Combining CRISPR and CRISPRi Systems for ... - ACS Publications

Research Article pubs.acs.org/synthbio

Combining CRISPR and CRISPRi Systems for Metabolic Engineering of E. coli and 1,4-BDO Biosynthesis Meng-Ying Wu,*,† Li-Yu Sung,*,† Hung Li,* Chun-Hung Huang,* and Yu-Chen Hu* Department of Chemical Engineering, National Tsing Hua University, Hsinchu 30013, Taiwan S Supporting Information *

ABSTRACT: Biosynthesis of 1,4-butanediol (1,4-BDO) in E. coli requires an artificial pathway that involves six genes and time-consuming, iterative genome engineering. CRISPR is an effective gene editing tool, while CRISPR interference (CRISPRi) is repurposed for programmable gene suppression. This study aimed to combine both CRISPR and CRISPRi for metabolic engineering of E. coli and 1,4-BDO production. We first exploited CRISPR to perform point mutation of gltA, replacement of native lpdA with heterologous lpdA, knockout of sad and knock-in of two large (6.0 and 6.3 kb in length) gene cassettes encoding the six genes (cat1, sucD, 4hbd, cat2, bld, bdh) in the 1,4-BDO biosynthesis pathway. The successive E. coli engineering enabled production of 1,4-BDO to a titer of 0.9 g/L in 48 h. By combining the CRISPRi system to simultaneously suppress competing genes that divert the flux from the 1,4-BDO biosynthesis pathway (gabD, ybgC and tesB) for >85%, we further enhanced the 1,4-BDO titer for 100% to 1.8 g/L while reducing the titers of byproducts gamma-butyrolactone and succinate for 55% and 83%, respectively. These data demonstrate the potential of combining CRISPR and CRISPRi for genome engineering and metabolic flux regulation in microorganisms such as E. coli and production of chemicals (e.g., 1,4-BDO). KEYWORDS: CRISPR, CRISPRi, 1,4-BDO, genome engineering, gene knockdown, metabolic engineering

enzyme activities are inhibited by high NADH levels under anaerobic conditions.1 Nonetheless, R164L mutation in gltA and replacement of native lpdA with D354 K mutant lpdA from Klebsiella pneumonia (denoted as K.p.lpdA (D354 K)) can enhance the enzyme function anaerobically.1 Moreover, succinate semialdehyde dehydrogenase encoded by sad (NAD-dependent) and gabD (NADP-dependent) converts succinyl semialdehyde, an intermediate in the synthetic 1,4BDO pathway, back to succinate (Figure 1). Knockout of sad and gabD genes in E. coli can repress the carbon flux channeling backward to succinate and hence increase the production of 4HB.3 Finally, gamma-butyrolactone (GBL) is a byproduct from 4-hydroxybutyryl-CoA, which is catalyzed by acyl-CoA thioesterase encoded by ybgC and tesB (Figure 1). Deletion of ybgC and tesB enhances the 1,4-BDO production.3 The development of engineered E. coli strain involves iterative gene mutation, deletion and insertion, which is labor-intensive and time-consuming. Recently, CRISPR-Cas9 (referred to as CRISPR thereafter) has emerged as a promising RNA-guided system for effective genome engineering of numerous eukaryotic5−8 and prokaryotic9,10 cells including E. coli.11−16 CRISPR system comprises the Cas9 nuclease, transacting RNA (tracrRNA) and CRISPR RNA (crRNA). crRNA contains the spacer sequence responsible for recognizing the protospacer sequence on target DNA. The Cas9/

1,4-butanediol (1,4-BDO) is a commodity chemical used in the manufacture of fibers, plastics, and solvents, and has a global market exceeding 2−2.5 million tons per year.1 In nature, 1,4BDO is not known to be produced by any microbe and is currently produced from fossil feedstocks.2,3 In 2011, scientists from Genomatica (San Diego, USA) reported the first development of engineered E. coli strain for 1,4-BDO biosynthesis by introducing a synthetic pathway to overexpress two E. coli native enzymes and four heterologous enzymes that convert intracellular succinate and α-ketoglutarate to 1,4BDO.1 Subsequently, it was also shown that 1,4-BDO biosynthesis in E. coli can be achieved by introducing an artificial pathway involving six exogenous genes: cat1 (succinate CoA transferase), sucD (CoA-dependent succinyl semialdehyde dehydrogenase), 4hbd (4-hydroxybutyrate dehydrogenase), cat2 (4-hydroxybutyryl CoA transferase), bld (butyraldehyde dehydrogenase) and bdh (butanol dehydrogenase).4 These gene products rewire the TCA cycle under microaerobic conditions and channel the flux of TCA cycle intermediates succinate and succinyl-CoA toward the synthesis of succinyl semialdehyde, 4-hydroxybutyrate (4HB), 4-hydroxybutyrylCoA, 4-hydroxybutyraldehyde and finally 1,4-BDO (Figure 1). 1,4-BDO production titer can be enhanced by knocking out arcA that inhibits flux entry into the TCA cycle and four more genes (adhE, ldhA, mdh, pf lB) whose gene products lead to byproduct production.1,4 Furthermore, lpdA (E3 subunit of pyruvate dehydrogenase) and gltA (citrate synthase) are essential for carbon flux into TCA cycle (Figure 1) but the © XXXX American Chemical Society

Received: July 8, 2017 Published: August 30, 2017 A

DOI: 10.1021/acssynbio.7b00251 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 1. 1,4-BDO biosynthetic pathway in E. coli. 1,4-BDO biosynthesis in E. coli can be achieved by introducing a synthetic pathway involving 6 exogenous genes: cat1, sucD, 4hbd, cat2, bld and bdh (labeled in black and bold). These gene products redirect the flux of succinate and succinyl-CoA toward the synthesis of succinyl semialdehyde, 4-hydroxybutyrate (4HB), 4-hydroxybutyryl-CoA, 4-hydroxybutyraldehyde and finally 1,4-BDO. The genes leading to the byproduct (gamma-butyrolactone) formation (ybgC and tesB) and channeling succinyl semialdehyde backward to succinate (sad and gabD) are shown in red font. lpdA and gltA genes are important to direct the pyruvate flux into TCA cycle (labeled with asterisk). cat1, succinate CoA transferase; sucD, CoA-dependent succinyl semialdehyde dehydrogenase; 4hbd, 4-hydroxybutyrate dehydrogenase; cat2, 4-hydroxybutyryl CoA transferase; bld, butyraldehyde dehydrogenase; bdh, butanol dehydrogenase; sad, NAD-dependent succinate semialdehyde dehydrogenase; gabD, NADP-dependent succinate semialdehyde dehydrogenase.

combining CRISPR and CRISPRi for metabolic engineering of E. coli and 1,4-BDO production.

crRNA/tracrRNA complex acts in concert to recognize protospacer-adjacent motif (PAM), binds to proximal protospacer DNA and triggers double strand break (DSB). The crRNA/tracrRNA duplex can replaced by a chimeric single guide RNA (sgRNA) that mimics the crRNA:tracrRNA duplex structure. Furthermore, catalytically deactivated Cas9 (dCas9) has been developed and used in conjunction with the chimeric sgRNA for specific binding to target gene and blocking of gene transcription.17 This newly developed CRISPR interference (CRISPRi) technology has been repurposed for gene knockdown in diverse prokaryotic cells including E. coli18−24 for rewiring metabolic networks and bioderived chemical production. Despite the potential of CRISPR and CRISPRi for genome engineering and gene regulation in E. coli, CRISPR and CRISPRi have yet to be combined for the metabolic engineering of E. coli. Neither has CRISPR or CRISPRi been harnessed for microbial production of 1,4-BDO. Here we aimed to combine both CRISPR and CRISPRi to engineer E. coli for 1,4-BDO production. We employed CRISPR to perform point mutation of gltA (R164 → L164), replacement of native lpdA to K.p.lpdA (D354 K), knockout of sad and knock-in of two large gene cassettes (6.0 and 6.3 kb in length) encoding the upstream (cat1, sucD, 4hbd) and downstream (cat2, bld, bdh) pathways of 1,4-BDO biosynthesis. The successive E. coli modification enabled the production of 1,4-BDO to a titer of 0.9 g/L. We further exploited CRISPRi to simultaneously suppress gabD, ybgC and tesB genes to prevent the diversion of flux away from the 1,4-BDO biosynthesis pathway, which further enhanced the 1,4-BDO titer for 100% to 1.8 g/L while reducing the titers of byproducts GBL and succinate for 55% and 83%, respectively. These data demonstrate the potential of

■

RESULTS Point Mutation of gltA by CRISPR. The overall pathway scheme for 1,4-BDO production is shown in Figure 1. We started from an E. coli W strain, WΔ5, whose adhE, ldhA, mdh, pf lB and arcA were knocked out by conventional λ-Red recombineering approach. To introduce R164L mutation to gltA, we constructed pCRISPR::gltA (Figure 2A) expressing the crRNA that targeted a protospacer near R164 of gltA, and synthesized a gltA oligonucleotide template containing R164L mutation (Figure 2A and Table S2). E. coli WΔ5 was coelectroporated with pCas9′ (expressing Cas9 and tracrRNA14) and pKD46 (encoding λ-Red proteins Gam, Bet and Exo), induced by arabinose for λ-Red protein expression, followed by electroporation with pCRISPR::gltA alone (Control group) or coelectroporation with pCRISPR::gltA and the oligonucleotide template (Figure 2B). Coexistence of pCas9′ and pCRISPR::gltA in the Control group resulted in significant reduction of colony number, indicating substantial cell death triggered by CRISPR/Cas9-mediated DSB (data not shown). Nonetheless, coelectroporation of the oligonucleotide template tremendously increased the colony numbers (data not shown), indicating that integration of the oligonucleotide template occurred and rescued the cells. To attest the R164L point mutation in gltA, we designed primers P1 and P2 (Figure 2C and Table S3) for colony PCR analysis so that successful R164L mutation would give a 510 bp amplicon. Figure 2C reveals a number of colonies with positive signals (Figure 2C). Sanger sequencing of the positive colonies (Figure 2D) confirmed the mutation of R164 (CGC) to L164 B


Research Article


Figure 2. Point mutation of gltA gene by CRISPR. (A) Vectors and oligonucleotide template for point mutation. The sequence of crRNA was 5′ggtcggcattttcgacagcaggcggaacg-3′, which cannot target the mutant form of gltA gene. (B) Schematic illustration of CRISPR-mediated DSB and recombination. (C) Schematic illustration of primers (P1/P2) used for confirming R164L point mutation of gltA and the colony PCR analysis. (D) Sanger sequencing to verify the correct R164L point mutation.

the same region of lpdA. Co-electroporation of pCas9′ and psgRNA_lpdA into E. coli WΔ5#1 resulted in nearly 100% cell death (Figure 3A), suggesting that sgRNA was more effective than the crRNA::tracrRNA duplex in recognizing the target DNA sequence to induce DSB. Therefore, sgRNA was used in all subsequent experiments for targeting. To continue lpdA editing in WΔ5#1, we constructed a plasmid harboring K.p.lpdA (D354 K), tetracycline resistance gene (TcR) flanked by Frt sequences and a pair of 50 bp homology arms that targeted lpdA, and PCR-amplified the linear donor DNA (≈3.0 kb, Figure 3B). The donor DNA was

(CTG). The resultant E. coli strain was designated E. coli WΔ5#1 (Figure 2B) and the plasmids were cured (Figure S2). Replacement of lpdA with K.p.lpdA (D354 K) by CRISPR. To replace the native lpdA with K.p.lpdA (D354 K), we constructed pCRISPR::lpdA that expressed the crRNA targeting lpdA. However, coelectroporation of pCas9′ and pCRISPR::lpdA into E. coli WΔ5#1 did not cause high death rate when compared with the control cells transformed with pCas9′ and pCRISPR::ϕ expressing the scramble crRNA (Figure 3A). To overcome this problem, we reconstructed psgRNA_lpdA (Figure 3B) expressing the sgRNA that targeted C


Research Article


Figure 3. Replacement of lpdA with K.p.lpdA (D354 K) by CRISPR. (A) Comparison of cell death induced by tracrRNA:crRNA and sgRNA. The protospacer sequence for crRNA and sgRNA was 5′-acctaaatcagcgcaacgga-3′. E. coli WΔ5#1 harboring pCas9′ was electroporated with pCRISPR::ϕ, pCRISPR::lpdA or psgRNA_lpdA. The cells were diluted and plated onto Cm/Km agar plates. (B) Schematic illustration of DSB induction and replacement of lpdA gene with K.p.lpdA (D354 K). (C) Schematic illustration of primers (P3/P4) used for confirming correct replacement of lpdA and the colony PCR analysis.

and TcR flanked by Frt sequences. Linear donor DNA with flanking homology arms (HRR and HRL) was PCR-amplified from these plasmids. The first step involved the integration of upstream genes (cat1, sucD and 4hbd) into lacZ gene (which allows for easy screening by blue/white colonies). Thus, we constructed psgRNA_lacZ that expressed the sgRNA targeting lacZ and coelectroporated this plasmid with the 6.3 kb donor DNA (encoding cat1, sucD and 4hbd, TcR and homology arms targeting lacZ locus) into WΔ5#2 that were pre-electroporated with pCas9′ and pKD46 (Figure 4B). After electroporation, the cells were recovered and plated onto Tc/Km/IPTG/X-gal agar plate. To verify precise integration into lacZ locus, we performed colony PCR of white colonies (with lacZ disrupted by the integrated gene) using primer pairs P5/P6 and P7/P8 (Figure 4C) that spanned the left and right junctions of the integration site, respectively. Figure 4C reveals correct amplicons (≈1 kb) for the left and right junctions in all 8 colonies tested. Colony PCR using P5/P8 also yielded full amplicons (Figure S4), confirming highly efficient and precise integration of the 6.3 kb cassette. The resultant E. coli strain was designated WΔ5#3 (Figure 4B). The residual plasmids were

coelectroporated with psgRNA_lpdA into WΔ5#1 that was pre-electroporated with pCas9′and pKD46 and induced with arabinose for λ-Red protein expression (Figure 3B). After electroporation, the cells were recovered and plated onto Km/ Tc agar plates. Colony PCR using primers P3/P4 (Figure 3C and Table S3) specific to the genomic sequences flanking the native lpdA gene confirmed that all 8 colonies contained the new 3.0 kb cassette comprising K.p.lpdA (D35K) and TcR. Such high editing efficiency of a 3.0 kb DNA agreed well with our previous findings.14 The resultant E. coli strain was designated WΔ5#2 (Figure 3B) and the residual plasmids were cured and TcR gene was removed via FLP/Frt recombination (Figure S3). Integration of Synthetic 1,4-BDO Pathway into E. coli by CRISPR. It was shown that CRISPR-mediated DSB enhances the homologous recombination efficiency but the efficiency drops significantly when the gene fragment is as large as 12 kb14 Since the 6 genes in the 1,4-BDO biosynthetic pathway, when combined, were nearly 12 kb, we introduced the pathway into WΔ5#2 in 2 steps. We constructed two plasmids (Figure 4A) each expressing 3 genes (cat1, sucD and 4hbd in pTA_CSHt; cat2, bld and bdh in pTA_CBBt) driven by constitutive lac promoter (lac promoter without the operator) D


Research Article


Figure 4. Integration of upstream 1,4-BDO biosynthetic pathway genes by CRISPR. (A) Schematic illustration of pTA_CSHt and pTA_CBBt. (B) Schematic illustration of DSB induction and integration of 3 genes (cat1, sucD and 4hbd) into lacZ locus. (C) Colony PCR analysis using primers (P5/P6 and P7/P8) that spanned the left and right junctions of integration site. Colony PCR of 8 colonies yielded ≈1 kb amplicons using both primer pairs.

cured and TcR gene was removed via FLP/Frt recombination (Figure S5). Since sad deletion can increase the production of 4 hydroxybutyrate,3 we next introduced the downstream genes (cat2, bld and bdh) into sad locus. We constructed psgRNA_sad that expressed sgRNA targeting the sad gene and coelectroporated this plasmid with the 6.0 kb donor DNA (comprising cat2, bld, bdh, TcR and homology arms targeting the sad locus) into WΔ5#3 pre-electroporated with pCas9′ and pKD46 (Figure 5A). Colony PCR using primer pairs spanning the left and right junctions of the integration site (P9/P10 and P7/P11, Figure 5B) and the entire cassette (P9/11, Figure S6) attested successful integration of the 6.0 kb cassette in 6 out of 7 colonies tested. The resultant E. coli strain was designated WΔ5#4 (Figure 5A). The residual plasmids were cured and TcR cassette was removed (Figure S7). To examine the 1,4-BDO production by WΔ5#4 with the complete synthetic pathway, we cultured cells in M9 minimal

medium aerobically to OD600 1.0 and then switched into microaerobic condition for 1,4-BDO production. After 24 and 48 h fermentation, the wild-type (WT) E. coli did not produce detectable 1, 4-BDO but WΔ5#4 strain successfully produced 0.6 g/L and 0.9 g/L of 1,4-BDO (Figure 5C). Enhanced 1,4-BDO Production by CRISPRi-Mediated Knockdown of Endogenous Genes. To further enhance 1,4-BDO yield, we constructed pdCas9 expressing dCas9 under the inducible PLtetO1 promoter and 2 plasmids constitutively expressing an sgRNA array targeting the nontemplate strands of gabD, ybgC and tesB genes that could reduce the 1,4-BDO yield (Figure 6A): psgRNA_gyt expressing one set of sgRNA while psgRNA_gyt2 expressing an additional set of sgRNA (2 sets in all). E. coli WΔ5#4 was coelectroporated with pdCas9 with psgRNA_gyt (WΔ5#4+gyt strain) or psgRNA_gyt2 (WΔ5#4+gyt2 strain), recovered and plated onto Cm/Ap agar plate. Colonies were picked and grown in induction medium containing 10 μg/mL aTc to induce the dCas9 protein E


Research Article


Figure 5. Integration of downstream 1,4-BDO biosynthetic pathway genes by CRISPR. (A) Schematic illustration of DSB induction and integration of 3 genes (cat2, bld, bdh) into sad gene. (B) Colony PCR analysis using primers (P9/P10 and P7/P11) that spanned the left and right junctions of integration site. Colony PCR of 7 colonies yielded ≈1 kb amplicons using both primer pairs. (C) Titers of 1,4-BDO (g/L) at 24 and 48 h. The titers represent means ± SD of 3 independent culture experiments.

expression for 16 h. qRT-PCR analysis showed that gabD, ybgC and tesB expression in the WΔ5#4+gyt strain was significantly suppressed to ≈12.4%−14.1% that in the WΔ5#4 strain (Figure 6B). Intriguingly, the expression of gabD, yabC and tesB in the WΔ5#4+gyt2 strain was not further suppressed, suggesting that targeting with additional sgRNA might not further substantiate the repression. To evaluate the 1,4-BDO titer, WΔ5#4 and WΔ5#4+gyt strains were cultivated for 48 h under microaerobic conditions as in Figure 5C. Figure 6C depicts that after 48 h the 1,4-BDO titer in the culture supernatant was enhanced 100%, from 0.9 g/ L in the WΔ5#4 strain to 1.8 g/L in the WΔ5#4+gyt strain. Concurrently, after 48 h GBL titer was reduced for 55%, from 1.1 g/L in the WΔ5#4 strain to 0.5 g/L in the WΔ5#4+gyt strain (Figure 6C). Succinate titer at 48 h was reduced for 83%, from 3.0 mg/L in the WΔ5#4 strain to 0.5 mg/L in the WΔ5#4+gyt strain These data indicated that CRISPRimediated suppression of gabD, ybgC and tesB genes successfully repressed byproduct formation and backward flux, thereby enhancing the 1,4-BDO production for ≈100%.

the strain are desired for commercial scale production in order to avoid the use of expensive and unnecessary antibiotics and chemical inducers.3,16 Furthermore, the final producer strains typically require cumbersome, iterative genome engineering by mutating, deleting and inserting multiple genes. For instance, more than 50 genetic changes are performed in Genomatica’s producer E. coli strain for commercial 1,4-BDO biosynthesis.3 Although genome engineering based on λ Red-mediated recombineering has become a routine practice, it is inefficient in integrating DNA beyond 3.5 kb,28 thus necessitating multiple rounds of gene knock-in if the gene cluster is large. By contrast, CRISPR/Cas9 enhances the efficiency of integrating large DNA fragments into E. coli,14,15,29 thus allowing us to knock-in multiple genes into the genome at a time. Here we exploited CRISPR technology to perform highly efficient point mutation, gene replacement, as well as simultaneous gene knockout and integration of 2 pathway gene cassettes exceeding 6 kb for 1,4-BDO production (Figures 2−5). We found that sgRNA was more effective than crRNA/ tracrRNA in mediating the DSB (Figure 3A), probably because sgRNA does not require the RNase processing of crRNA/ tracrRNA. The resultant 1,4-BDO titer reached 0.9 g/L, which was higher than the titer (0.66 g/L) using the same synthetic pathway.4 Importantly, we also explored CRISPRi to selectively knockdown genes (gabD, yabC and tesB) that could divert the carbon flux away from the synthetic pathway, thus reducing byproduct formation and further augmenting the 1,4-BDO product titer for 100% to 1.8 g/L (Figure 6). In previous studies, these competing genes are knocked out.2,3 However, deletion of genes involved in cell metabolism, intracellular

■

DISCUSSION 1,4-BDO is not naturally produced by microbes. To date, several studies have demonstrated 1,4-BDO biosynthesis by introducing different synthetic pathways into E. coli, allowing the cells to utilize glucose1,4 or xylose25−27 as the major carbon source for 1,4-BDO production. These studies employed plasmids to express the essential genes in the artificial pathways for 1,4-BDO production. However, integration of pathway/ accessory genes and expression under constitutive promoters in F


Research Article


Figure 6. Enhanced 1,4-BDO production by CRISPRi-mediated knockdown of endogenous genes. (A) Illustration of pdCas9, psgRNA_gyt, and psgRNA_gyt2. gabD1, gabD2, ybgC1, ybgC2, tesB1 and tesB2 are the sgRNA targeting different regions of endogenous genes. (B) Relative expression levels of gabD, ybgC and tesB. The data were analyzed using qRT-PCR and normalized to those in the WΔ5#4 strain. (C) 1,4-BDO titer (g/L). (D) GBL titer (g/L). (E) Succinate titer (mg/L). The titers were measured at 48 h. All data represent means ± SD of 3 independent culture experiments.

transport, and/or survival may compromise cells’ ability to grow and produce the desired product, hence maximum titer might be achieved by lowering the expression to intermediate levels.30 Under these circumstances, CRISPRi provides a flexible tool to repress endogenous gene expression without completely abolishing the gene functions, hence allowing us to intricately fine-tune the metabolic flux in the cells. Furthermore, with appropriate sgRNA library targeting various genes at different regions relative to the transcription start site, CRISPRi

would allow for suppression of multiple pathway genes to varying degrees and hence enable interrogation of how controlling local gene expression would improve global metabolic flux and final product yield. Taken together, here we demonstrate, for the first time, the feasibility of metabolically engineering E. coli for 1,4-BDO production by the combination of CRISPR and CRISPRi. The final titer is lower than that (>120 g/L) achieved by the production strain developed by Genomatica, which is subjected G


Research Article


sequences49). The dsDNA spacer targeting the cognate protospacer on gltA or lpdA genes were chemically synthesized and subcloned into pCRISPR::ϕ between the 2 DRs with Eco31I to yield pCRISPR::gltA or pCRISPR::lpdA. All plasmids expressing sgRNA were derived from pgRNAbacteria plasmid (Addgene, #44251) which accommodated ApR and an sgRNA backbone driven by constitutive P J23119 promoter.17 The sgRNA backbone comprised the 20 bp spacer region, dCas9 handle (42 bp) and the S. pyogenes terminator (40 bp). To generate plasmids expressing the sgRNA targeting lpdA, lacZ or sad genes, ApR was digested and replaced with KmR to avoid conflict with ApR on pKD46. We next designed a reverse primer gRNA_R and specific forward primers with different spacer sequences (Table S1) and performed inverse PCR (iPCR) using the backbone plasmid as the template DNA in order to replace the spacer sequence on the sgRNA backbone.50 The resultant PCR products were phosphorylated using T4 polynucleotide kinase and joined using T4 DNA ligase to form new plasmids containing KmR, PJ23119 promoter and sgRNA targeting different locus on the E. coli W chromosome, which were designated psgRNA_lpdA, psgRNA_lacZ and psgRNA_sad, respectively. To construct psgRNA_gyt, 3 plasmids each encoding one sgRNA that targeted the nontemplate strand in the coding region of gabD, ybgC or tesB genes were constructed using specific primers (Table S1) and iPCR as described above. The 3 sgRNAs were assembled using the BioBrick method50 (designated as gabD1-ybgC1-tesB1) and cloned into the pgRNA-bacteria plasmid to replace the original sgRNA backbone. Likewise, another 3 plasmids each encoding one sgRNA that targeted another region of the nontemplate strand in the gabD, ybgC and tesB genes were constructed. The 3 sgRNA were assembled using the BioBrick method (designated as gabD2-ybgC2-tesB2) and cloned into psgRNA_gyt so that the resultant psgRNA_gyt2 contained two sgRNA arrays. All sgRNAs were driven by PJ23119 promoter. For the R164L mutation of gltA, an 80 nt gltA oligonucleotide containing the R164L mutation in the middle was chemically synthesized (Table S2). To swap the native lpdA with K.p.lpdA (D354 K), the entire K.p.lpdA (D354 K) gene was chemically synthesized and subcloned into pTA_Frt_Tc vector (Figure S1) which contained the tetracycline resistance gene (TcR) flanked by Frt sequences. The resultant plasmid was designated pTA_lpdA_Tc. Genes encoding cat1 (from C. kluyveri), sucD (from P. gingivalis), 4hbd (from P. gingivalis), cat2 (from P. gingivalis), bld (from C. saccharoperbutylacetonicum), bdh (from C. saccharoperbutylacetonicum) were codon-optimized for E. coli and chemically synthesized. All these 6 genes contained the same ribosome binging site (TCTAGAGAAAGAGGAGAAATACTAG, BBa_B0034 in http://parts.igem.org/Ribosome_ Binding_Sites/Prokaryotic/Constitutive/Community_ Collection) and their respective start and stop codons. cat1, sucD and 4hbd were assembled together with a terminator and cloned into pTA_Frt_Tc vector downstream of the constitutive lac promoter (lac promoter devoid of the operator). The resultant pTA_CSHt harbored the cat1, sucD and 4hbd genes and TcR flanked by Frt sites. Similarly, cat2, bld and bdh genes were assembled together with the terminator and cloned into pTA_Frt_Tc downstream of the constitutive lac promoter to yield pTA_CBBt. These two plasmids served as the templates for PCR to prepare linear donor DNA for integration of these 6 genes. All plasmids are tabulated in Table 1.

to extensively more genetic modifications such as mutation (e.g., cat2), deletion (e.g., gabT and puuE) and overexpression of extra genes (e.g., ackA-pta).2 Further improvement of our strain may be achieved by metabolic modeling, proteomic/transcriptomic analyses, protein engineering as well as multiplex genome engineering by CRISPR/CRISPRi. Meanwhile, here we followed the protocol developed recently14 and electroporated pCas9′ into the cells in each round of CRISPRmediated engineering. This process may be simplified by integrating the Cas9 gene under the control of a stringently inducible promoter and turning on Cas9 expression whenever needed. The template donor DNA was prepared in the form of PCR amplicon for coelectroporation into the cells, which may be obviated by using a single plasmid harboring the donor gene and sgRNA array that includes two gRNA to cut the donor template DNA in vivo for subsequent gene integration. Conversely, in this study the antibiotic-resistance gene was removed by the FLP/Frt-mediated recombination, which can be simplified in future studies by CRISPR-induced DSB within the antibiotic-resistance gene for direct replacement by the next incoming gene, thus enabling markerless and seamless engineering. Additionally, here the CRISPRi system was maintained in the plasmid form. The dCas9 gene derived from S. pyogenes may be replaced with an orthogonal dCas9 (e.g., dCas9 derived from Staphylococcus aureus31,32) and integrated into the genome along with the sgRNA array needed for CRISPRi suppression, which would enable permanent suppression of genes that mitigate the 1,4-BDO titer. Finally, CRISPR has been exploited for programmable genome engineering of other microorganisms such as Clostridium,33 Streptomyces,34 Actinomycetes,35 Bacillus subtilis,36 S. cerevisiae29,37,38 and cyanobacteria.39 Conversely, CRISPRi has been used for modulation and analysis of gene expression in various eukaryotic cells (e.g., CHO cells40) and microorganisms including Corynebacterium glutamicum,41 Mycobacterium tuberculosis,42 Bacillus subtilis,43 Halomonas44 and cyanobacteria,45−47 etc. As such, the concept of combining CRISPR and CRISPRi for metabolic engineering of E. coli may be expanded to the genome engineering and gene regulation in these microorganisms for the production of various bioderived chemicals.

■

MATERIALS AND METHODS E. coli Strains. All molecular cloning works were conducted using E. coli DH5-α (New England Biolabs) as the host. E. coli W (ATCC 9637) was used as the parent strain for genome engineering and 1,4-BDO biosynthesis. Plasmids Construction. pKD46 plasmid48 harbored the temperature-sensitive oriR101 with repA101ts for curing at 37 °C, ampicillin resistance gene (ApR) and λ-Red operon (encoding Gam, Bet and Exo proteins) under the control of arabinose-inducible promoter ParaB. pCas9′ was derived from pCas9 (Addgene #42876) that harbored chloramphenicol resistance gene (CmR), S. pyogenes-derived cas9 and tracrRNA driven by respective native promoters, but a sequence (6764− 7852 bp) in the original pCas9 was removed to prevent the recombination of donor DNA into the plasmid.14 The plasmid pdCas9 was purchased from Addgene (#44249), which harbored CmR and dCas9 gene (derived from S. pyogenes) driven by anhydrotetracycline (aTc)-inducible PLtetO1 promoter. pCRISPR::ϕ (Addgene #42875) harbored kanamycin resistance gene (KmR) and scrambled crRNA (containing 2 direct repeats (DRs) but lacking the spacer targeting any E. coli H


Research Article


and arabinose to induce the λ Red protein expression, and cultured at 30 °C to OD600 = 0.4−0.6. The cells were made competent and then coelectroporated with pCRISPR::gltA (100 ng) and the 80 nt gltA(R164L) oligonucleotide template (10 μM). After coelectroporation, the cells were recovered in 2 mL SOC medium in a 12 mL culture tube (250 rpm) for 2.5 h at 37 °C and plated onto the Cm/Km plate for 20−24 h at 37 °C as described earlier.14 The pKD46 plasmid was cured at 37 °C. The colonies were picked for colony PCR and Sanger sequencing to verify the correct point mutation. The clone with the correct gltA(R164L) mutation was designated WΔ5#1 stain. The pCRISPR::gltA and pCas9′ were cured as shown in Figure S2. To replace the native lpdA with K.p.lpdA (D354 K), we designed a pair of ≈70 nt primers that comprised 20 nt sequences complementary to pTA_lpdA_Tc and 50 nt homology arm sequences complementary to both ends of native lpdA. The linear donor DNA comprising the K.p.lpdA (D354 K), TcR and the homology arms for lpdA was PCRamplified using the primer pairs and pTA_lpdA_Tc as the template. We coelectroporated WΔ5#1 cells with pCas9′ and pKD46, recovered, plated and cultured the cells with Cm/Ap and arabinose (to induce λ Red protein expression) as described above. The competent cells were coelectroporated with psgRNA_lpdA (100 ng) and the linear donor DNA (1500 ng) encoding K.p.lpdA (D354 K), recovered in 2 mL SOC medium in a 12 mL culture tube (250 rpm) for 2.5 h at 37 °C and plated onto the Tc/Km plate for 20−24 h at 37 °C.14 The pKD46 plasmid was cured at 37 °C. The colonies were picked for colony PCR using primers flanking the native lpdA gene. The clones containing the K.p.lpdA (D354 K) gene was designated WΔ5#2. The pCas9′ and psgRNA_lpdA plasmids were cured and TcR was removed by FLP/Frt-mediated recombination (Figure S3). To integrate cat1, sucD and 4hbd into the lacZ locus, we PCR-amplified the linear donor DNA (6.3 kb) comprising cat1, sucD, 4hbd, TcR and flanking Frt sites as well as the left and right homology arms (HRL and HRR) for replacing the entire lacZ gene, using pTA_CSHt as the template and the primers pairs (≈70 nt) that contained 20 nt sequences complementary to pTA_CSHt and 50 nt homology arm homologous to flanking sequences adjacent to the native lacZ gene. Meanwhile, we coelectroporated WΔ5#2 cells with pCas9′ and pKD46, recovered, plated and cultured the cells with Cm/Ap and arabinose as described above. The competent cells were coelectroporated with psgRNA_lacZ (100 ng) and the 6.3 kb linear donor DNA (1500 ng), recovered in 2 mL SOC medium in a 12 mL culture tube (250 rpm) for 2.5 h at 37 °C and plated onto the Tc/Km/IPTG/X-gal (for blue/white screening) plate for 20−24 h at 37 °C. The white colonies were picked for colony PCR using primers flanking the integration sites and the entire lacZ gene (Figure S4). The clones containing the cat1, sucD and 4hbd genes were designated WΔ5#3. The pCas9′ and psgRNA_lacZ plasmids were cured and TcR was removed (Figure S5). To integrate cat2, bld and bdh into the sad locus, we PCRamplified the linear donor DNA (6.0 kb) comprising cat2, bld, bdh, TcR and flanking Frt sites as well as the left and right homology arms for replacing the entire sad gene, using pTA_CBBt as the template and the primers pairs (≈70 nt) that contained 20 nt sequences complementary to pTA_CBBt and 50 nt homology arms homologous to the flanking sequences adjacent to the sad gene. Next, we coelectroporated

Table 1. Strains and Plasmids Used in This Study designation Plasmids pKD46 pCas9′ pdCas9 pCRISPR::ϕ pCRISPR::gltA pCRISPR::lpdA pgRNA-bacteria psgRNA(Km) psgRNA_lpdA psgRNA_lacZ psgRNA_sad psgRNA_gyt psgRNA_gyt2 pTA_lpdA_Tc pTA_CSHt pTA_CBBt

description

references

Expressed λ-red recombinase (gam, bet, exo), 48 ParaB, oriR101, repA101(Ts), ApR 14 Expressed S. pyogenes cas9 and tracrRNA, P15A ori, CmR 17 Expressed S. pyogenes dcas9, PLtetO1, CmR R 49 Expressed scramble crRNA, pBR322 ori, Km Expressed crRNA(gltA), KmR This study Expressed crRNA(lpdA), KmR This study 17 Expressed sgRNA plasmid, PJ23119, ApR Expressed sgRNA plasmid, PJ23119, KmR This study Expressed sgRNA(lpdA), PJ23119, KmR This study Expressed sgRNA(lacZ), PJ23119, KmR This study Expressed sgRNA(sad), PJ23119, KmR This study Expressed 3 sgRNA targeting gabD, ybgC and This tesB, PJ23119, ApR study Expressed 6 sgRNA targeting gabD, ybgC and This tesB, PJ23119, ApR study pTA vector containing K.p.lpdA (D354 K) This and TcR flanked by Frt sequences, ApR study pTA vector containing constitutive lac This promoter, cat1, sucD, 4hbd, and TcR flanked study by Frt sequences, ApR pTA vector containing constitutive lac This promoter, cat2, bld, bdh, and TcR flanked by study R Frt sequences, Ap

Strains E. coli W

Wild-type E. coli W

E. coli WΔ5

E. coli W Δpf lBΔarcAΔmdhΔadhEΔldhA

E. coli WΔ5#1

E. coli WΔ5 gltA(R164L)

E. coli WΔ5#2

E. coli WΔ5#1 ΔlpdA::k.p.lpdA (D354 K)

E. coli WΔ5#3

E. coli WΔ5#2 ΔlacZ::cat1-sucD-4hbd

E. coli WΔ5#4

E. coli WΔ5#3 Δsad::cat2-bld-bdh

E. coli WΔ5#4+gyt E. coli WΔ5#4+gyt2

E. coli WΔ5#4 harboring pdCas9 and psgRNA_gyt E. coli WΔ5#4 harboring pdCas9 and psgRNA_gyt2

ATCC 9637 This study This study This study This study This study This study This study

Genome Engineering and Strain Development. To construct the recombinant E. coli W for 1,4-BDO production, we first deleted pf lB, ldhA, mdh, adhE, and arcA genes using the λ-Red recombineering approach48 to yield WΔ5 strain. Antibiotics Cm (34 μg/mL), Ap (100 μg/mL), Km (50 μg/ mL) and Tc (10 μg/mL) were used alone or in combination for selection. IPTG (0.05 mM) and arabinose (1 mM) were used for inducing β-galactosidase and λ-Red proteins, respectively. X-gal (200 μg/mL) was used to detect βgalactosidase. To introduce R164L mutation to gltA, WΔ5 cells were first coelectroporated with pCas9′ and pKD46, recovered at 30 °C for 1 h and plated onto Cm/Ap agar plates. The colonies were picked and cultured overnight in 3 mL LB medium containing Cm/Ap. The cells were seeded (diluted 100-fold) to the shake flask containing 30 mL LB medium supplemented with Cm/Ap I


Research Article


Analytical Methods. The culture broth (3 mL) was withdrawn from the reactor, filtered with 0.22 μm and the supernatant was analyzed by LC−MS (LCMS-2020, Shimadzu) using the Hypersil GOLD C18 Column (for 1,4-BDO and GBL) or Acclaim Organic Acid column (for succinate). The mobile phase was acetonitrile (ACN) plus 0.1% formic acid. All data represent means ± SD of 3 independent culture experiments.

WΔ5#3 cells with pCas9′ and pKD46, recovered, plated and cultured the cells with Cm/Ap and arabinose as described above. The competent cells were coelectroporated with psgRNA_sad (100 ng) and the 6.0 kb linear donor DNA (1500 ng), recovered as described above for 2.5 h at 37 °C and plated onto the Tc/Km plate for 20−24 h at 37 °C. The colonies were picked for colony PCR using primers flanking the entire sad gene (Figure S6) or the integration sites. The clones containing the cat2, bld and bdh genes were designated WΔ5#4. The pCas9′ and psgRNA_sad plasmids were cured and TcR was removed in the 3 mL culture tube (Figure S7) and the final WΔ5#4 strain was stored at −80 °C. To knockdown gabD, ybgC and tesB expression, WΔ5#4 cells were coelectroporated with pdCas9 and psgRNA_gyt (WΔ5#4+gyt strain) or psgRNA_gyt2 (WΔ5#4+gyt2 strain), recovered at 37 °C for 1 h and plated onto Cm/Ap agar plates. The colonies were picked, cultured in the 3 mL culture tube and the presence of pdCas9 and psgRNA_gyt (or psgRNA_gyt2) was confirmed by enzyme digestion. The resultant WΔ5#4+gyt strain and WΔ5#4+gyt2 strain were stored at −80 °C. All E. coli strains developed in this study are summarized in Table 1. Verification of Genome Engineering. The colonies grown on agar plates containing the appropriate antibiotics were picked and the correct gene mutation/replacement/ knockout/knock-in was verified by PCR using primer pairs as shown in Table S3. The R164L point mutation in the gltA gene was further verified by Sanger sequencing. qRT-PCR for mRNA Quantification. WΔ5#4 strain was thawed and cultured for 16 h in 3 mL culture tubes using LB medium. WΔ5#4+gyt and WΔ5#4+gyt2 strains were thawed and cultured similarly, but the LB medium contained Cm/Ap and aTc (100 ng/mL) to induce dCas9 expression and gene knockdown. Total RNA was extracted from the harvested cells using the NucleoSpin RNA II Kit (Macherey Acherey-Nagel), quantified using a spectrophotometer (Nanodrop 2000, Thermo) and 1 μg RNA was reverse-transcribed to cDNA using the MMLV Reverse Transcription first-strand cDNA Synthesis Kit (Epicenter Biotechnologies). The cDNA was diluted in 1 mL deionized water and stored at −20 °C. After thawing, 3 μL cDNA was mixed with 1.5 μL deionized water, 5 μL SYBR Green PCR Master Mix (Applied Biosystems) and 0.5 μL primer pairs specific to gabD, ybgC or tesB (10 μM). Subsequent quantitative real-time PCR (qPCR) was performed using StepOnePlus (Applied Biosystems) with 16S rRNA as the internal control. Gene expression levels in all groups were normalized to those in the WΔ5#4 strain. All data represent means ± standard deviation (SD) of 3 independent culture experiments. Fermentation Conditions. Frozen WΔ5#4 cells were thawed, seeded to a tube containing 3 mL LB medium and cultured overnight at 37 °C. The cells (3 mL) were transferred to an in-house reactor containing 300 mL M9 medium (Sigma, 1:100 dilution) supplemented with 1 mM MgSO4, 0.1 mM CaCl2, 10 mM NaHCO3, 20 g/L glucose and 100 mM MOPS and 0.2 g/L yeast extract, and cultured with sparging and agitation (1000 rpm). After OD600 reached 1.0, we added more glucose (20 g/L) and cultured the cells under microaerobic conditions (600 rpm, no sparging) at 37 °C for 48 h. WΔ5#4+gyt cells were cultured in the reactor similarly except that LB and M9 medium contained additional Cm/Ap and aTc (100 ng/mL) was added to induce dCas9 expression during the microaerobic fermentation.

■

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.7b00251. Map of pTA_Frt_Tc; Process of curing pCRISPR::gltA; Process of curing psgRNA_lpdA and deleting TcR; Colony PCR confirmation of integration of the entire donor DNA into lacZ gene; Process of curing psgRNA_lacZ and removing TcR; Colony PCR confirmation of integration of the entire donor DNA into sad gene; Process of curing psgRNA_sad and removing TcR; Primer sequences for psgRNA plasmid construction; Sequence of gltA (R164L) template; Primer sequences for colony PCR (PDF)

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. *E-mail: [email protected]. *E-mail: [email protected]. *Phone: (886)3-571-8245. Fax: (886)3-571-5408. E-mail: [email protected]. ORCID

Yu-Chen Hu: 0000-0002-9997-4467 Author Contributions †

MYW and LYS contributed equally to this work. MYW performed experiments and wrote the paper. LYS designed and performed experiments and wrote the paper. HL and CHH performed experiments. YCH designed experiments, supervised the students and wrote the paper. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We acknowledge Prof. Roa-Pu Shen for suggestions and Prof. James Liao for providing pKD46 plasmid for recombineering. This work was supported by the Ministry of Science and Technology (MOST 103-2622-E-007-025, 104-2622-8-007-001 and 105-2622-8-007-009), Taiwan.

■

REFERENCES

(1) Yim, H., Haselbeck, R., Niu, W., Pujol-Baxley, C., Burgard, A., Boldt, J., Khandurina, J., Trawick, J. D., Osterhout, R. E., and Stephen, R. (2011) Metabolic engineering of Escherichia coli for direct production of 1,4-butanediol. Nat. Chem. Biol. 7, 445−452. (2) Burgard, A., Burk, M. J., Osterhout, R., Van Dien, S., and Yim, H. (2016) Development of a commercial scale process for production of 1,4-butanediol from sugar. Curr. Opin. Biotechnol. 42, 118−125. (3) Barton, N. R., Burgard, A. P., Burk, M. J., Crater, J. S., Osterhout, R. E., Pharkya, P., Steer, B. A., Sun, J., Trawick, J. D., Van Dien, S. J., et al. (2015) An integrated biotechnology platform for developing

J


Research Article

ACS Synthetic Biology sustainable chemical processes. J. Ind. Microbiol. Biotechnol. 42, 349− 360. (4) Hwang, H. J., Park, J. H., Kim, J. H., Kong, M. K., Kim, J. W., Park, J. W., Cho, K. M., and Lee, P. C. (2014) Engineering of a butyraldehyde dehydrogenase of Clostridium saccharoperbutylacetonicum to fit an engineered 1,4-butanediol pathway in Escherichia coli. Biotechnol. Bioeng. 111, 1374−1384. (5) Maeder, M. L., and Gersbach, C. A. (2016) Genome-editing technologies for gene and cell therapy. Mol. Ther. 24, 430−446. (6) Goyal, A., Myacheva, K., Gross, M., Klingenberg, M., Duran Arque, B., and Diederichs, S. (2017) Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res. 45, e12. (7) Barrangou, R., Birmingham, A., Wiemann, S., Beijersbergen, R. L., Hornung, V., and Smith, A. (2015) Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference. Nucleic Acids Res. 43, 3407−3419. (8) Cao, J., Wu, L., Zhang, S. M., Lu, M., Cheung, W. K., Cai, W., Gale, M., Xu, Q., and Yan, Q. (2016) An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 44, e149. (9) Jakočiunas, T., Jensen, M. K., and Keasling, J. D. (2017) System̅ level perturbations of cell metabolism using CRISPR/Cas9. Curr. Opin. Biotechnol. 46, 134−140. (10) Jakočiunas, T., Jensen, M. K., and Keasling, J. D. (2016) ̅ CRISPR/Cas9 advances engineering of microbial cell factories. Metab. Eng. 34, 44−59. (11) Li, Y., Lin, Z., Huang, C., Zhang, Y., Wang, Z., Tang, Y.-j., Chen, T., and Zhao, X. (2015) Metabolic engineering of Escherichia coli using CRISPR−Cas9 meditated genome editing. Metab. Eng. 31, 13−21. (12) Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl. Environ. Microbiol. 81, 2506−2514. (13) Pyne, M. E., Moo-Young, M., Chung, D. A., and Chou, C. P. (2015) Coupling the CRISPR/Cas9 System with Lambda Red recombineering enables simplified chromosomal gene replacement in Escherichia coli. Appl. Environ. Microbiol. 81, 5103−5114. (14) Chung, M. E., Yeh, I. H., Sung, L. Y., Wu, M. Y., Chao, Y. P., Ng, I. S., and Hu, Y. C. (2017) Enhanced integration of large DNA into E. coli chromosome by CRISPR/Cas9. Biotechnol. Bioeng. 114, 172− 183. (15) Bassalo, M. C., Garst, A. D., Halweg-Edwards, A. L., Grau, W. C., Domaille, D. W., Mutalik, V. K., Arkin, A. P., and Gill, R. T. (2016) Rapid and efficient one-step metabolic pathway integration in E. coli. ACS Synth. Biol. 5, 561−568. (16) Liang, L., Liu, R., Garst, A. D., Lee, T., Nogué, V.S.i., Beckham, G. T., and Gill, R. T. (2017) CRISPR EnAbled trackable genome engineering for isopropanol production in Escherichia coli. Metab. Eng. 41, 1−10. (17) Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., and Lim, W. A. (2013) Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173−1183. (18) Lv, L., Ren, Y. L., Chen, J. C., Wu, Q., and Chen, G. Q. (2015) Application of CRISPRi for prokaryotic metabolic engineering involving multiple genes, a case study: controllable P(3HB-co-4HB) biosynthesis. Metab. Eng. 29, 160−168. (19) Li, S., Jendresen, C. B., Grünberger, A., Ronda, C., Jensen, S. I., Noack, S., and Nielsen, A. T. (2016) Enhanced protein and biochemical production using CRISPRi-based growth switches. Metab. Eng. 38, 274−284. (20) Kim, S. K., Han, G. H., Seong, W., Kim, H., Kim, S.-W., Lee, D.H., and Lee, S.-G. (2016) CRISPR interference-guided balancing of a biosynthetic mevalonate pathway increases terpenoid production. Metab. Eng. 38, 228−240. (21) Cress, B. F., Linhardt, R. J., and Koffas, M. A. G. (2015) CRISPathBrick: modular combinatorial assembly of type II-A CRISPR arrays for dCas9-mediated multiplex transcriptional repression in E. coli. ACS Synth. Biol. 4, 987−1000.

(22) Wu, J., Du, G., Chen, J., and Zhou, J. (2015) Enhancing flavonoid production by systematically tuning the central metabolic pathways based on a CRISPR interference system in Escherichia coli. Sci. Rep. 5, 13477. (23) Rath, D., Amlinger, L., Hoekzema, M., Devulapally, P. R., and Lundgren, M. (2015) Efficient programmable gene silencing by Cascade. Nucleic Acids Res. 43, 237−246. (24) Cress, B. F., Linhardt, R. J., and Koffas, M. A. G. (2016) Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 44, 4472. (25) Liu, H., and Lu, T. (2015) Autonomous production of 1,4butanediol via a de novo biosynthesis pathway in engineered Escherichia coli. Metab. Eng. 29, 135−141. (26) Wang, J., Jain, R., Shen, X., Sun, X., Cheng, M., Liao, J. C., Yuan, Q., and Yan, Y. (2017) Rational engineering of diol dehydratase enables 1,4-butanediol biosynthesis from xylose. Metab. Eng. 40, 148− 156. (27) Tai, Y.-S., Xiong, M., Jambunathan, P., Wang, J., Wang, J., Stapleton, C., and Zhang, K. (2016) Engineering nonphosphorylative metabolism to generate lignocellulose-derived products. Nat. Chem. Biol. 12, 247−253. (28) Kuhlman, T. E., and Cox, E. C. (2010) Site-specific chromosomal integration of large synthetic constructs. Nucleic Acids Res. 38, e92. (29) Shi, S., Liang, Y., Zhang, M. M., Ang, E. L., and Zhao, H. (2016) A highly efficient single-step, markerless strategy for multi-copy chromosomal integration of large biochemical pathways in Saccharomyces cerevisiae. Metab. Eng. 33, 19−27. (30) Wiktor, J., Lesterlin, C., Sherratt, D. J., and Dekker, C. (2016) CRISPR-mediated control of the bacterial initiation of replication. Nucleic Acids Res. 44, 3801−3810. (31) Gao, Y., Xiong, X., Wong, S., Charles, E. J., Lim, W. A., and Qi, L. S. (2016) Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat. Methods 13, 1043−1049. (32) Chen, B., Hu, J., Almeida, R., Liu, H., Balakrishnan, S., CovillCooke, C., Lim, W. A., and Huang, B. (2016) Expanding the CRISPR imaging toolset with Staphylococcus aureus Cas9 for simultaneous imaging of multiple genomic loci. Nucleic Acids Res. 44, e75. (33) Wang, Y., Zhang, Z.-T., Seo, S.-O., Lynn, P., Lu, T., Jin, Y.-S., and Blaschek, H. P. (2016) Bacterial genome editing with CRISPRCas9: Deletion, integration, single nucleotide modification, and desirable “clean” mutant selection in Clostridium beijerinckii as an example. ACS Synth. Biol. 5, 721−732. (34) Cobb, R. E., Wang, Y., and Zhao, H. (2015) High-efficiency multiplex genome editing of Streptomyces species using an engineered CRISPR/Cas system. ACS Synth. Biol. 4, 723−728. (35) Tong, Y., Charusanti, P., Zhang, L., Weber, T., and Lee, S. Y. (2015) CRISPR-Cas9 based engineering of Actinomycetal genomes. ACS Synth. Biol. 4, 1020−1029. (36) Westbrook, A. W., Moo-Young, M., and Chou, C. P. (2016) Development of a CRISPR-Cas9 tool kit for comprehensive engineering of Bacillus subtilis. Appl. Environ. Microbiol. 82, 4876− 4895. (37) Bao, Z., Xiao, H., Liang, J., Zhang, L., Xiong, X., Sun, N., Si, T., and Zhao, H. (2015) Homology-integrated CRISPR−Cas (HICRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae. ACS Synth. Biol. 4, 585−594. (38) Jakočiunas, T., Bonde, I., Herrgård, M., Harrison, S. J., ̅ Kristensen, M., Pedersen, L. E., Jensen, M. K., and Keasling, J. D. (2015) Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metab. Eng. 28, 213−222. (39) Li, H., Shen, C. R., Huang, C.-H., Sung, L.-Y., Wu, M.-Y., and Hu, Y.-C. (2016) CRISPR-Cas9 for the genome engineering of cyanobacteria and succinate production. Metab. Eng. 38, 293−302. (40) Shen, C.-C., Sung, L.-Y., Lin, S.-Y., Lin, M.-W., and Hu, Y.-C. (2017) Enhancing protein production yield from CHO Cells by CRISPR interference (CRISPRi). ACS Synth. Biol. 6, 1509−1519. K


Research Article

ACS Synthetic Biology (41) Cleto, S., Jensen, J. V. K., Wendisch, V. F., and Lu, T. K. (2016) Corynebacterium glutamicum metabolic engineering with CRISPR interference (CRISPRi). ACS Synth. Biol. 5, 375−385. (42) Singh, A. K., Carette, X., Potluri, L. P., Sharp, J. D., Xu, R., Prisic, S., and Husson, R. N. (2016) Investigating essential gene function in Mycobacterium tuberculosis using an efficient CRISPR interference system. Nucleic Acids Res. 44, e143. (43) Peters, J. M., Colavin, A., Shi, H., Czarny, T. L., Larson, M. H., Wong, S., Hawkins, J. S., Lu, C. H., Koo, B. M., Marta, E., et al. (2016) A comprehensive, CRISPR-based functional analysis of essential genes in bacteria. Cell 165, 1493−1506. (44) Zhang, J.-P., Li, X.-L., Li, G.-H., Chen, W., Arakaki, C., Botimer, G. D., Baylink, D., Zhang, L., Wen, W., Fu, Y.-W., et al. (2017) Efficient precise knockin with a double cut HDR donor after CRISPR/ Cas9-mediated double-stranded DNA cleavage. Genome Biol. 18, 35. (45) Yao, L., Cengic, I., Anfelt, J., and Hudson, E. P. (2016) Multiple gene repression in cyanobacteria using CRISPRi. ACS Synth. Biol. 5, 207−212. (46) Huang, C.-H., Shen, C. R., Li, H., Sung, L.-Y., Wu, M.-Y., and Hu, Y.-C. (2016) CRISPR interference (CRISPRi) for gene regulation and succinate production in cyanobacterium S. elongatus PCC 7942. Microb. Cell Fact. 15, 196. (47) Gordon, G. C., Korosh, T. C., Cameron, J. C., Markley, A. L., Begemann, M. B., and Pfleger, B. F. (2016) CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab. Eng. 38, 170−179. (48) Datsenko, K. A., and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640−6645. (49) Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L. A. (2013) RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233−239. (50) Larson, M. H., Gilbert, L. A., Wang, X., Lim, W. A., Weissman, J. S., and Qi, L. S. (2013) CRISPR interference (CRISPRi) for sequencespecific control of gene expression. Nat. Protoc. 8, 2180−2196.

L


Combining CRISPR and CRISPRi Systems for ... - ACS Publications

Recommend Documents