Article pubs.acs.org/JAFC
Comparative Analysis of Recombinant Cytochrome P450 CYP9A61 from Cydia pomonella Expressed in Escherichia coli and Pichia pastoris Xue-Qing Yang,*,† Wei Wang,† Xiao-Ling Tan,‡ Xiao-Qi Wang,*,† and Hui Dong† †
Key Laboratory of Economical and Applied Entomology of Liaoning Province, College of Plant Protection, Shenyang Agricultural University, Shenyang 110866, China ‡ Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China J. Agric. Food Chem. 2017.65:2337-2344. Downloaded from pubs.acs.org by KAROLINSKA INST on 01/06/19. For personal use only.
S Supporting Information *
ABSTRACT: On the basis of prior work, cytochrome P450 CYP9A61 was found to be enriched in fat bodies and during feeding stages, and transcription was induced by λ-cyhalothrin in Cydia pomonella. In this study, recombinant CYP9A61 was expressed in Escherichia coli and Pichia pastoris, and its biochemical properties were investigated. Substrate saturation curves and biochemical properties revealed that, in the presence of glycosylation, the yeast-secreted CYP9A61 exhibited a higher affinity for the substrate p-nitroanisole and was found to be more stable at certain pHs and temperatures than bacterially produced CYP9A61. Halfinhibitory concentrations (IC50) of three synthetic pyrethroids on both the bacterium- and yeast-expressed CYP9A61 suggested that recombinant CYP9A61 expressed in different hosts exhibits different inhibition properties. Taken together, our findings show that yeast-expressed CYP9A61 exhibits enzyme activity that is better than that expressed in bacteria and might be used for further metabolism assays to reveal the insecticide-detoxifying role of CYP9A61 in C. pomonella. KEYWORDS: Cydia pomonella (L.), P450, detoxification, pyrethroids, biochemical properties, inhibition properties
■
INTRODUCTION The codling moth, Cydia pomonella (L.) (Lepidoptera: Tortricidae), an economically important orchard pest of apples and pears worldwide,1,2 has developed resistance to several different classes of insecticides, including synthetic pyrethroids (Pys),3,4 organophosphates (OPs),5−7 neonicotinoids,5,8 and insect growth regulators (IGRs).2 Cytochrome P450 (P450 or CYP) enzymes are important heme-containing monooxygenases that exist in almost all organisms. P450s are the focus in insects because of the role the enzymes play in detoxification and because they are responsible for insecticide resistance.9−12 Previous studies that focused on the underlying resistance mechanisms of the insecticide resistance in field populations of C. pomonella have indicated that a P450-based metabolic resistance is one of the main mechanisms.1,2,5,13 Most recently, the CYP9A61 transcripts were found to be more abundant in the silk gland and fat body than in other tissues and more abundant in feeding stages than in nonfeeding stages. Transcripts of CYP9A61 and p-nitroanisole O-dealkylation (pNAOD) activity were significantly induced by λcyhalothrin and chlorpyrifos-ethyl, empirically demonstrating that this P450 is potentially involved in the insecticidedetoxifying process.14 Apart from the induction of CYP9A61 and pNAOD activity, there is no direct evidence that CYP9A61 detoxifies insecticides. To further elucidate the insecticidedetoxifying role of CYP9A61, a more rigorous assessment of the biochemical properties of CYP9A61, as well as the interactions of CYP9A61 with insecticides in an in vitro assay system, should be performed. However, such work has been hindered by a lack of enough (approximately 1 mg) active form of pure CYP9A61 with sufficiently high activity for biochemical © 2017 American Chemical Society
study. It is known that characterization of a recombinant P450 is quite difficult because CYPs are one of most challenging enzymes to functionally characterize because of the difficulty of recombinantly expressing these membrane-associated monooxygenases. Currently, purification of the native enzyme of CYP from insect tissues was technically difficult and time-consuming and gave only a very low yield because of the very low CYP content of insects.15 Another way to obtain a large amount of protein is to express the protein in heterologous expression systems using recombinant DNA technology. Currently, both prokaryotic and eukaryotic microorganism expression systems have been frequently selected as expression hosts. To the best of our knowledge, insect P450s from various sources have been cloned and functionally expressed in recombinant baculovirus-infected Sf9 insect cells,11,16 Escherichia coli,15,17,18 and yeast.19,20 Among these expression systems, the baculovirus expression system is technically more complicated and produces a relatively low yield of protein. The yeast and E. coli expression systems have advantages compared with the baculovirus expression system because they are easy to handle, produce a high yield, and are cost-effective.15 Recently, some insect and mite CYPs have been functionally co-expressed with NADPH P450 reductase (CPR) in E. coli,18,21 and there are also a few insect CYPs that have been functionally expressed in prokaryotic systems without co-expression with CPR.15,17 Received: Revised: Accepted: Published: 2337
January 24, 2017 March 7, 2017 March 8, 2017 March 8, 2017 DOI: 10.1021/acs.jafc.7b00372 J. Agric. Food Chem. 2017, 65, 2337−2344
Article
Journal of Agricultural and Food Chemistry Table 1. Primers Used in This Studya primer name
primer sequence (5′−3′)
F1 R1 5′AOX-F α-factor R 3′AOX-R
GGGGTACCATGTATCGTAACTACACCACG ACTAGCGGCCGCTCAATGATGATGATGATGATGATTCTTGCGTGGCCTAAAC GACTGGTTCCAATTGACAAGC GCAGCAATGCTGGCAATAGTA GCAAATGGCATTCTGACATCC
Specific primers F1 and R1 complementary to the flanking sequences of the open reading frame (ORF) with KpnI and NotI restriction enzyme sites (underlined), respectively. The six-His tag sequence is shown in bold. a
K2HPO4, and 100 μg/mL ampicillin while being shaken at 220 rpm and 37 °C until the OD600 reached 0.6. Then, isopropyl β-Dthiogalactopyranoside (IPTG) at a final concentration of 0.2 mM was added, and cells were grown at 18 °C while being shaken at 220 rpm for 48 h. Cells were harvested by centrifugation at 4 °C (12000g for 20 min), and the cell pellets were resuspended in 20 mL of TA buffer [50 mM Tris-acetate (pH 7.6) containing 250 mM sucrose and 0.25 M EDTA] containing 0.25 mg/mL lysozyme. This mixture was shaken at 4 °C for 1 h at 80 rpm. Then, the membrane fraction was isolated as described by Ding et al.17 The crude samples were applied to a NiNTA agarose gel column (Transgen, Beijing, China), and recombinant CYP9A61 was purified as described by the manufacturer. Purified CYP9A61 was analyzed by sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS−PAGE) and stained with Coomassie blue G-250 (Roche). Construction of the Yeast Expression Vector. The PCR products and expression vector pPICZαB were digested and ligated as described above. To facilitate purification, a six-His tag was fused to the C-terminus of CYP9A61 and then inserted into plasmid pPICZαB to create CYP9A61-pPICZαB (Figure S1b). The recombinant pPICZαB vector was transformed into E. coli DH5α competent cells, and colonies were then screened on LB solid medium containing 25 μg/mL Zeocin to obtain positive recombinant colonies containing CYP9A61-pPICZαB. Restriction analysis and sequencing were further performed to verify the CYP9A61-pPICZαB expression construct sequences. Subsequently, the recombinant CYP9A61-pPICZαB plasmid was linearized with SalI, and the products were electroporated into competent P. pastoris X-33 cells. The empty vector control was used as a negative control. The positive transformants were screened on YPD plates [2% (w/v) tryptone, 1% (w/v) yeast extract, 2% (w/v) glucose, and 2% (w/v) agar] containing 100 μg/mL Zeocin. Recombinant yeast genomic DNA was isolated, and the presence of inserted CYP9A61 was further verified by PCR using genomic DNA as templates and using 5′AOX-F coupled with α-factor R and 5′AOX-F coupled with 3′AOX-R as the primer pair (Table 1). As shown in Figure S1c, two transformants were confirmed via PCR to harbor CYP9A61. Expression and Purification of Recombinant CYP9A61 in P. pastoris. PCR-confirmed transformants were grown in 20 mL of buffered complex glycerol medium [BMGY, composed of 1% (w/v) yeast extract, 2% (w/v) tryptone, 1.34% YNB, 1% glycerol, and 0.2 μg/ mL biotin, buffered with 0.1 M potassium phosphate (pH 6.0)] at 30 °C and 200 rpm until the cultures had reached an OD600 of 2−6. The cells were harvested by centrifugation at 3000g for 5 min, resuspended in 200 mL of buffered methanol complex medium [BMMY, composed of 1% yeast extract, 2% tryptone, 1.34% YNB, 1% methanol, and 0.2 μg/mL biotin (pH 6.0)] to an OD600 of 1.0 on a shaker. Methanol was added to the culture to a final concentration of 1% (v/v) every 24 h to maintain the induction. A negative control containing the pPICZαB plasmid without any exogenous gene inserted was performed in parallel. To analyze the expression, 1 mL of culture was taken at 24 h intervals. After methanol induction for 72 h, the supernatant was harvested and the proteins were precipitated at 4 °C by adding ammonium sulfate to a final concentration of 80% (w/v) as described by the protein purification handbook (Biotech, Amersham Pharmacia, 2001). The precipitated proteins were collected by centrifugation at 4 °C and 100000g for 20 min, dissolved in 0.1 M sodium phosphate
However, functional expression and characterization of CYPs in C. pomonella have not kept pace with those in other pests and mites.12 Thus, the knowledge of expression of CYP9A61 in a heterologous system and the enzyme properties of the produced protein, as well as the inhibitory activity of Pys against CYP9A61, may provide a better understanding of insecticide detoxification mechanisms in this species. Taking into account the significance of this P450, we initiated further research into the functional overexpression of C. pomonella CYP9A61 in E. coli. and Pichia pastoris, including determining the purification, catalytic activity, and inhibition properties of the enzymes using three widespread commercially used synthetic pyrethroids. These results will then provide information for future investigation of the roles of CYP9A61 in detoxification of insecticides.
■
MATERIALS AND METHODS
Strains, Plasmids, and Chemicals. P. pastoris strain X-33 (wildtype) and expression vector pPICZαB were purchased from Invitrogen. The pET-32a (+) plasmid was obtained from Novagen (Heidelberg, Germany). E. coli strain DH5α, the Ex Taq DNA polymerase, and restriction endonucleases were purchased from Takara (Dalian, China) and used as specified by the suppliers. Yeast nitrogen base (YNB, without amino acids and ammonium sulfate) was obtained from Becton, Dickinson and Company. E. coli DH5α cells harboring the pPICZαB plasmid were cultured at 37 °C in LuriaBertani (LB) medium containing 25 μg/mL Zeocin (Invitrogen). pNitroanisole, p-nitrophenol, analytical grade insecticides, and P450 inhibitor quercetin22 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals and reagents (analytical grade) were commercially available. Isolation of CYP9A61 and Construction of the Prokaryotic Expression Vector. The total RNA was extracted from five thirdinstar C. pomonella larvae using the RNAiso Plus Kit (Takara) based on the manufacturer’s instructions and then treated with DNase I (MBI, Fermentas) to remove any genomic DNA contamination. A total of 1 μg RNA was used to synthesize first-strand cDNA by using the RevertAid First Strand cDNA Synthesis Kit (MBI) as described by the manufacturer. The open reading frame (ORF) with truncation of the N-terminal transmembrane domain14 of CYP9A61 was amplified by reverse transcription polymerase chain reaction (RT-PCR) using F1 and R1 (Table 1) as the primer pair. The PCR product was cleaned using the Biospin Gel Extraction Kit (Bioer Technology Co., Ltd., Hangzhou, China) as recommended by the manufacturer and then digested with KpnI and NotI restriction enzymes. Digestion products were ligated into expression vector pET-32a (+) already digested with the same restriction enzymes to create expression plasmid CYP9A61pET 32a (+). To facilitate purification, a six-His tag was fused to the C-terminus of CYP9A61; this was then inserted into plasmid pET-32a (+) to create pET-32a (+)-CYP9A61 (Figure S1a). The recombinant pET-32a (+)-CYP9A61 plasmid was then transformed into E. coli BL21 (DE3) cells. Three clones were sequence-verified by Shanghai Sunny Biotech Co., Ltd. Expression and Purification of Recombinant CYP9A61 in E. coli. Single positive colonies were inoculated into 1 L of Luria-Bertani (LB) medium containing 1% casamino acids, 17 mM KH2PO4, 72 mM 2338
DOI: 10.1021/acs.jafc.7b00372 J. Agric. Food Chem. 2017, 65, 2337−2344
Article
Journal of Agricultural and Food Chemistry
Figure 1. Expression and purification of recombinant CYP9A61 protein in (A) E. coli and (B) P. pastoris. The samples (5 μL) were separated on 12% SDS−PAGE gels and were stained with Coomassie blue. Panel a: lane 1, eluted proteins using elution buffer containing 100 mM imidazole; lanes 2 and 3, recombinant CYP9A61 with and without, respectively, induction by 0.2 mM IPTG before being loaded onto the Ni2+-NTA column. Panel b: lane 1, uninduced supernatant of the positive transformant at 72 h; lanes 2−4, methanol-induced supernatant of the positive transformant at 24, 48, and 72 h, respectively; lane 5, methanol-induced supernatant of the control transformant (pPICZαB-X-33) at 72 h; lane 6, purified CYP9A61 in P. pastoris. Lane M in each panel contained the molecular mass markers β-galactosidase (116.0 kDa), bovine serum albumin (66.2 kDa), ovalbumin (45.0 kDa), lactate dehydrogenase (35.0 kDa), and REase Bsp98I (25.0 kDa) from top to bottom, respectively. Subsequently, plates were preincubated for 5 min at 30 °C before reactions were initiated by addition of 10 μL of 9.6 mM reduced nicotinamide adenine dinucleotide phosphate (NADPH). After reaction for 1 h, the assay was quenched with 10 μL of 2 M NaOH and absorbance was read in an Infinite M200 PRO Microplate Reader (Tecan, Männedorf, Switzerland) at 405 nm to monitor the generation of p-nitrophenol (pNP) from pNA. The activity was expressed as nanomoles of pNP per minute per milligram of protein. Three replicates of control reactions (without NADPH addition) were run for each P450 source. To determine the steady-state kinetic parameters Vmax and Km, various concentrations (1000, 500, 100, 80, 60, 40, 20, 10, 4, and 2 μM) of pNA were used. The kinetic parameters were determined from the double-reciprocal Lineweaver−Burk plots. Inhibition Studies. The inhibition of pNAOD by various insecticides was measured using the 96-well microplate in the presence of pNA (10 μM), 0.1 M sodium phosphate buffer (pH 7.8), 1.0 nM CYP9A61, 0.03 nM housefly P450 reductase, and different concentrations (200, 20, 2, 0.2, 0.02, and 0.002 μM) of insecticides in a final volume of 190 μL. After incubation for 5 min at 30 °C, reaction was initiated by adding 10 μL of 9.6 mM NADPH. Reactions were run for 1 h, and the absorbance was determined at 405 nm. Insecticide stocks were dissolved and diluted in acetone, and a solvent control was included to correct for any solvent effects across the dilution range. Quercetin, a potent P450 inhibitor,22 was employed as a positive control. In addition, a control reaction (no NADPH) was also conducted. IC50 values were calculated using GraphPad Prism 5 (GraphPad, San Diego, CA) using the equation26 Y = 100/[1 + 10(log IC50 − X) × Hill slope]. Effects of Temperature and pH on pNAOD Activity. The effect of pH on enzyme activity was analyzed by incubating aliquots of CYP9A61 protein at 30 °C using 0.1 M sodium phosphate buffer at different pH values (5.5−10.0). The activity of CYP9A61 measured at pH 7.8 was considered to be 100%. The effect of temperature on enzyme activity was determined by incubating aliquots of CYP9A61 protein at various temperatures (15− 55 °C) in 0.1 M sodium phosphate (pH 7.8). After reaction for 1 h, the assay was quenched with 10 μL of 2 M NaOH and the absorbance was read as described above. The activity of CYP9A61 analyzed at 30 °C was regarded as 100%. The effect of temperature on enzyme stability was investigated by preincubating purified CYP9A61 at various temperatures (15−55 °C) in 0.1 M sodium phosphate (pH 7.8) for 5 min. Subsequently, 10 μL of 9.6 mM NADPH was added to
buffer (pH 7.8), and followed by purification on a Ni-NTA agarose gel column (Transgen). To determine if the bands that appeared on SDS−PAGE corresponded with the target protein, a Western blot analysis was performed using an anti-His antibody. Equivalent proteins (10 μL) of the methanol-induced supernatant of the empty vector control for 72 h and methanol-induced supernatant of positive transformants at 24 and 72 h were separated by 12% SDS−PAGE and transferred to a nitrocellulose (NC) membrane by a Bio-Rad (Hercules, CA) TransBlot SD instrument. Subsequently, the NC membrane was treated with 5% skim milk in Tris-HCl buffer containing 0.5% Tween 20 (TBST) for 2 h and then incubated in antisera against the His tag antibody at a dilution of 1:5000. Thereafter, a goat anti-mouse antibody at a dilution of 1:3000 was incubated with the NC membrane, and the immunoreaction bands were detected using an enhanced chemluminescent kit (Boster, Wuhan, China) as described by the manufacturer. Both the recombinant proteins produced from E. coli and P. pastoris were dialyzed against 0.1 M sodium phosphate buffer (pH 7.8) on a magnetic stirrer at 4 °C overnight. The dialysis buffer was changed three times during dialysis. Dialyzed recombinant CYP9A61 was incubated for 36 h at 4 °C with enterokinase (Wuhan More Biotechnology Co., Ltd.) to generate Trx-free CYP9A61. To maintain an active protein, glycerol was added to a final concentration of 20%, and the sample was then flash-frozen in liquid nitrogen and stored in aliquots at −80 °C before being used. The protein concentration was determined by the Bradford assay using BSA as a standard.23 CYP9A61 concentrations were determined by reduced versus oxidized spectroscopy according to the method of Omura and Sato.24 The deglycosylation assay was performed using 20 μg of purified protein expressed in yeast with the enzymatic protein deglycosylation kit from Sigma (St. Louis, MO). After that, the sample was heated for 5 min at 95 °C and the molecular mass of the deglycosylated protein was determined by SDS−PAGE using a 12% gel. p-Nitroanisole O-Dealkylation (pNAOD) Activity of Recombinant CYP9A61. The p-nitroanisole O-dealkylation (pNAOD) activity was determined in a final volume of 200 μL with chromogenic substrate p-nitroanisole (pNA) as described previously25,26 with slight modification. In brief, 1 nM recombinant CYP9A61 was reconstituted with 0.03 nM housefly P450 reductase27 in 0.1 M sodium phosphate (pH 7.8) buffered with 2 mM pNA on Nunc 96-well transparent microplates (Nunc, Roskilde, Denmark). 2339
DOI: 10.1021/acs.jafc.7b00372 J. Agric. Food Chem. 2017, 65, 2337−2344
Article
Journal of Agricultural and Food Chemistry initiate the reaction at 30 °C. After reaction for 1 h, the assay was quenched with 10 μL of 2 M NaOH and the absorbance was read as described above. The relative activity was determined, and the activity of CYP9A61 stored at −80 °C was regarded as 100%. Structural Modeling for CYP9A61. The three-dimensional (3D) structure of CYP9A61 was modeled using the SWISS-MODEL server (http://swissmodel.expasy.org). The target template sequence was searched with BLAST against the primary amino acid sequence contained in the SWISS-MODEL template library. A total of 295 templates were found. For each identified template, the template’s quality was predicted from features of the target−template alignment. The templates with the highest quality were selected for model building. As a result, the crystal structure of human cytochrome P450 3A4 [Protein Data Bank (PDB) entry 3nxu.1, chain A, 2.0 Å resolution] was selected as a template after searching the PDB database. On the basis of the model obtained, the 3D structure of CYP9A61 was generated using the Swiss-PdbViewer program, version 4.1.0. The reliability of the 3D model was validated using Profile-3D.28 Statistical Analysis. Statistical analysis was conducted using SPSS 12.0 (IBM, Chicago, IL). The results are shown as mean of triplicate determinations ± the standard deviation (SD) and were plotted using GraphPad Prism 5.
E. coli and P. pastoris with P450 contents of 3.669 ± 0.842 nmol/mg of protein (n = 3) and 0.646 ± 0.185 nmol/mg of protein (n = 3), respectively. The deglycosylation assay was further performed to determine the potential glycosylation of yeast-produced recombinant CYP9A61 using PNGaseF (Figure S5). The PNGaseF-treated sample exhibited two bands on the gel; one was completely deglycosylated (∼62 kDa), and the other band represented incompletely deglycosylated CYP9A61 (>62 kDa), suggesting the presence of glycosylation in yeast-produced recombinant CYP9A61. p-Nitroanisole O-Dealkylation (pNAOD) Activity Assay. The pNAOD activity of recombinant CYP9A61 expressed in E. coli BL21 (DE3) and P. pastoris X-33 against pNA was determined. Recombinant E-CYP9A61 exhibited activities of 0.2512 ± 0.068 and 0.2685 ± 0.075 nmol of pNP min−1 (mg of protein)−1 for Trx-containing and Trx-free CYP9A61, respectively, whereas the value for recombinant PCYP9A61 is 87.586 ± 9.54 nmol of pNP min−1 (mg of protein)−1. The pNAOD activity was undetectable in nonCYP9A61-transformed P. pastoris X-33 cells after methanol induction. The pNAOD activity of recombinant CYP9A61 displayed Michaelis−Menten kinetics over the pNA substrate range shown in Figure 2. E-CYP9A61 (Figure 2A) and P-CYP9A61 (Figure 2B) exhibited Vmax values of 4.950 ± 0.316 and 91.78 ±
■
RESULTS Expression of Recombinant CYP9A61 in E. coli. The open reading frame (ORF) of CYP9A61 that encodes a protein of 515 amino acids, with truncation of the N-terminal transmembrane domain at residues 2−24,14 was isolated by PCR. CYP9A61 expressed in E. coli was mainly produced as inclusion bodies; however, 12% SDS−PAGE (5 μL of protein loaded) showed that recombinant CYP9A61 produced a small amount of soluble P450 (Figure 1A, lane 1). Additionally, recombinant CYP9A61 exhibited an expected molecular mass of approximately 78 kDa (Figure 1A, lane 1), which is the molecular mass of the CYP9A61 holoenzyme (62.04 kDa) plus the Trx tag (∼13 kDa), the His tag (∼1.0 kDa), and the S tag (∼1.7 kDa) in the pET-32a (+) plasmid, and the fused six-His tag (∼1.0 kDa) at the C-terminus of CYP9A61. After cleavage by recombinant enterokinase, a single band with an estimated molecular mass of 62 kDa was obtained (Figure S2). Expression of CYP9A61 in P. pastoris. The 12% SDS− PAGE showed that recombinant CYP9A61 expressed a band with a molecular mass (approximately 80 kDa) higher than the expected values (63 and 62.04 kDa for the enzyme and ∼1 kDa for the His tag), and the yield increased as induction progressed from 24 to 72 h (Figure 1B). Thus, the optimal induction time was determined to be 72 h post-methanol induction. The target band was not observed in the non-CYP9A61-inserted control (pPICZαB transformed into X-33) (Figure 1B, lane 6). Western blot analysis provided further evidence that recombinant CYP9A61 was expressed in yeast with a molecular mass higher than the expected value (Figure S3). Purification of Recombinant CYP9A61. Soluble recombinant CYP9A61 was purified in E. coli (Figure 1A) and P. pastoris (Figure 1B) by affinity chromatography using Ni2+NTA resin (Transgen). After purification, total recombinant protein concentrations of approximately 1.02 ± 0.251 mg/mL (n = 3) and 4.086 ± 0.985 mg/mL (n = 3) were obtained in 1 L and 500 mL cultures expressed in E. coli (E-CYP9A61) and P. pastoris (P-CYP9A61), respectively. The CO difference spectrum indicated that CYP9A61 was expressed predominantly as P450, with only a small amount of P420 in both E. coli (Figure S4a) and P. pastoris (Figure S4b), suggesting that purified recombinant CYP9A61 is of good quality.24 Results indicate that the CYP9A61 was expressed in
Figure 2. Substrate saturation curves for p-nitroanisole O-dealkylation (pNAOD) by CYP9A61 expressed in (A) E. coli and (B) P. pastoris. Reactions were performed using a 96-well microplate. Reaction systems (200 μL) contained various concentrations of pNA (1000, 500, 200, 100, 80, 60, 40, 20, 10, 4, and 2 μM) and 10 μL of CYP9A61. Plates were preincubated for 5 min at 30 °C before reactions were initiated by addition of 10 μL of 9.6 mM reduced NADPH. After 1 h, the assay was quenched with 10 mL of 2 M NaOH and the absorbance was read at 405 nm to monitor the generation of pNP. The activity was expressed as nanomoles of pNP per minute per milligram of protein. 2340
DOI: 10.1021/acs.jafc.7b00372 J. Agric. Food Chem. 2017, 65, 2337−2344
Article
Journal of Agricultural and Food Chemistry Table 2. IC50 Values for Pyrethroids and Inhibitor
4.17 nmol of pNP min−1 (mg of protein)−1, respectively, with Km values of 65.20 ± 13.2 and 36.19 ± 6.12 μM versus pNA, respectively. Inhibition Study. To further characterize E-CYP9A61 and P-CYP9A61, three Pys (cypermethrin, permethrin, and λcyhalothrin) and the potent P450 inhibitor quercetin were selected to compare their inhibition profile against that of CYP9A61 in two different microbial expression hosts (Table 2). A clear difference in inhibition properties exists between ECYP9A61 and P-CYP9A61 as demonstrated by the IC50 values of all tested molecules (Table 2). Cypermethrin exhibited IC50 values of 27.8 and 15.8 μM for E-CYP9A61 and P-CYP9A61, respectively, whereas permethrin exhibited IC50 values of 78.9 μM for E-CYP9A61 and 41.2 μM for P-CYP9A61; λcyhalothrin exhibited IC50 values of 19.7 μM for E-CYP9A61 and 10.3 μM for P-CYP9A61 (Table 2). The strongest inhibition was observed for quercetin with IC50 values of 0.4 and 0.2 μM for E-CYP9A61 and P-CYP9A61, respectively (Table 2). Effect of pH and Temperature on CYP9A61 Activity. Both E-CYP9A61 and P-CYP9A61 exhibited maximal activity at pH 7.5 and 8.0, respectively, and the activity decreased at pH >9.0 or 80% remaining active) when they were kept below 35 °C for 1 h at pH 7.8, and the activity dropped dramatically and retained ∼20% of its value at 50 and 55 °C. P-CYP9A61 exhibited thermostability that was higher than that of ECYP9A61 at 35 and 40 °C (Figure 3C). Structural Analysis of CYP9A61. The structure of the CYP9A61 3D model is shown in Figure S6. CYP9A61 contains
16 α-helices and 9 β-sheets connected by loops. The amino acid sequence of CYP9A61 is 34.62% identical with that of human CYP3A4 (PDB entry 3nxu.1, chain A). The amino acid residues that are part of the cytochrome P450 heme-binding domain FxxGxxxCxG (Phe 473, Gly 474, Leu 475, Gly 476, Pro 477, Arg 478, Asn 479, Cys 480, Ile 484, and Gly 482) are colored red (Figure S6). The result of Profile-3D shows the residues with an average 3D − 1D score of >0.05 (Figure S7), indicating that the 3D model is reasonable.
■
DISCUSSION A previous study documented that cytochrome P450 CYP9A61 was associated with λ-cyhalothrin detoxification in C. pomonella.14 To further investigate the insecticide detoxification role of CYP9A61, we strove to functionally express recombinant CYP9A61 in bacteria and yeast with truncation of the N-terminal transmembrane domain. Successful expression of CYP9A61 apoprotein was achieved in this study. The molecular mass of secreted recombinant CYP9A61 in P. pastoris (approximately 80 kDa) was higher than that of CYP9A61 expressed in E. coli (62.04 kDa, without the tags). The possible reason might be glycosylation, one of the most common post-translational modifications occurring in P. pastoris cells.29 Using the N-glycosylation prediction web tool (http://www.cbs.dtu.dk/services/NetNGlyc/), three potential N-glycosylated sites, including NYTT (residues 3−6), NLTF (residues 196−199), and NKTV (residues 291−294), were predicted. The potential glycosylation in yeast-produced recombinant CYP9A61 was further confirmed by treatment with PNGaseF (Figure S5). Our finding is in line with those for Toxoplasma gondii surface antigen 2 gene SAG230 and mammalian acetylcholinesterase31 heterologously expressed in P. pastoris. Unlike E. coli, P. pastoris is capable of conducting many of the post-translational modifications that are usually performed in higher eukaryotes, such as correct folding, Nlinked glycosylation, disulfide bond formation, proteolytic processing, and processing of signal sequences.32 Further analysis (data not shown) confirmed that N-glycosylated 2341
DOI: 10.1021/acs.jafc.7b00372 J. Agric. Food Chem. 2017, 65, 2337−2344
Article
Journal of Agricultural and Food Chemistry
nmol/mg of protein, which was much larger than the amount of CYP6D1 from the housefly (Musca domestica) expressed in another yeast cell line, Saccharomyces cerevisiae, by being cultured in media with glucose using expression vector pYES2.19 In this study, the pNAOD activity of yeast-produced recombinant CYP9A61 was 87.586 ± 9.54 nmol of pNP min−1 (mg of protein)−1 against pNA, which was much higher than the amount of recombinant CYP9A61 expressed in E. coli. The pNAOD activity of recombinant CYP9A61 in this study was also higher than those of recombinant CYP9A12 and CYP9A14 from Helicoverpa armigera expressed in S. cerevisiae without fusion CPR or the introduction of any signal sequence or tag, which exhibited pNAOD activity values of 0.59 and 0.42 nmol of pNP min−1 (mg of protein)−1 against pNA, respectively.20 It is noteworthy that the pNAOD activity of recombinant CYP9A12 and CYP9A14 was determined in the yeast cell lysate, not with the purified enzyme, so that reduces the values for comparison of the pNAOD activities of CYP9A12 and CYP9A14 with that of CYP9A61. The optimal pH of secreted recombinant CYP9A61 was around 7.5, which is similar to those of the E. coli-produced enzyme. This optimal pH is in line with total P450 from midgut microsomes of the black swallowtail, Papilio polyxenes.37 The enzyme expressed in E. coli is more rapidly inactivated by a decreased pH (
