Comparative Proteome Analysis of Serum from Acute Pulmonary

Dec 5, 2006 - Department of Respiratory Medicine, Department of Surgery, Xijing Hospital, Department of Health Statistics, Fourth Military Medical Uni...
1 downloads 3 Views 471KB Size
Download PDF
Comparative Proteome Analysis of Serum from Acute Pulmonary Embolism Rat Model for Biomarker Discovery Sheng-qing Li,*,† Jun Yun,‡ Fu-bo Xue,| Chang-qing Bai,† Shu-guang Yang,§ Hai-ping Que,§ Xin Zhao,§ Zhe Wu,§ Yu Wang,§ and Shao-jun Liu*,§ Department of Respiratory Medicine, Department of Surgery, Xijing Hospital, Department of Health Statistics, Fourth Military Medical University, Xi an 710032, P. R. China, and Department of Neurobiology, Institute of Basic Medical Sciences, Beijing 100850, P.R China Received June 26, 2006

Pulmonary embolism (PE) is a common, potentially fatal disease and its diagnosis is challenging because clinical signs and symptoms are nonspecific. In this study, to investigate protein alterations of a rat PE model, total serum proteins collected at different time points were separated by two-dimensional electrophoresis (2-DE) and identified using matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Bioinformatics analysis of 24 differentially expressed proteins showed that 20 had corresponding protein candidates in the database. According to their properties and obvious alterations after PE, changes of serum concentrations of Hp, Fn, DBP, RBP, and TTR were selected to be reidentified by western blot analysis. Semiquantitative RT-PCR showed DBP, RBP, and TTR to be down-regulated at mRNA levels in livers but not in lung tissues. The low serum concentrations of DBP, RBP, and TTR resulted in the up-regulation of 25(OH)D3, vitamin A, and FT4 (ligands of DBP, RBP, and TTR) after acute PE in rat models. The serum levels of Hp and Fn were detected in patients with DVT/PE and controls to explore their diagnostic prospects in acute PE because the mRNA levels of Hp and Fn were found to be up-regulated both in lung tissues and in livers after acute PE. Our data suggested that the concentration of serum Fn in controls was 79.42 ( 31.57 µg/L, whereas that of PE/ DVT patients was 554.43 ( 136.18 µg/L (P < 0.001), and that the concentration of serum Hp in controls was 824.37 ( 235.24 mg/L, whereas that of PE/DVT patients was 2063.48 ( 425.38 mg/L (P < 0.001). The experimental PE rat model selected in this study was more similar to the clinical process than the other existing PE animal models, and the findings indicated instant changes of serum proteins within 48 h after acute PE. The exploration of these differentially expressed proteins or their combination with existent markers such as D-dimer may greatly improve the accuracy of the diagnosis of acute PE, but diagnostic tests are still needed to evaluate the sensitivity and specificity of these markers and also the number of false positives and false negatives. Keywords: comparative proteomics • two dimensional gel electrophoresis • mass spectrometry • pulmonary embolism • haptoglobin • ferritin

1. Introduction Acute pulmonary embolism (PE) is a potentially fatal disease that requires prompt diagnosis and treatment. Because a significant number of the deaths caused by acute (massive) pulmonary thromboembolism occur within hours after the onset of symptoms,1 its early diagnosis is very important. The gold standard diagnostic tests for PE, contrast venography and * To whom correspondence should be addressed. Sheng-qing Li, Department of Respiratory Medicine, Xijing Hospital, Fourth Military Medical University, 17 West Changle Road, Xi an 710032, P. R. China, Tel: +86-2983375237, Fax: +86-29-83375577, E-mail: [email protected]. Shao-jun Liu, Department of Neurobiology, Institute of Basic Medical Sciences, 27 Taiping Road, Beijing 100850, P. R. China, Tel: +86-10-66931304, Fax: +8610-68213039, E-mail: [email protected]. † Department of Respiratory Medicine. ‡ Department of Surgery. | Department of Health Statistics. § Department of Neurobiology.

150

Journal of Proteome Research 2007, 6, 150-159

Published on Web 12/05/2006

pulmonary angiography, are invasive, expensive, not readily available, and labor intensive.2 Thus, a diagnostic tool for PE is needed that is noninvasive and highly accurate, allowing immediate treatment decisions to be made in most cases. D-dimer, a hemeostatic molecular marker, is sensitive for the presence of PE, but it is not specific. It therefore cannot be used to make a positive diagnosis of acute PE.3 Thus, it is very urgent to develop simple diagnostic tools in an attempt to reduce the number of invasive or costly exams needed to manage these patients. In this study, we used 2-DE and mass spectrometry (MS) to investigate the protein expression changes in sera at different time points after acute PE. Some differentially expressed proteins were reidentified with Western blot analysis. Because many serum proteins are produced in livers and lungs, their mRNA expression levels were validated both in livers and lungs. 10.1021/pr0603102 CCC: $37.00

 2007 American Chemical Society

Serum from Acute PE Rat Model

The ligands of some serum binding proteins were also determined to explore their biological roles in acute PE. To explore their diagnostic prospects in acute PE, the serum levels of some proteins were detected in patients with DVT/PE and in controls. The varying expression patterns of serum proteins may offer us a clue to find new biomarkers for diagnosis and early detection of this disease.

2. Materials and Methods 2.1. Materials. IPG buffer (pH 3-10 NL), 18 cm Immobiline Drystrips (pH 3-10 NL), Drystrip cover fluid, Urea, Bromophenol blue, CHAPS, agarose, Coommassie Brilliant blue R-250 and G-250, Acrylamide, Bis, Tris, SDS, and TEMED were obtained from Sigma (St. Louis, MO, U.S.A.). 2-DE SDS-PAGE standards were from Bio-rad (Hercules, CA, U.S.A.). DTT and sequencing grade-modified trypsin (porcine pancreas source) were from Promega (Madison, WI, U.S.A.). Ammonium persulfate was from Gibco BRL (Grand Island, NY, U.S.A.). The primary antibodies to TTR (rabbit polyclonal IgG) and DBP (goat polyclonal IgG) were both from Santa Cruz Biotechnology, Inc. (Santa Cruz, California, USA). The primary antibodies to haptoglobin (rabbit polyclonal IgG) were from Chemicon International (Temecula, CA, U.S.A.). The primary antibodies to Fn (rabbit polyclonal IgG) were from Sigma-Aldrich China Inc. The primary antibodies to RBP (mouse monoclonal IgG) were from Novus Biologicals, Inc. (Littleton, CO, U.S.A.). Other analytical-grade chemicals used in this study were from domestic sources. All buffers were prepared with Milli-Q deionized water. The IPGphor IEF system, Ettan Dalt vertical electrophoresis system, Hoefer processor plus (automated gel stainer), and the ImageMaster 2D Elite software were purchased from Amersham Pharmacia Biotech (Uppsala, Sweden). A Unicam UV-330 spectrometer (Cambridge, United Kingdom) was used to determine protein concentration. 2.2. Acute PE Model Establishment. The acute PE rat model was established as described previously, with slight modifications.4 Briefly, 10 mL of blood from wistar rats was aspirated by intracardiac puncture and mixed completely with 100 U thrombin. Emboli were prepared by injecting the blood into a sterilized plastic catheter, which was about 3 mm in diameter. The blood clots were stabilized at room temperature for 10 h and cut into pieces 1 cm in length and 1.5 mm in diameter. Fourty adult male Wistar rats weighing between 250 and 300 g (aged 5 months) were randomly divided into a control group (n ) 8) and an experimental group (n ) 32), and the latter was classified into a 1-hour group (n ) 8), 8-hour group (n ) 8), 24-hour group (n ) 8), and 48-hour group (n ) 8). Under general phenobarbital anesthesia (40 mg/kg, administered intraperitoneally), the left jugular veins of the experimental group of rats were exposed and a plastic catheter about 2 mm in diameter was inserted. Three emboli were injected into the vein through the catheter, causing the emboli to be carried along the circulation stream, obstructing certain segments of the pulmonary artery and resulting in acute pulmonary embolism. The blood samples were collected by intracardiac puncture at different time points, 1, 8, 24, and 48 h. Rats used in this experiment were treated in accordance with the Guidelines laid down by the NIH in the U.S. regarding the care and surgery of animals. 2.3. Separation of Serum Proteins. First, the whole blood samples were left at 37 °C for 1 h to allow them to clot thoroughly. Then, they were centrifuged at 4000 rpm for 20 min at 4 °C. The upper serum samples were recovered,

research articles dispensed, and stored at -80 °C. The protein concentration was determined according to the Bradford method with BSA as the protein standard. 2.4. 2-DE and Image Analysis. The protocol for 2-DE gel analysis was followed as described previously.5 Briefly, 1 mg of serum was loaded on a ceramic IPG gel strip holder with the in-gel rehydration mode. IPG gel (18 cm, pH 3-10 NL) was rehydrated for 12 h under low voltage of 30 V at 20 °C. Isoelectric focusing was performed using the following parameters: 200 V for 1 h, 500 V for 1 h, 1000 V for 1 h, 8000 V (gradient) for 0.5 h, and finally 8000 V for a total of 60 kVh. After IEF, the IPG strips were immediately equilibrated in 10 mL equilibration solution with gentle shaking at 20 °C for 15 min.6 Vertical SDS-PAGE was run with lab-made homogeneous acrylamide gel (13% T, 3% C) in an Ettan DALTII apparatus (Amersham Biosciences). Protein spots were stained with Coommassie Brilliant Blue R-250 for preparative gels. Gels were also run with the same samples yet a smaller loading amount (200 µg). These gels were stained with silver for clearer visualization. Image analysis was performed using the ImageMaster 2D Elite software according to the protocols provided by the manufacturer. 2.5. MALDI-TOF MS Identification. Proteins for MALDI peptide mass fingerprinting (PMF) analysis were excised from preparative gels, destained in 50 mM NH4HCO3/CAN (50:50), and dried by vacuum centrifugation. The dry gel pieces were suspended in 20 µL of modified porcine trypsin (10 ng/µL) dissolved in 50 mM NH4HCO3 digestion buffer, incubated on ice for 1 h for reswelling, and then kept at 37 °C overnight (1418 h). The peptide mixture was then concentrated and purified to remove detergents like SDS, CHAPS and salts. After being eluted in 5 µL of matrix solvent containing 0.5% TFA, 50% ACN and 20 mg/mL alpha-CCA, peptide mixtures were deposited on the stainless steel MALDI probe to dry slowly at ambient temperature. MALDI/TOF mass spectra were recorded in positive ion mode with delayed extraction on a Biflex III TOF instrument equipped with a SCOUT multiprobe (Bruker, Bremen, Germany). 2.6. Database Search. The Mascot search engine (http:// www.matrixscience.com/cgi/search_form.pl? FORMVER ) 2 &SEARCH)PMF) was used to identify proteins. The taxonomic category was Rattus. The sequence database to be searched was the latest NCBInr. Cysteine residues were empirically regarded as completely alkylated by iodoacetamide, and methionine residues as partially oxidized. The most frequently occurring contaminant peptides derived from keratin and trypsin autodigestion peptides were deleted before database searching in order to avoid random matches.7 2.7. Western Blot. The protein quantitation of Hp, Fn, DBP, RBP, and TTR were selected to be validated by western-blot analysis because the expression changes of these proteins were more obvious than that of the other proteins and the obtaining of their antibodies was convenient. Briefly, serum samples were first diluted 10 times by 1 × PBS, and then total proteins (60 µg) were separated by SDS-PAGE and electro-blotted to nitrocellulose membrane. After being blocked with 5% nonfat dried milk in 1 × TBST (25 mM Tris, pH 7.5, 150 mM NaCl, 0.1% Tween 20) overnight, membranes were incubated with primary antibodies for 1 h, followed by a secondary antibody for another hour. All these steps were conducted at room temperature. The immunocomplexes were visualized by chemiluminescence using the ECL kit (Amersham Pharmacia Biotech Inc, PiscatJournal of Proteome Research • Vol. 6, No. 1, 2007 151

research articles

Li et al.

Table 1. Primer Sequences and the Size of Products of Five Proteins proteins

primers

size of products (bp)

haptoglobin

Sense 5′ CCT ATC TGC CTG CCT TCC 3′ Anti-sense 5′ AGG TGT CCT CCT CCG TGT C 3′ Sense 5′ GCG GTT AGC TCC ATA CTC C 3′ Anti-sense 5′ GGT TGG TCA GGT GGT TGC 3′ Sense 5′ CCC AGG TTC CAG AAG TGT 3′ Anti-sense 5′ CTC AGT CGT TCC GCC AAT 3′ Sense 5′ GGG TGT AGC CTC CTT TCT 3′ Anti-sense 5′ TGT ATT TGG ACG ATG GTT T 3′ Sense 5′ CTT CCC TTC GCC TGT TCC 3′ Anti-sense 5′ GAG CCT TCC AGT ACG ATT TG 3′ Sense 5′GATGACCCAGATCATGTTTG 3′ Anti-sense 5′TAGGAGCCAGGGCAGTAA3′

316

Fn DBP RBP TTR β-actin

away, NJ, U.S.A.). The film signals were digitally scanned and then quantified using NIH image software. 2.8. Semiquantitative RT-PCR. Total RNAs of rat lungs and livers were prepared separately by TRIZOL Reagent according to the manufacturer’s instructions, dissolved in diethyl-pyrocarbonate-treated water, and stored at -70 °C until further analysis. The quantity of total RNA isolated was determined by absorbance at 260 nm. The first-strand cDNA was synthesized by SuperScriptTMIII using five micrograms of total RNA in a final volume of 20 µL as described by the manufacturer. This cDNA solution was then stored at -20 °C and used as the template for amplification in PCR. Semiquantitative RT-PCR analysis was employed to validate the differential expression of proteins Hp, Fn, DBP, RBP, and TTR both in rat lungs and in livers. The primers of these proteins were designed using the primer premier 5.0 software, and their specificity was tested by SequencherTM software to avoid amplification of any other related gene members. The ubiquitous housekeeping gene β-actin was used as the loading control. The sequences of the primers for five proteins are listed in Table 1. PCRs were performed using TaKaRa Taq enzyme in a final volume of 25 µL as described by the manufacturer. PCR products were separated by electrophoresis on a 1.5% agarose gel stained with ethidium bromide to enable DNA visualization under UV light. Image analysis was performed using the Image Master TotalLab v1.11 software according to the protocols provided by the manufacturer. 2.9. Fn and Hp Testing for Suspected Pulmonary Embolism Patients. Consecutive patients, both inpatients and outpatients, who had been clinically diagnosed as possibly having pulmonary embolism and were referred by their physician for ventilation-perfusion lung scanning or helical CT scanning were eligible for the study. Patients were ineligible if they had one or more of the following: (1) compression ultrasound could not be performed due to physical or technical limitations, (2) therapeutic anticoagulation, (3) presence of inferior vena cava filter, (4) indwelling lower extremity venous catheter, or (5) inability to return for follow-up testing. Patients were considered not to have PE when the following criteria were met: normal ventilation-perfusion lung scan, or normal helical CT lung scan, and they were assigned as controls. Diagnostic criteria for PE were a high-probability ventilation-perfusion lung scan, deep-vein thrombosis shown by ultrasonography, or a helical CT scan showing an embolus. Among the 98 patients who were enrolled into the study, 58 patients (30 men, 28 women) had PE/DVT, and the other 40 patients (21 men, 19 women) were controls. The mean age of patients at the time of study was 56.45 years (S.D. 10.95 years), and the range was between 34 and 76 years. The mean age of the control group was 53.76 years (S.D. 11.23 years), and the range was between 152

Journal of Proteome Research • Vol. 6, No. 1, 2007

482 220 417 300 614

30 and 76 years. The patients and the control group were ageand sex-matched. After obtaining informed consent, the Fn concentration was determined by means of particle-enhanced immunonephelometry (N Latex Fn, Dade Behring Inc. USA) using BN Systems.8 The detection limit was 1 µg/L and linearity range was from 12 to 1000 µg/L. The intra-assay and inter-assay coefficients of variations (CVs) for Fn were lower than 4%. Hp concentrations were measured using rate nephelometry with Beckman ICS II (Beckman Coulter, Inc. USA).9 The detection limit was 50 mg/L and linearity was obtained from 0.1 to 15 g/L. The intra- and inter-assay CVs in this experiment were lower than 5%.

3. Results 3.1. Comparative Proteomic Analysis between the Sera of Control and That of PE Rat Models. For each time point, three 2-DE silver stained gels were integrated, and analyzed by Image Master 2D Elite Version 3.01 software, and reproducibility (>85%) was achieved. There were approximately 1400 protein spots in each 2-DE gel of the sera samples visualized by silver staining. From the five maps, it is readily evident that most proteins (>80%) were distributed in an area of pI 4.0-8.0 and MW 30-70 kD (Figure 1). Compared with the normal control, 24 protein spots showed differences after acute PE and their expression changes at different time points were exhibited by histograms with % changes vs control apart from those proteins identified as albumins (Figure 1). These differentially expressed proteins had four main types of expression patterns: (1) not expressed until 1 h after acute PE, (2) expressed in the control total serum proteins but disappeared after acute PE, (3) expressed lowly in the control group, but increased at each time point after acute PE, and (4) expressed highly in the control group, but decreased steadily after acute PE. Figure 2 shows a magnified comparison of the patterns of spot 24 (Figure 2A), spot 22 (Figure 2B), spot 1 (Figure 2C), and spot 4 (Figure 2D), which exemplify the main types of time-course for concentration levels after PE. 3.2. Identification of Proteins by MALDI-TOF MS and Their Functional Exploration. Corresponding protein candidates were found in the database for 20 of the 24 protein spots (Table 2). Spots 16, 17, 22, and 23 cannot find their corresponding proteins in the database. They may be brand new proteins or else they may be little fragments of some proteins according to their molecular weight (lower than 15 KDa). If they were only fragments, the PMF information of these four spots may be so limited that they could not find their corresponding proteins in the database. Database searching and functional exploration of the above 20 proteins revealed that 8 of them

Serum from Acute PE Rat Model

research articles

Figure 1. 2-DE map of the total serum proteins of the control group and the changing patterns of 24 proteins at different time points exhibited by histograms with % changes vs control apart from those proteins identified as albumins. Total serum proteins (200 µg) of each time point were subjected to a 2-DE system (First dimension, IPG strip, pH3-10NL, 18 cm; Second dimension, 13% T, 3% C SDSPAGE, 260 × 200 × 1 mm). Proteins were visualized by silver nitrate staining, and 24 proteins were found to vary in a statistically significant way in the murine model.

included cDNA sequence BC038613/unnamed protein product, MTSG1 346aa isoform, and a protein similar to solute carrier family 25.

Figure 2. Magnified comparison maps of spot (A) 24, (B) spot 22, (C) spot 1, and (D) spot 4 in the 2-DE patterns at different time points after acute PE. Spot 22 was not expressed until 1 h after acute PE. Spot 24 was expressed in the control total serum proteins but disappeared after acute PE. Spot 1 had low expression in the control group, but its expression increased at each time point after acute PE. Spot 4 had high expression in the control group, but its expression decreased steadily after acute PE.

are all albumins. These 8 spots observed in 2-DE gels with different molecular weights might be different fragments of albumin, which were digested by some enzymes in rat serum activated by the stressful conditions of acute PE. The left 12 proteins could be attributed to five kinds. DBP, RBP, TTR, and Fn could be classified as binding proteins. Hp was an acute phase protein. The third type of protein, complement components, included C4A and C4B. Apolipoprotein A-I belonged to a kind of apolipoproteins. It was difficult to classify the last kind of proteins because of their unknown functions. It

3.3. Validation of Differentially Expressed Proteins by Western Blot Analysis. We verified whether the expression patterns of proteins DBP, RBP, TTR, Hp and Fn observed in 2-DE gels paralleled those validated by western blot analysis. DBP, RBP and TTR were all down-regulated in sera after acute PE, and decreased dramatically at 48 h (Figure 3). After acute PE, the protein levels of DBP began to decrease obviously at 8 h and almost disappeared at 48 h. The expression of RBP was down-regulated gradually from 1 to 24 h after acute PE and decreased about 200 times at 48 h. The protein levels of TTR decreased about 2 times from 1 to 8 h after acute PE, downregulated about 100 times at 24 h, and were nearly undetectable at 48 h. Both Hp and Fn were up-regulated in sera after acute PE and remained at high levels (Figure 3). The expression of Hp increased twice 1 h after acute PE, and was up-regulated about 50 times at 8, 24, and 48 h. The protein levels of Fn increased gradually after acute PE, and was up-regulated about 100 times at 48 h. The expression patterns of the selected proteins were in agreement with 2-DE results, so the results of western blot analysis confirmed the reliability of the proteomic analysis. 3.4. Biological Roles of DBP, RBP, and TTR in Acute PE. DBP, RBP, and TTR are mainly produced in the liver and secreted into plasma. Yves et al. reported that healthy adults with normal macrophage functioning and liver parenchymal Journal of Proteome Research • Vol. 6, No. 1, 2007 153

research articles

Li et al.

Table 2. List of Proteins Identified by MALDI-TOF MS possibilityb

matched peptidec

sequence coveraged

1 2 3 4

9.7e-06 0.00021 9.7e-08 6.1e-07

16(10) 16(10) 24(12) 6(15)

28% 22% 25% 17%

38531/7.10 68674/6.09 68674/6.09 57492/4.93

gi|6981042 gi|19705431 gi|19705431 gi|24418887/

5 6 7 8 9 10 11 12 13 14 15 18 19 20 21 24

1.2e-11 6.1e-08 0.00047 7.7e-06 1.4e-05 4.8e-12 1.2e-06 0.0067 3.1e-10 4.8e-08 0.028 0.007 0.00013 3.1e-06 2.4e-08 0.02

6(15) 22(16) 16(13) 20(40) 21(12) 24(18) 23(18) 18(13) 23(13) 26(14) 24(13) 8(13) 5(10) 6(11) 19(15) 7(12) 9(47)

18% 24% 22% 35% 18% 13% 14% 15% 22% 34% 74% 16% 53% 44% 21% 37% 38%

49401/6.32 68674/6.09 68674/6.09 53509/5.65 68674/6.09 192006/6.62 192042/6.99 68674/6.09 68674/6.09 30029/7.16 23191/5.69 39897/5.81 13065/6.04 20736/5.99 68674/6.09 29899/5.51 35615/9.46

gi|12839826 gi|19705431 gi|19705431 gi|203941 gi|19705431 gi|46237577 gi|29789265 gi|19705431 gi|19705431 gi|204657 gi|33859612 gi|37784494 gi|3212535 gi|38181803 gi|19705431 gi|2145147 gi|34875118

spot no.a

theoretical Mw(Da)/pIe

acc.# (NCBInr.)f

protein descriptiong

haptoglobin; albumin albumin mixture 1:cDNA sequence BC038613 and unnamed protein product albumin albumin vitamin D-binding protein albumin complement component 4b complement component 4a albumin albumin preprohaptoglobin retinol binding protein 4 MTSG1 346aa isoform chain D, Rat TTR Fn light chain albumin apolipoprotein A-I similar to solute carrier family 25

a Spot No. was defined according to spot positions in 2-DE gels. Spots 16, 17, 2,2 and 23 cannot find their corresponding proteins in the database. b Probability: the probability that the observed match is a random event. c Matched peptide: the number of peptides matched to the candidate protein (the number of observed peptides). d Sequence coverage: percent of identified sequence to the complete sequence of the known protein. e pI: theoretical isoelectric point of the matched protein. Mw: theoretical molecular weight of the matched protein in Da. f Acc.No.: NCBInr database accession number. g Protein description: name of each matched protein in the NCBInr database.

integrity, who were submitted to stress of medium severity, were characterized by DBP, RBP, and TTR plasma levels reduced by half and an estimated 10-fold increase in free ligand disposal to target cells during the days following injury.10 In this study, we found that the expression of DBP, RBP, and TTR at mRNA levels were all down-regulated in rat livers during the stressful condition of acute PE (Figure 4A), but there were no changes in rat lungs (figures not listed in this paper), so the changes of serum concentration of DBP, RBP, and TTR might mainly be caused by livers. The mRNA levels of DBP decreased obviously at 8 h and about 10 times at 48 h. RBP was downregulated gradually after acute PE, and to one-fourth at 48 h. The expression of TTR decreased to one-half at 8 h, and onethird at 48 h. The stressful condition of acute PE initiated by the release of cytokines such as TNF and IL-1 triggered the delivery of a secondary wave of cytokines overthrowing the whole body’s economy and initiating complex reacting processes. Our data supported the finding that accompanying the down-regulation of DBP, RBP, and TTR, more ligands are released in free form and act as mediators that fine-tune the multiple aspects of the acute phase response. In this study, we found that the serum concentrations of the ligands of DBP, RBP, and TTR-25(OH)D3, Vitamin A, and FT4 all increased gradually after acute PE (Table 3). The serum concentration of free 25(OH)D3 increased from 9.68 ( 4.24 ng/mL (control) to 29.57 ( 5.23 ng/mL at 24 h (P < 0.05) and 36.47 ( 5.58 ng/mL at 48 h (P < 0.001). The serum levels of free Vitamin A increased from 1.82 ( 0.45 µmol/L (control) to 3.84 ( 0.44 µmol/L at 24 h (P < 0.05) and 4.35 ( 0.37 µmol/L at 48 h (P < 0.05). The serum concentration of FT4 increased from 8.56 ( 3.04 pmol/L(control) to 28.54 ( 5.34 pmol/L at 8 h (P < 0.05), 37.43 ( 5.73 pmol/L at 24 h (P < 0.001), and 49.37 ( 6.02 pmol/L at 48 h (P < 0.001). These transient high levels of 25(OH)D3, retinoid, and thyroxine create a defense line strengthening and fine-tuning the effects primarily initiated by cytokines in acute PE. 154

Journal of Proteome Research • Vol. 6, No. 1, 2007

3.5. Expression Changes of Fn and Hp After Acute PE. In humans, Hp is produced mainly in the liver and secreted into circulation, but the lung is a major extrahepatic site for Hp synthesis. In addition to transporting hemoglobin to the liver, thus facilitating hemoglobin catabolism and preventing tissue injury, several functions have been assigned to Hp, including antioxidant activity, angiogenesis, and the host defense response to infection and inflammation. Funmei et al. found that Hp mRNA was localized in several cell types in the inflamed lung, including alveolar macrophages and eosinophils.11 Our data suggested that the mRNA levels of Hp were up-regulated both in rat livers and lungs after acute PE (Figure 4A,B). It can be inferred that Hp might play an important role in defense in acute PE characterized by inflammation and accumulated hemoglobin. Iron is critical for many aspects of cellular function, but it can also generate reactive oxygen species that can damage biological macromolecules. To limit oxidative stress, iron acquisition and its distribution is tightly regulated by a number of specific proteins in the lungs. Among these proteins, Fn mainly produced in the lung epithelia can limit the capacity of iron to generate ROS and iron-based free radicals and thus serves as an antioxidant protein. We found that the mRNA levels of Fn increased both in rat lungs and livers after acute PE (Figure 4A,B). The up-regulation of Fn might be a defense response to the inflammation and iron excess attributed to acute PE. 3.6. Expression Changes of Hp and Fn in Patients with PE/ DVT. In this study, we validated the expression changes of DBP, RBP, TTR, Hp, and Fn at both mRNA and protein levels and found that the down-regulation of DBP, RBP, and TTR mainly resulted from the low synthesis ability of livers and had little relationship with lung tissues, so the down-regulation of these three proteins may be the response of the body triggered by the stress of acute PE, whereas Hp and Fn were up-regulated not only in livers but also in lung tissues. This phenomenon

research articles

Serum from Acute PE Rat Model

Figure 3. Validation of protein change patterns at different time points by western blot analysis of proteins Hp, Fn, DBP, RBP, and TTR. Total serum proteins (60 µg/lane) were separated by SDS-PAGE and probed with the primary antibodies of these five proteins. Both Hp and Fn were up-regulated in sera after acute PE and maintained at high levels. DBP, RBP, and TTR were all down-regulated in sera after acute PE and decreased dramatically at 48 h.

implied that Hp and Fn may play important roles in the pathophysiological mechanism of acute PE in addition to the merely acute phase response. To explore their specific roles and diagnostic prospects in acute PE, we selected Hp and Fn to study their expression changes in patients with PE/DVT. Our data indicated that the results of patients paralleled those of rat models at the protein levels of Hp and Fn. The concentration of serum Fn in controls was 79.42 ( 31.57 µg/L, whereas that of PE/DVT patients was 554.43 ( 136.18 µg/L (P < 0.001).

The concentration of serum Hp in controls was 824.37 ( 235.24 mg/L, whereas that of PE/DVT patients was 2063.48 ( 425.38 mg/L (P < 0.001) (Figure 5). Patients with PE/DVT showed significantly increased concentrations of both serum Fn and Hp.

4. Discussion Acute PE can cause many pathophysiological changes in hemodynamics, gas exchange, hypoxemia, and the mainteJournal of Proteome Research • Vol. 6, No. 1, 2007 155

research articles

Li et al.

Figure 4. Identification of the expression patterns of (A) Hp, Fn, DBP, RBP, and TTR in livers and (B) Hp and Fn in lungs at mRNA levels by semiquantitative RT-PCR analysis. Total RNA of rat lungs and livers was prepared separately to synthesize the first-strand cDNA. PCR’s were performed using TaKaRa Taq enzyme and specific primers. β-actin was used as the internal control. Image analysis was performed using the Image Master TotalLab v1.11 software. The expression of DBP, RBP, and TTR at mRNA levels were all downregulated in rat livers but not in lung tissues during the stressful condition of acute PE. The mRNA levels of Hp and Fn were upregulated both in rat lungs and in livers after acute PE. 156

Journal of Proteome Research • Vol. 6, No. 1, 2007

research articles

Serum from Acute PE Rat Model Table 3. Changes of Serum Concentrations of 25(OH)D3, Vitamin A, and FT4 after Acute PE (n ) 8, x ( s) time

25(OH)D3 (ng/mL) vitamin A (mmol/L) FT4 (pmol/L) a

0 (control)

1

8

24

48

9.68 ( 4.24 1.82 ( 40.45 8.56 ( 43.04

12.36 ( 44.45 2.05 ( 40.37 14.37 ( 43.45

15.65 ( 45.34 2.96 ( 40.42 28.54 ( 45.34a

29.57 ( 3.84 ( 40.44a 37.43 ( 45.73b

45.23a

36.47 ( 45.58b 4.35 ( 40.37a 49.37 ( 46.02b

P < 0.05 vs control group. b P < 0.001.

Figure 5. Determination of serum concentrations of (A) Hp and (B) Fn in controls and patients with PE/DVT. The concentration of serum Hp in controls was 824.37 ( 235.24 mg/L, whereas that of PE/DVT patients was 2063.48 ( 425.38 mg/L (P < 0.001). The concentration of serum Fn in controls was 79.42 ( 31.57 µg/L, whereas that of PE/DVT patients was 554.43 ( 136.18 µg/L (P < 0.001).

nance of acid-base balance, and these changes may be translated into variations of serum proteins. These varying proteins can thus be used as potential biomarkers for diagnosis of acute PE. The diagnosis of PE remains a challenge at present. Pulmonary angiography, admittedly the “gold standard” technique for this diagnosis, is costly, invasive, and not universally available.12 Noninvasive procedures such as lung scan and lower limb venous compression ultrasonography have certainly simplified the diagnostic approach. However, lung scans are a useful diagnostic tool in only 30-50% of patients.13 Ultrasonography reveals deep-vein thrombosis in 60% of patients with PE, but only in 8-19% of patients with a nondiagnostic lung scan.14 Plasma D-dimer, a degradation product of crosslinked fibrin, can only be used as a screening analyte for allowing the exclusion of PE in suspected patients.15 So the identification and confirmation of peripheral biomarkers for PE has great clinical prospects. Proteomics offers great promise for the study of proteins in plasma/serum; indeed, a number of potential new markers of diseases have been characterized. In this experiment, a comparative proteomic technique was employed to explore the dynamic changes of the proteome of sera resulting from PEs. Protein spots were identified by MALDITOF MS and PMFs. They can be classified as carrier proteins, acute phase proteins, complement components, apolipoproteins, and so on. The relationships of these proteins with PE are elucidated in the following section. Binding Proteins. DBP is a multi-functional plasma protein with many important functions: DBP is the main systemic

transporter of 25(OH)D3 and is essential for its cellular endocytosis. Vitamin D sterols are vital for maintaining normal bone growth and calcium homeostasis. In addition, they contribute to immune modulation16 and possess anti-proliferative17 and anti-angiogenic18 properties. DBP can significantly enhance the chemotactic response to complement fragment C5a.19 DBP, along with gelsolin, acts as an extracellular actin scavenger system. The role of DBP in the actin scavenger system is to bind g-actin and prevent further nucleation and polymerization.20 Actin release is associated with a range of clinical situations that include hepatic necrosis, septic shock, trauma, adult respiratory distress syndrome, and some pregnancy-related disorders. Reduced levels of DBP have been observed in trauma patients who go on to develop organ dysfunction and sepsis, with complete depletion of free DBP in septic shock and hepatic necrosis being associated with a fatal outcome. DBP is synthesized predominantly by hepatic parenchymal cells. In this study, we found that the serum concentration of DBP decreased significantly in rats after PE, and the synthesis of DBP in the liver was down-regulated markedly, which might result in the low serum concentration of DBP. We also found that the serum concentration of 25(OH)D3 was up-regulated after acute PE. This might be related with the low serum concentration of DBP, which might release more ligands into serum. TTR (TTR, TTR) is a beta-sheet rich protein. It is synthesized predominantly by hepatic parenchymal cells. It behaves as a tetramer and binds to retinol binding protein (RBP) and thyroxin in plasma.21 Because TTR is a tryptophan-rich protein, the protein is used as a useful marker protein for nutrition assessment (NST). However, TTR is also an anti-acute phase protein, and the concentration is influenced by various conditions, such as inflammation and infection. Mutated forms of TTR are the precursor proteins of familial amyloidotic polyneuropathy (FAP).22 Recent research revealed that TTR plays an important role in various central nervous system disorders, such as Alzheimer’s disease, depression, and lead intoxication. In this study, TTR was found to be down-regulated in rats with acute PE. The low serum concentration of TTR might result from the declining synthesis of TTR in rat livers. We also found that the serum concentration of FT4 was up-regulated after acute PE. This might be related with the low serum concentration of TTR, which might release more ligands into the serum. The circulating FT4 fraction appears as the sensor reflecting the actualthyroxine status and governing the release of thyroxine stimulating hormone (TSH). Dietary vitamin compounds transported as retinyl esters by chylomicrons are rapidly taken up by liver parenchymal cells, then transferred and stored as holoRBP (conveying retinol) in stellate cells, representing until released into the bloodstream the major reservoir (up to 80-90%) of total body vitamin A.23 RBP could also play a role in the development of fetuses by delivering retinol from the maternal circulation to the developJournal of Proteome Research • Vol. 6, No. 1, 2007 157

research articles ing fetus.24 Recent studies have demonstrated that during the onset of a stress reaction of medium severity, the reduction by half of RBP plasma levels releases more retinol in free form into the extracellular space in amounts corresponding to about 10 times the normal free concentration.25 In this study, we also found that RBP was down-regulated after acute PE. The low serum concentration of RBP might result from the declining synthesis of RBP in rat livers. The serum concentration of FT4 was also found to be up-regulated after acute PE. This could be related to the low serum concentration of RBP, which might cause more ligands to be released into the serum. Fn is the major iron storage protein regulating cytosolic concentration of iron by storing excess iron. Many pulmonary inflammatory processes are associated with disruption of iron metabolism resulting in excess accumulation of the metal. Elevated levels of iron can contribute to significant damage to the lungs and increase the availability of iron to microbial organisms, resulting in more persistent and virulent infections. Fn limits the capacity of iron to generate ROS and iron-based free radicals and thus serves as an antioxidant protein.26 Storage of the metal in Fn limits its accessibility to catalytically active metal and protects the epithelial lining of the lung against the generation of oxidative stress. The metal can be released subsequently from the cell and transported out of the lung either via the mucociliary pathway for clearance or by the body’s reticuloendothelial system, which is available for more long-term iron storage.27 The expression of Fn is under delicate control and is regulated at both the transcriptional and posttranscriptional levels by iron, cytokines and oxidative stress.28 In this study, we found that the synthesis of Fn was up-regulated in lung tissues after acute PE. The concentration of serum Fn increased to 554.43 ( 136.18 µg/L in patients with PE/DVT, whereas that of controls was 79.42 ( 31.57 µg/L (P < 0.001). The up-regulated Fn might protect lung tissues from being damaged by ROS and iron-based free radicals. Acute Phase Proteins. Haptoglobin (Hp) is an acute phase protein. It can capture free Hb in plasma to allow hepatic recycling of heme iron and to prevent kidney damage during hemolysis.29 Hemoglobin in plasma is instantly bound with high affinity to Hp - an interaction leading to the recognition of the complex by HbSR/CD163 and endocytosis in macrophages.30 Hp also acts as an antioxidant, has antibacterial activity and plays a role in modulating many aspects of the acute phase response. Hp is expressed at high levels in specific cells, including alveolar macrophages and eosinophils in diseased or inflamed human lung tissues, but not in the normal lung. Because the Hp-hemoglobin complex can be removed efficiently by alveolar macrophages, Hp synthesized by alveolar macrophages at the site of inflammation could contribute significantly to the clearance of hemoglobin and thus protect the lower respiratory tract against hemoglobin-mediated oxidative damage.11 In this study, we found that Hp was up-regulated in lung tissues after acute PE. The concentration of serum Hp increased to 2063.48 ( 425.38 mg/L in patients with PE/DVT, whereas that of controls was 824.37 ( 235.24 mg/L (P < 0.001). We can conclude that overexpression of Hp might attenuate blood-induced lung injury after acute PE. Complement Components. Complement component C4 is an essential component of the effector arm of the humoral immune response. Complement C4 exists as two isotypes, C4A and C4B. Although sharing >99% sequence identities, they have different hemolytic activities, covalent affinities to antigens and immune complexes, and serological reactivities.31 C4A may be 158

Journal of Proteome Research • Vol. 6, No. 1, 2007

Li et al.

functionally advantageous for ensuring the solubilization of antibody-antigen aggregates (or inhibition of immune precipitation) through binding to IgG or to antigens of immune complexes (IC), and clearance of IC through binding to complement receptor CR1. C4B functions more in the propagation of the activation pathways that lead to the formation of the membrane attack complex in attacking foreign antigens.32 In this study, we found that C4A was up-regulated, whereas C4B was down-regulated in rat PE models. Apolipoproteins. Apolipoprotein A-I (apo A-I) is the major protein of high-density lipoprotein (HDL), comprising about 70% of total HDL protein. The best characterized functions of apo A-I are related to its role in reverse cholesterol transport and include lipid and cholesterol binding, lecithin:cholesterol acyl transferase (LCAT) activation, and receptor binding.33 Beyond its role in cholesterol metabolism, there are many other disparate activities attributed to apo A-I (and HDL) that may be physiologically relevant, some of which may also contribute to apo A-I’s anti-atherogenic properties, such as its antiinflammatory and antioxidant activities.34 Plasma HDL, quantified by either its cholesterol or apo A-I content, is the best single predictor of coronary artery disease (CAD), with high HDL levels being correlated with low CAD.35 Apo A-I was found to be up-regulated in rat PE models in this study. In this experiment, Spots 16, 17, 22, and 23 cannot find their corresponding candidate proteins in the database. They may be brand new proteins, or else they may be little fragments of some proteins according to their low molecular weight. The ESI-MS/MS study of these spots may lead us to find new proteins. Among the identified 20 spots, 8 spots were albumin, which might be different fragments of albumin according to their different molecular weights. Four of the 12 proteins left had new sequences, and their sequence information was predicted by automated computational analysis using the gene prediction method: GNOMON, supported by EST evidence. Further experiments are needed to explore their properties and their functions in acute PE. In this study, changes of serum concentrations of Hp, Fn, DBP, RBP, and TTR were validated by western blot analysis because of their obvious changes and the convenience of obtaining their antibodies. Semiquantitative RT-PCR analysis showed DBP, RBP, and TTR to be downregulated at mRNA levels in livers but not in lung tissues. Our data supported the finding that accompanying the downregulation of DBP, RBP, and TTR, more ligands (25(OH)D3, vitamin A and FT4) were released in free form and acted as mediators that fine-tune the multiple aspects of the acute phase response. Different from that of DBP, RBP, and TTR, the expression of Hp and Fn were up-regulated not only in livers but also in lung tissues. This phenomenon implied that Hp and Fn may play important roles in the pathophysiological mechanism of acute PE in addition to the merely acute phase response. To explore their specific roles and diagnostic prospects in acute PE, Hp and Fn were selected to study their expression changes in patients with PE/DVT. Our data indicated that the changes of patients paralleled those of rat models at the protein levels of Hp and Fn. These findings may help us understand the molecular mechanism of pathophysiological changes after acute PE. The experimental PE rat model selected in this study was more similar to the clinical process than the other existed PE animal models, and the findings indicated instant changes of serum proteins within 48 h after acute PE. The exploration of these differentially expressed proteins or their combination with existent markers such as D-dimer may

research articles

Serum from Acute PE Rat Model

greatly improve the accuracy of the diagnosis of acute PE, but diagnostic tests are still needed to evaluate the sensitivity and specificity of these markers, and also the number of false positives and false negatives. Abbreviations: C4A, complement component 4A; C4B, complement component 4B; DBP, vitamin D binding protein; RBP, retinol binding protein; DVT, deep venous thromboembolism; Hp, haptoglobin; PE, pulmonary embolism; Apo A-I, apolipoprotein A-I.

Acknowledgment. This study was supported in part by the innovation funds of Xijing Hospital of Fourth Military Medical University and the Chinese Guanghua Science and Technology Foundation. References (1) Girard, P.; Sanchez, O.; Leroyer, C.; Musset, D.; Meyer, G. Stern, J.-B.; Parent, F. Chest 2005, 128, 1593-1600. (2) Sohne, M.; Kamphuisen, P. W.; van Mierlo, P. J.; Buller, H. R. Thromb. Haemost. 2005, 94, 206-210. (3) Perrier, A.; Desmarais, S.; Goehring, C.; de Moerloose, P.; Morabia, A.; Unger, P.-F.; Slosman, D.; Junod, A.; Bounameaux, H. Am. J. Respir. Crit. Care Med. 1997, 156, 492-496. (4) Clozel, J. P.; Holvoet, P.; Tschopp, T. J. Cardiovasc. Pharmacol. 1988, 12, 520-525. (5) Zhao, C.-J.; Jia, Y.-F.; Ding, Q.-X.; Que, H.-P.; Liu, S.-J.; Guo, Y.-J. Prog. Biochem. Biophys. 2000, 27, 645-649. (6) Go¨rg, A.; Obermaier, C.; Boguth, G.; Harder, A. Electrophoresis 2000, 21, 1037-1053. (7) Kristensen, D. B.; Imamura, K.; Miyamoto, Y.; Yoshizato, K. Electrophoresis 2000, 21, 430-439. (8) Van den Bosch, G.; van den bossche, J.; Wagner, C. Clin. Chem. 2001, 47, 1465-1467. (9) Montagne, P.; Laroche, P.; Bessou, T.; Cuilliere, M. L.; Varcin, P.; Duheille, J. Eur. J. Clin. Chem. Clin. Biochem. 1992, 30, 217-222. (10) Yves, I.; Larry, B. Nutrition 1999, 15, 305-320. (11) Funmei, Y.; Andrew, J. G.; Damon, C. H.; Frank, J. W.; Christi, A. W.; Jacqueline, J. Am. J. Respir. Cell Mol. Biol. 2000, 23, 277-282. (12) Henschke, C. I.; Mateescu, I.; Yankelevitz, D. F. Chest 1995, 107, 940-945. (13) Hull, R. D.; Raskob, G. E.; Ginsberg, J. S.; Panju, A. A.; BrillEdwards, P.; Coates, G.; Pineo, G. F. Arch. Intern. Med. 1994, 154, 289-297.

(14) Perrier, A.; Bounameaux, H.; Morabia, A.; de Moerloose, P.; Slosman, D.; Didier, D.; Unger, P. F.; Junod, A. Arch. Intern. Med. 1996, 156, 531-536. (15) Ginsberg, J. S.; Wells, P. S.; Kearon, C. Ann. Intern. Med. 1998, 129, 1006-1011. (16) Branisteanu, D. D. J. Neuroimmunol. 1997, 79, 138-147. (17) Gewirtz, D. A. Curr. Med. Chem. Anti-Canc. Agents 2002, 2, 683690. (18) Majewski, S. J. Investig. Dermatol. Symp. Proc. 1996, 1, 97-101. (19) McVoy, L. A.; Kew, R. R. J. Immunol. 2005, 175, 4754-60. (20) Lind, S. E.; Smith, D. B.; Janmey, P. A.; Stossel, T. P. Am. Rev. Respir. Dis. 1988, 138, 429-434. (21) Peterson, P. A. J. Biol. Chem. 1971, 246, 44-49. (22) Hammarstrom, P.; Jiang, X.; Deechongkit, S.; Kelly, J. W. Biochemistry 2001, 40, 11453-11459. (23) Bellovini, D.; Morimoto, T.; Tosetti, F.; Gaetani, S. Exp. Cell Res. 1996, 222, 77-83. (24) Sundaram, M.; Sivaprasadarao, A.; DeSousa, M. M.; Findlay, J. B. J. Biol. Chem. 1998, 273, 3336-3342. (25) Quadro, L.; Blaner, W. S.; Salchow, D. J.; Vogel, S.; Piantedosi, R.; Gouras, P.; Freeman, S.; Cosma, M. P.; Colantuoni, V.; Guttesman, M. E. EMBO J. 1999, 18, 4633-4644. (26) Balla, J.; Nath, K. A.; Balla, G.; Juckett, M. B.; Jacob, H. S.; Vercellotti, G. M. Am. J. Physiol. 1995, 268, L321-L327. (27) Jennifer, L.; Turi, F. Y.; Michael, D.; Garrick, C. A.; Claude, A. P.; Andrew, J. G. Free Radical Bio. Med. 2004, 36, 850-857. (28) Schneider, B. D.; Leibold, E. A. Blood 2003, 102, 3404-3411. (29) Delanghe, J. R.; Langlois, M. R. Clin. Chem. Lab. Med. 2002, 40, 212-216. (30) Madsen, M.; Graversen, J. H.; Moestrup, S. K. Redox. Rep. 2001, 6, 386-388. (31) Schifferli, J. A.; Steiger, G.; Paccaud, J. P.; Sjoholm, A. G. Clin. Exp. Immunol. 1986, 63, 473-477. (32) Gatenby, P. A.; Barbosa, J. E.; Lachmann, P. J. Clin. Exp. Immunol. 1990, 79, 158-163. (33) Rodrigueza, W. V.; Williams, K. J.; Rothblat, G. H.; Phillips, M. C. Arterioscler. Thromb. Vasc. Biol. 1997, 17, 383-393. (34) Cockerill, G. W.; Rye, K. A.; Gamble, J. R.; Vadas, M. A.; Barter, P. J. Arterioscler. Thromb. Vasc. Biol. 1995, 15, 1987-1994. (35) Calabresi, L.; Franceschini, G. Curr. Opin. Lipidol. 1997, 8, 219-224.

PR0603102

Journal of Proteome Research • Vol. 6, No. 1, 2007 159