Comparison with Benzo[a] - ACS Publications - American Chemical

Article Cite This: Chem. Res. Toxicol. 2018, 31, 22−36

pubs.acs.org/crt

Bonding of Butylparaben, Bis(2-ethylhexyl)-phthalate, and Perfluorooctanesulfonic Acid to DNA: Comparison with Benzo[a]pyrene Shows Low Probability for Strong Noncovalent DNA Intercalation Sergio Manzetti*,†,‡ †

Department of Cellular and Molecular Biology, Computational Ecotoxicity Group, Uppsala University, Husargatan 3, SE-75124 Uppsala, Sweden ‡ Fjordforsk AS, Midtun 155, 6894 Vangsnes, Norway S Supporting Information *

ABSTRACT: Parabens, phthalates, and perfluorinated compounds are pollutant compounds used in cosmetics, plastics, and fire-fighting foams. All three compounds have been studied over several years for toxicity mechanism; however, a clear view of their ability to bind to DNA has not been supplied empirically. In this work, a simulation study is done to reveal the interaction of three of these pollutants, bis(2-ethylhexyl)-phthalate (DEHP), butylparaben (BPRB), and the protonated form of perfluorooctanesulfonic acid (PFOS(H)), with DNA. The results show that the DEHP, PFOS(H), and BPRB bind with a probability of 1/5 to DNA, with respective bonding energies −23.96 kJ/mol (PFOS(H)), −94.92 kJ/mol (BPRB), and −216.52 kJ/mol (DEHP). The positive control, benzo[a]pyrene diol epoxide (BAP), which is known for its notorious DNA intercalation, binds at a rate of 3/5 simulations, with bonding energies of −6544.52, −7034.66, and −7578.67 kJ/ mol. The results are compared to empirical studies and conclusively show that all these pollutants can interfere with transcription and DNA related mechanisms by forming noncovalent interactions with DNA. The results show also that these pollutants are unlikely to undergo strong noncovalent intercalation to DNA, such as BAP, and do not possess the frontier orbital profiles to undergo adduct formation. After many years of research and several unanswered questions on the action of these pollutants on DNA, a calculation on their properties hence to the DNA confirms that there is a low probability for these to undergo a strong intercalation with DNA. Literature shows however that the pollutants are strongly interfering with the protein machinery and receptors on the cell surface and are therefore still priority pollutants for ecotoxicity research.

■

saturate protein surfaces28−30 and are transferred through the maternal cord from the placenta in rat models, suggesting the same fate for humans.31,32 Recent studies show also that PFASs cause genotoxic effects on the DNA in human HepG2 cell lines33 and increase the chance of prostate cancer in case groups with hereditary prostate cancer.34 One of the most important PFASs, which is banned for use in several countries, is perfluorooctanesulfonic acid (PFOS(H)) and is distinguished from the other PFASs in that it is widely used in firefighting foam and has been found ubiquitously in many ecosystems.8 Plastic analogues are widespread in the environment and found in drinking water supplies, soils and sediments, and even in commercial drinking water.35 One plastic analogue in particular, di-2-ethylhexyl phthalate (DEHP), which belongs to the phthalate family (PHT) of plasticizers, has been used for the last 40 years in plastic bottles, packaging materials, as well as food packaging as fortifying material to plastic polymers. PHTs were initially used as plasticizers in the polyvinyl chloride industry as early as in the 1930s and have since emerged as

INTRODUCTION The spreading of pollutants from cosmetics, consumer materials, waste, traffic pollution, and industrial activity represents one of the greatest dangers to modern human kind and has been associated with ecotoxic effects in the human environments, decreased fertility, cancer, diabetes, and several other chronic diseases.1−5 The most important persistent pollutants that are related to these complications are PCBs, organic compound pesticides, plastic analogues, hormone analogues, perfluorinated compounds (PFASs), polycyclic aromatic hydrocarbons, and also pyrogenic compounds such as dioxins. PFASs are used widely through the industrial production of plastic materials, polymers, surfactants, as flameretardants in foam, as well as starting materials for pesticides6 and have been released in the environment for decades.4,7 PFASs are found in ground and drinking waters,8−10 accumulate in bioorganisms,11 fish,12 animals,13 and humans,4,14 and also in entire food-chains.15 PFASs accumulate in the liver and blood in animals,16−18 and the interactions with the cellular and serological factors have caused concern19 for long-term toxicity effect ranging from infertility,20,21 cancer,22−25 and neurological disorders.26,27 Recent studies show that PFASs © 2017 American Chemical Society

Received: September 25, 2017 Published: November 29, 2017 22

DOI: 10.1021/acs.chemrestox.7b00265 Chem. Res. Toxicol. 2018, 31, 22−36

Article

Chemical Research in Toxicology

of these toxicants and are also important to assist in improving regulations for limiting the introduction, use, and spread of new emerging pollutants in the environment. This approach constructed in silico is also a potential reference to an optimal method to predict and study chemical’s properties with an accurate mechanism of atomistic dynamics, coupled with electronic landscape analysis, which is often absent in other prediction approaches.

ubiquitously applied in the plastic industry. PHTs has received equal attention as dioxins and PCBs received in the 1970s and 1980s. Bisphenol A, F and bis(2-ethylhexyl)phthalate (BEHP, DEHP) are the most common PHTs and are reported in the last decades for toxicity effects, by animal studies, and have been subjects of research given their sexual hormone interference effects in rats.36 PHTs are transferred to humans from plastics and source-materials by evaporation, leakage, and particle decomposition during material usage erosion and can be found ubiquitously in the environment.37,38 PHT have also been associated with cancer.39 Several countries have banned the use of bisphenol A and F and DEHP and further toxicity studies on PHTs are carried out worldwide.16,40−42 Parabens (PRBs) are a third class of pollutants that have raised great concern in the past decade in Europe, particularly Scandinavian countries and in the US. Parabens are commonly used in cosmetics, skin-care products, hygienic products, and other products such as pharmaceutics. PRBs have received particular focus in recent years given strong indications of their endocrine disrupting activity, hormonal interference, and carcinogenic potential.43−45 PRBs have been detected in human urine, serum, milk, placental tissue, and breast tumor.46 PRBs have been banned for use in several products, particularly in lotions for children under 3 years of age.46 However, studies on PRBs are still not conclusive on the emergency of the importance of parabens, as the correlation between cancer and parabens is weak, even tough they pertain endocrine disrupting properties.47 The main concern of PRBs arose originally in 2004 when PRBs were detected in human breast tissue from patients with breast cancer.48 Since then, several studies have been carried out on PRBs, particularly in connection with the estrogen receptor. In particular, butylparaben (BPRB) has received great attention in several studies, given its higher octanol−water partition coefficient (Log Kow) compared to other parabens (Log Kow: 3.6) and thus easily transferable structure across the cellular membrane. The same accounts for DEHP (Log Kow: 7.60) and also PFOS (Log Kow not determinable given the formation of multiple layers in the solution). Given that these compounds are still in circulation and use worldwide, PFOS, BPRB, and DEHP are therefore prioritized in this study for analysis and interaction with the DNA in a simulated environment. This is done to add additional information to their potential interference with DNA regulation and eventual role in cancer development, as existing but not confirming information on cancer incidence is published on BPRB,48 perfluorinated compounds are associated with bladder cancer,4 and DEHP has also been associated for potential carcinogenic effects.38 In this study, two methods are combined to reveal the potential mechanism of disruption the three molecules have molecular simulations and quantum chemical calculations, which are juxtaposed in a set of repeated calculations to identify the most likely outcome of interaction between each of the compounds and a fragment of the p53 suppressor gene fragment simulated in water with NaCl at physiological concentrations (0.15M), at a cellular temperature (37 °C) and at neutral pH. This represents in other words the cellular solvent that is critical for the simulations to reveal how the toxicants may interact with the DNA under real conditions. This gene fragment has been used given its paramount role in cellular regulation and thus acts as an excellent receptor for potential interactions with the described toxicants. The results from this study are critical for further understanding the nature

■

MATERIALS AND METHODS

Molecular Simulations. Molecules and the DNA fragment were downloaded respectively from the Pubchem database49 and the RCSB database.50 The two molecules, butylparaben (BPRB) and the protonated perfluorooctanesulfonic acid (PFOS(H)), were downloaded in SDF format from the pubchem database under respective IDs 7184, 74483, while bis(2-ethylhexyl)-phthalate (DEHP) was retrieved from the Chemspider database51 in 3D coordinates, under ID: 21106505. A positive control molecule for DNA intercalation, benzo[a]pyrene diol epoxide,52−55 was downloaded from Pubchem, ID 44461. PFOS was used in protonated form given incompatibility of the negative charged variant, PFOS−, to the topology-generating system. All structures were converted to MOL2 format using Openbabel.56 The molecules were then converted to GROMACS topologies using the topology generator ANTECHAMBER57 using the Amber99sb-ILDN force field.58 The p53 suppressor gene was selected as receptor for this study, representing one of the most paramount genes in the human genome.59 A large fragment of this gene (sequence: TCACAAGTTAGAGACAAGCCT) was found in crystal structure under PDBID 4HJE.60 4HJE was downloaded and imported into the GROMACS package61 and converted to topology format using the Amber99sb-ILDN force field.58 This force field was used as it was easy to implement in the topology procedure for the GROMACS package and has shown good results according to benchmarking studies on the DNA.62 Preliminary Simulations. Molecules. A single molecule of BPRB, PFOS(H), BAP, and DEHP was simulated separately for optimized solvation-geometry search. The molecules were put in an own box dimensions 5 × 5 × 5 nm3 (for PFOS(H) and BPRB: 3 × 3 × 3 nm3) filled with water molecules of the single-point charge (SPC) type, as these are standard models for solvent simulations,63 and minimized with 10.000 steps with the steepest descent method. The systems were then simulated for 10 ns at 37 °C (310 K) with Velocity-Rescale algorithm,64 with a time-step of 2 fs, using a Particle Mesh Ewald electrostatic scheme,12 with a coulomb and vdW cutoff of 8 Å,65 and a frequency of updating the neighbor list of 10 fs. No pressure-coupling was used. P53 Suppressor. The p53 suppressor fragment, encompassing 20 DNA bases, was minimized in a water phase composed of 32307 water molecules in a virtual cubic box of 7 × 7 × 7 nm3, with NaCl ions added to reach a physiological concentration of 0.15 M. This was done given the considerable effects the ions have on stabilizing the helical conformation of nucleic acid macrostructures.66 The system was minimized with 10.000 steps. The system was then equilibrated for 10 ns with a time-step of 2 fs, using a Particle Mesh Ewald electrostatic scheme,67 with a Coulomb and vdW cutoff of 8 Å in accord with AMBER parameters,65 and neighbor searching frequency of 10 fs. The temperature was set to 310 K (37 degrees), representing physiological conditions of the DNA in cellular active environment. LINCS algorithm68 was used on all bonds and the temperature was simulated using the velocity rescaling algorithm V-rescale.64 Full-Scale Simulations of DNA with Four Target Toxicants. The outputs of the structures from the preliminary water simulations were extracted from the last frame of the GROMACS output trajectory by devising the gmx trajconv command and keeping only nonwater molecules (Na, Cl, DNA) in the GRO file to be used to DNA-toxicant simulations. The generated GRO file was then merged by gmx insert molecules with one of the four toxicants in a separate simulation environment. At this stage, four different simulation environments were therefore rendered ready for equilibration simulation, DNA 23


Article


Figure 1. PFOS(H) in noncovalent interaction with the p53 suppressor core domain (PDB: 4HJE). Left: Resulting configuration of the PFOS(H) bound to the surface of the end of the p53 DNA fragment. Water molecules are shown as small dots for clarity. Generated in Visual Molecular Dynamics.102 Upper-Right (framed): Magnification of the site were PFOS(H) interacts with the DNA bases, Thymine 21 and Adenosine 21 from the sense and antisense parts of the DNA. Generated in Chemcraft.78 (NaCl)+BAP, DNA (NaCl) + BPRB, DNA (NaCl) + PFOS(H), and DNA (NaCl) + DEHP, which where each given quintuple simulations of 20 ns each, with the above-mentioned parameters, deriving from five different seed start impulses. In other words, DNA with each of the four toxicants separately, was simulated five times for each toxicant, in boxes of size 7 × 7 × 7 nm3, with LINCS applied on all bonds and default position restraints on the DNA atoms. Quantum Chemical Calculations. Selected outputs from the MD simulations were prepared for quantum chemical analysis with ADFView.69 For PFOS(H)-DNA simulation output, the two bases that resulted in noncovalent contact were extracted from the MD output with the PFOS(H) molecule. This allowed the interaction to be studied analytically at the electronic level between the PFOS(H) and the DNA residues (Adenosine 21 (A21) and Thymine 21 (T21)). The phosphate groups were not included, as they did not interact with the PFOS(H) molecule. The system of PFOS(H)-DNA bases was assigned a neutral charge (given the protonated state of PFOS(H). For DEHP-DNA base complex, the extracted residue from the DNA was Adenosine 21 only, as it was the only interactor with the DEHP molecule. The phosphate group of T21 was capped with a methyl group and assigned a charge of −1. The BPRB output was treated likewise, however, given that BPRB intercalated between the first basepair (A1-T1) and the second residue, Cytosine 2, BPRB was extracted with all these three residues into one large structure. The phosphate groups from A1 were capped with a methyl group and assigned a negative charge. The phosphate bridge between A1 and C2 was kept as it was and assigned a negative charge. This generated the input for the quantum chemical calculation for BPRB with a total charge of −2, and three bases, as the phosphate group of thymine 1 (T1) was out of range of chemical interaction with BPRB. The prepared structures were then subjected to a minimization procedure in Gabedit70 using the AMBER force field58 with the QuasiNewtonian method until convergence was reached. The structures were then subjected to a preliminary quantum chemical calculation using the B3LYP method71 with the 3-21G Pople basis set72 in ORCA.73 PFOS(H) converged after 25 steps, DEHP after 22 steps, and BPRB after 21 steps of this preliminary run. The positive control molecule benzo[a]pyrene diol epoxide had three inputs for the quantum chemical calculations (three outputs from the MD calculations). These were treated equally to the other molecules mentioned above and converged after 36 cycles (structure no. 1), 17

cycles (structure no. 2), and 15 cycles (structure no. 3). The outputs from this preliminary calculation were then run in ORCA73 using the B3LYP functional71 in combination with def2-SVP basis set,74 with DFT-D3(BJ) dispersion correction75 employed to give the final resulting geometry for the wave function analysis. Resolution of the identity (RI) technique76 was used to accelerate the calculation. Convergence for each group was: DEHP-A21 (18 cycles), PFOS(H)(A21-T21) (93 cycles), BPRB-(T1-C2-G1) (28 cycles), BAP-T1-A1 (48 cycles), BAP-A21-T21 (20 cycles), BAP-A21-T21 (20 cycles). Wave Function Analysis. Molden,77 Chemcraft,78 Multiwfn,79 and AdfView AdfInput69 were used to analyze the interaction between each molecule and the respective moiety on the DNA. The prioritized interactions where the noncovalent interaction index (reduced density gradient with promolecular approximation79), commonly used52,79,80 to assess van der Waals, electrostatic, and polar interactions, the Laplacian of the electron density (LED) used to derive hyperfine electron density profiles,80,81 the frontier orbitals and the Mulliken82 charges. Bonding Energies. Bonding energies were calculated by saving each fragment from the output of the final quantum chemical calculation into one separate file: the DNA bases as one fragment (file 1) and the pollutant molecule as a second separated fragment (file 2). These fragments (saved as XYZ files in AdfInput69, see Supporting Information) were prepared for ORCA calculation using Gabedit.70 The ORCA quantum chemical geometry optimization was run with the same parameters set above: the B3LYP functional71 in combination with def2-SVP basis set,74 with DFT-D3(BJ) dispersion correction75 and RI technique.76 The formula used for this calculation is the conventional bonding energy formula; Ebonding = Ecomplex − (EDNA‑bases+ Epollutant), where Ecomplex is the calculated energy for each pollutant in complex with the interacting DNA bases (see Quantum Chemical Calculations). EDNA‑bases is the optimized energy of the bases only, in a separated state from the pollutant, and Epollutant is the resulting energy of the pollutant per se, thus without the bases present in its molecular environment. Ebonding is the resulting bonding energy for the noncovalent interaction between the bases and the pollutants. 24


Article


Figure 2. Molecular interaction of PFOS(H) with the bases at the end of the p53 suppressor DNA (A21T21) generated from quantum chemical calculations. (A) Molecular structure of neutral PFOS(H) and A21T21 with atomic groups and H-bonds visible; (B) complex of PFOS(H) and A21T21 colored by Mulliken charges (see bar on right). (C) High-lying occupied molecular orbitals, situated on the thymine 21 ring moiety; (D) low-lying unoccupied molecular orbital, situated on the sulfate group of the PFOS(H) molecule; (E) noncovalent interaction index between A21T21 and PFOS(H), indicating a very weak noncovalent interaction between fluorine atoms and partial positive charges (≈ +0.2) of the thymine 21 nitrogen atoms. This figure shows also the H-bond between sulfur and the oxygen on the ribose bridge. (F) Map of the Laplacian of the electron density, which shows a predominant electronic density on the fluorine atoms (highly electronegative), which forms the weak interaction with the partial positive charges on the thymine and the adenosine bases. A generated in Molden,77 B generated in Chemcraft,78 C, D, F generated in Multiwfn.79 E generated in Multiwfn79 and reproduced in AdfView.69 Iso-value of C (−0.20); D(−0.20); E(0.45); F (−0.22). Displayed distances in Å.

■

Wave Function Analysis. The analysis of the final output of the PFOS(H)-DNA moiety complex reveals that the major anchor for the interaction is the H-bond formed by the sulfur group (Figure 2A). The high-lying occupied orbital is entirely situated in the adenosine plane (Figure 2C), while the low-lying unoccupied molecular orbitals are entirely located toward the sulfate-end of the PFOS(H) molecule (Figure 2D). The Hbond is also aided in bonding PFOS(H) and the DNA by the noncovalent interaction between the PFOS(H) molecule and the base plane of A21 and T21 (Figure 2 E). Overall, the noncovalent interaction is thus sustained by one H-bond and two weakly polarized groups, the electronegative fluorine atoms, and the partial positively charged nitrogen atoms on the thymine (T21) and adenosine (A21) rings (Figure 2E). The Laplacian of the electron density (Figure 2F), which gives a more accurate description of the electron densities,52 shows that the fluorine and the planar surfaces of the bases A21 and T21 are in a compatible configuration by density of electrons and form the basis for the interaction between PFOS(H) and the DNA terminus by a weakly polarized electrostatic

RESULTS Perfluorooctanesulfonic Acid. PFOS(H) in its neutral protonated form bonded noncovalently to the p53 fragment in one of five simulations and remained in a stable van der Waals interaction with the end of the DNA, interacting with adenosine 21 and thymine 21 (Figure 1 and Figure S11). This interaction oscillates between −40 and −60 kJ/mol in Lennard-Jones potential between the DNA and PFOS(H) (Figure S11), led to the expulsion of water molecules from the surface of the DNA bases in the simulation, and formed the noncovalent complex of PFOS(H)-DNA observed (Figure 1). To assess the strength and stability of the complex, quantum chemical calculations were run on the extracted residues (A21T21-PFOS(H)) from the complete water-DNA-PFOS(H) system. The calculations converged after 93 cycles and show that the fluorine atoms interact with the surface of adenosine and thymine 21, while the sulfate group remains in H-bond contact to the epoxide oxygen at the terminus of the adenosine moiety. To asses the details behind this interaction, the complex is studied below by wave function analysis.79 25


Article

Chemical Research in Toxicology attraction. This bonding of PFOS(H) to the terminal part of the DNA can show how the interaction between PFOS(H) and DNA can cause complications in the restriction and splicing processes that the cell undergoes and thus cause the DNA and gene expression problems that have been documented recently (vide inf ra). Comparison with Empirical Data. No crystal structure of PFOS in complex with DNA moieties is available; however, a recent study83 shows that PFOS has the ability of lowering the expression levels of several genes. This is agreement with also other studies,84 which report the same interfering effect of PFOS on genetic transcription. These studies report also upregulation of the p53 gene itself, which suggest that the results can also result toward inhibition of silencer genes of the p53 suppressor, accounting for the interaction between PFOS and the DNA. This remains however to be confirmed by dedicated in vitro/in vivo studies. The results found by the calculations suggest thus that PFOS can act via three possible scenarios. (1) It can bind to the DNA by H-bonds via its sulfur oxygens and inhibit transcription activity by the polymerases via steric occupation on the DNA surface. (2) Alternatively, PFOS can bind to the heteronuclear RNA (hRNA) in a similar fashion as calculated here and inhibit the translation enzymes to splice it to the correct mRNA (mRNA) sequence. (3) PFOS can bind by H-bonds to the mRNA and disrupt its bonding to the peptidyl transferase system, thus reducing the production of proteins from their genetic source, as reported in the mentioned studies. Several studies show that PFOS binds to proteins rather stably;26−28,30 however, no studies show that it binds to the DNA, although genotoxic effects are reported as mentioned above. It is difficult to estimate the exact nature of interaction between PFOS and the DNA without a crystal structure, in such exemplary case as benzo[a]pyrene diol epoxide cocrystallized with a DNA fragment;55 however, the results observed in both the simulations, the quantum chemical calculations and the calculated bonding energy of the PFOSDNA complex (Table 1), suggest that PFOS can bind to exposed DNA ends where negative charges are not present at such degree as on the strand-surfaces. However, in the case of the DNA surface, where negative charges are present and extensive, the fluorine atoms may be too negatively partial charged to form stable complexes that disturb transcription and repair of the DNA. Also, accounting for the putative alternative of PFOS− interacting with the DNA with its negative charge, the repulsion may be even greater than what is observed here for the neutral specie. This is given that the presence of negatively charged ions on the phosphate groups are likely to repel the bulky and electronegative fluorine atoms, and prevent contact between PFOS and the planar surfaces in between bases in the double helix, such as is the case for benzo[a]pyrene diol epoxide.55 However, as the simulations indicate, PFOS can interact with the exposed ends of the DNA and remain in a hydrogen bonded network with accessible H-bond donors, such as the phosphate groups, while the fluorine chain can form a polarized electrostatic interaction with the surface of the DNA bases. Interestingly, the energy of a H-bond between a hydroxyl group and an oxygen atom is experimentally determined to be approximately −29 kJ/mol. Accounting for the current system here (PFOS(H)), the H-bond donor is a sulfate group instead, and it is thus feasible to anticipate that the major part of the resulting bonding energy of PFOS(H) to the DNA (−23.56 kJ/ mol, Table 1) is largely represented by the H-bond, and minor credit may be attributed to the fluorine atoms in interaction

Table 1. Bonding States of Quintuple Simulations of DNA with, Respectively, PFOS(H), BPRB, DEHP, and Positive Control BAP

molecule

interaction with DNA

PFOS(H) simulation 1 simulation 2 simulation 3

unbounded unbounded bounded

quantum mechanical bonding energy (kJ/mol)

interaction type

interacting DNA residues

−23.56

H-bond (sulfate group)

A21, T21

−94.92

H-bond, polar, van der Waals

T1,C2, G2

electrostatic, van der Waals.

A21

van der Waals van der Waals, H-bond, electrostatic van der Waals, electrostatic.

T1, A1 A21, T21

simulation simulation BPRB simulation simulation simulation simulation

4 5

unbounded unbounded

1 2 3 4

unbounded unbounded unbounded bounded

simulation DEHP simulation simulation simulation simulation

5

unbounded

1 2 3 4

unbounded unbounded unbounded bounded

simulation 5 BAP simulation 1 simulation 2

unbounded bounded bounded

−6544.52 −7034.66

simulation 3

bounded

−7578.67

simulation 4 simulation 5

unbounded unbounded

−216.52

A21, T21

with the planar surfaces of the bases A21 and T21. This shows also, that the usual form of PFOS, the negatively charged variant, PFOS− will not be able to form any H-bonds in this similar fashion to PFOS(H), unless there are strongly positive charges available on the DNA surface. However, partial positive charges are present only on the inner parts of the DNA and not on the exposed surface, which leaves the DNA particularly vulnerable for intercalation during the single-strand form, during replication. A separate study to confirm this is required. Bis(2-ethylhexyl)-phthalate. The simulations of DEHP with the p53 suppressor gene core domain showed that the probability of forming a noncovalent stable interaction between DEHP and the DNA is 1/5 (Table 1). The interaction is similar to PFOS(H) at the exposed end of the gene core domain and is localized on the adenosine (21) moiety (Figure 3). The DEHP molecule was able to expel the water molecules on the thymine surface by sheer hydrophobic interaction between the partially positively charged peripheral hydrogens of the benzoic group of DEHP and the negative charge (−1) of the phosphate group, and through hydrophobic interaction from the aliphatic tail of the DEHP and the surface of the adenosine ring. This interaction is primarily enforced by the electrostatics from the phosphate group and the benzene hydrogens, which are known to be positively partial charged,3,85 and by the ability of the aliphatic tails of the DEHP to expel water molecules from the 26


Article


Figure 3. DEHP in noncovalent interaction with the p53 suppressor core domain (PDB: 4HJE). Left: Resulting configuration of the DEHP bound to the surface of the open end of the p53 DNA fragment. Water molecules are shown as small dots for clarity. Generated in Visual Molecular Dynamics.102 Right (Framed): Magnification of the bonding site of DEHP to the DNA end, interacting noncovalently with one base, A21 from the DNA. Generated in Chemcraft.78 Waters shown as red and white dots for simplicity.

base surface. This interaction results as −60 to −70 kJ/mol in Lennard-Jones interaction energy between the DEHP and the DNA molecules in the water simulation (Figure S71). Indeed, this interaction forms the stable complex that remains in configuration at 37 °C (cell temperature), which is analyzed below for electronic properties. Wave Function Analysis. In a detailed analysis, the interaction between A21 at the DNA terminus of the p53 suppressor fragment and the DEHP molecule is revealed by its electronic and wave function properties (Figure 4) to be sustained by the hydrophobic interaction from the aliphatic tail of the DEHP molecule and the plane of the adenosine moiety. This interaction is shown in Figure 4E, which depicts the noncovalent interaction index (also known as reduced density gradient). Interestingly, the interaction appears to have a large contact-surface between DEHP and the A21 molecule; however, the second hexyl chain is in no contact with the DNA whatsoever. The accommodation of both hexyl chains appears impossible given the steric restrictions on the benzene carboxyl groups and the surface character of the open end of the DNA. Importantly, however, the role of the benzene ring in bonding seems equally, if not more, important than the hydrophobic DEHP tail, as it forms an electrostatic interaction from its slightly acidic hydrogens (see study on aromatic hydrogens85) to the negative charge of the adenosine phosphate group (Figure 4E). The DNA bases and DEHP have no apparent frontier interaction of LUMO and HOMO orbitals (Figure 4C,D) and thus do not carry a particular potential for chemical reactivity, at least in this approximated configuration by MD optimized by QM calculations. The electron density Laplacian (LED) shows also that the interaction between the slightly acidic benzene hydrogens and the phosphate group is evident, where the benzene ring orients itself toward the phosphate oxygen (Figure 4A,F). The LED

depicts a three-dimensional overlap between high Laplacian of electron density on the phosphate oxygen and low value of the Laplacian on the hydrogens. This is also observed by considering the population of the Mulliken charges (Figure 4B), which shows the +0.37 charge of the benzene hydrogens and the negatively charged oxygens from the phosphate group (total charge of −1). The ribose unit of A21, which is more visible in Figure 4E, shows no apparent interaction with the DEHP molecule. The carboxylate group at the root of the aliphatic tail of DEHP appears to be outside of interaction with the adenosine ring moiety. However, the adenosine ring bears a subdivision of partial charges, which are compatible to the interacting aliphatic tail (Figure 4B, green colored atoms), as well as favorable electrostatic Laplacian densities with the aliphatic tail (Figure 4F). This forms an overall chemical compatibility between the ring moiety of adenosine and the aliphatic hexyl chain of DEHP. Comparison with Empirical Data. No crystal structure of DEHP in complex with the DNA has been generated over the years; however, there are several studies on the effects of DEHP on genomic stability, DNA expression patterns, as well as RNA studies. Initially, DEHP was not found to induce any genotoxic effects on the DNA86 and thus display that no covalent interaction occurs between DEHP and DNA. The results from the molecular simulation and the quantum chemical studies do confirm this, and that there is no chemical indication of that any interaction of electron-exchange takes place between DNA and DEHP (Figure 4). DEHP can however still form a threat to the DNA by either establishing stable noncovalent bonds to its bases or by obstructing the transcription enzymes and the polymerase/gyrase/helicase system. In this study, considering only the DNA, one can confirm that there is a probability of 1/ 5 of that DEHP forms a stable noncovalent interaction with the DNA, and this can pose problems to the DNA-transcription/ 27


Article


Figure 4. Molecular interaction of DEHP with the open end of the p53 suppressor DNA (T21) resolved by quantum chemical calculations. (A) Molecular structure of DEHP in interaction with Adenosine 21 (A21); (B) complex of DEHP and A21 colored by Mulliken charges (see bar for values); (C) occupied orbitals of the complex of DEHP and A21; (D) unoccupied orbitals of the DEHP-A21 complex; (E) noncovalent-interaction index (known also as RDG-gradient) of DEHP-A21; (F) Laplacian of the electronic density of DEHP-A21. A generated in Molden,77 B generated in Chemcraft,78 C−F generated in Multiwfn.79 Iso-surface values: C (0.05); D (0.05); E (0.30, Visualized in AdfView69); F (−0.22). Black arrow (E − right side): highlighted negative charge from phosphate oxygen (A21) interacting with positive partial charges on benzene ring. Black arrow (E − left side): highlighted van der Waals interaction between adenosine ring and DEHP hexyl chain no. 1. Blue arrows (F): Highlighted electrostatic interaction from the Laplacian of the electron density of the positive partial charges of benzene hydrogens and negative charge on phosphate oxygens (A21). Displayed distances in Å.

repair system. Indeed, DEHP has been studied for disturbance of expression of the p53 suppressor gene recently,87 which provides an interesting report to compare the simulations of precisely the interaction between DEHP and the p53 suppressor gene core domain as calculated here. The study by Erkekoglu et al.87 shows that p53 protein expression is significantly reduced by 35% compared to negative-control cells by the DEHP molecule. The study by Erkekoglu et al. shows also that DEHP affects the DNA expression by bonding to the DNA bases, confirmed by the additional results by Erkekoglu et al., which show that two repair molecules, selenomethionine and sodium selenite, do not change or reduce the detrimental effect that DEHP has on the p53 protein expression. In other words, DEHP targets the DNA in a mechanism independent of the ability of the cell to repair and protect the DNA. The exact nature of the mechanism is not clear; however, the current results in this study show that there is a molecular and

electronic basis for a stable interaction between DEHP and the DNA and that this interaction can prolong for nanoseconds (Figure S75), which is sufficient in the realm of the molecular biological time-perspective to disturb expression of the p53 and thus give the effects reported by Erkekoglu et al. In another study, von Däniken et al.88 radiolabeled DEHP and incubated it in vivo in rat models as 1% of the diet for a period of 4 weeks. During this period, the group extracted liver biopsies and measured radioactive material in the liver cells and was able to record DNA-bonded DEHP, only when the radiolabel group was assigned to the aliphatic group of the DEHP molecule. This was also confirmed by a second similar study by Lutz89 who measured no DNA bonding effect when the DEHP molecule was labeled on the carboxylate group carbon atom. In other words, two separate studies show that DEHP does not bond to the DNA when a radiolabel is applied on the benzene ring-carboxylate part. 28


Article


Figure 5. Butylparaben (BPRB) bound noncovalently to the p53 suppressor gene. Right side, (framed): Interacting DNA bases mostly in pink (atom color) and BPRB in white (residue color). Rendered in Chemcraft.78 Abbreviations: T1, thymine 1; G2, guanosine 2; C2, cytosine 2. Waters shown as red dots.

and thymine 1. The “head” of the BPRB molecule (benzoic acid moiety) is on the other hand inclined toward the guanosine backbone atoms and forms a H-bond between its hydroxyl group and the phosphate group of guanosine 2. This interaction leads to the accommodation of the benzene ring in a highly relaxed conformation posed toward the guanosine ring, forming additionally a ring-to-ring planar π−π interaction. This form of interaction is ideal for an intercalator, as benzo[a]pyrene diol epoxide has also displayed in its original crystal structure,55 which is characterized as a compression of the bases on the pyrene rings, forming a sandwich-like conformation of the intercalated complex. The interaction between BPRB and the base pairs is sustained by a series of electronic features, which are described below. Wave Function Analysis. Butylparaben assumes a planar and linear orientation in a pocket formed between T1, G2, and C2, where the bases allow for its positioning between the base rings, in an energetically favored configuration with a large intermolecular contact-surface (Figure 6). This contact surface is maintained by the triple H-bond between the G2 and C2 residues (Figure 6A) and the inclination of the thymine 1, which forms a molecular boundary interacting with the aliphatic group of the paraben molecule. The charge-interaction between the groups is a second factor maintaining this contact-surface, which, as defined by the Mulliken charges (Figure 6B), displays that the alpha-carbon of the BPRB molecular (benzene carbon with attachment to the aliphatic tail) gains a positive partial charge (+0.9), which interacts well with the negative partial charges of the guanosine nitrogen and carbon (N7: −0.5, C5: −0.20). The polar phosphate oxygen from the guanosine 2 base forms additionally a stable H-bond with the benzene hydroxyl hydrogen from the paraben ring. There is additionally a stable hydrophobic interaction between the aliphatic hydrogens at the end of the paraben tail and the thymine carbons, which further stabilizes the complex. The first two aliphatic carbon atoms from the BPRB tail form instead a stable van der Waals interaction with the hydrogens of the cytosine 2 ring moiety. The negative charges from the phosphate groups are localized at the boundaries of the pocket and do not directly participate in the bonding framework.

Comparing such a finding with the molecular simulation and quantum chemical calculations is not trivial, given that 14C does not differ in partial charge or atomic radius; however, its different electronic levels are expected to differ from regular 12 C. This is based on that the potential energy operator in the Hamiltonian of 14C changes when the atomic mass, Z, is increased from 12 to 14, thus giving rise to different energy levels as the solutions to the Schrödinger equation for the 14C atom compared to the 12C. In other words, the potential energy of 14C is different (stronger) from 12C and possibly can affect the bonding character to the hexyl chain and the torsions allowed by the bond to the benzene ring. The accommodation of the aliphatic hexyl chain and the orientation of the benzene ring is shown in the previous section to be critical for a favorable bonding between DEHP with the DNA adenosine moiety. Theretofore, the empirical results88,89 show no bonding of DEHP to DNA when 14C is at the anchor between the aliphatic hexyl and the benzene, the torsions between the benzene and the aliphatic ring may be affected, and thus not allow for a proper interaction between the aliphatic chain and the DNA bases as observed in these calculations. Butyl Paraben. Butyl paraben was the only compound of the four studied that not only bonded to the terminus of the DNA, but also intercalated between two base-pairs of the same strand (thymine 1 (T1) and cytosine 2 (C2)). This intercalation led BPRB to bury itself more into the DNA surface, forming a noncovalent interaction with T1, G2, and C2 (Figure 5). As for the PFOS(H) and DEHP simulations, it has a 1/5 probability of interacting with the DNA by considering the presented model of study. Compared to DEHP and PFOS, BPRB is the molecule that has formed the most intricate network of interaction to the DNA bases. Its interaction can be observed in the Supporting Information (Figure S51), where it intercalated within 0.5 ns into the DNA, forming a stable interaction oscillating along the 20 ns period between −75 and −50 kJ/mol, and down to −110 kJ/mol in the Lennard-Jones potential. The molecular surface (Figure 5) shows indeed that butylparaben is partly buried in the van der Waals field of the terminus of the DNA, and intercalates with the hydrophobic tail toward cysteine 2, squeezed between the rings of cysteine 2 29


Article


Figure 6. Quantum chemical geometry of the complex of butylparaben (BPRB) and the three interacting DNA bases (T1, C2, G2) from the open end of the p53 gene core suppressor domain. (A) Molecular structure of the optimized geometry; (B) complex of BPRB and the three bases colored by Mulliken charges (see bar for values); (C) high-lying occupied molecular orbitals, iso-value 0.050; (D) low-lying occupied molecular orbitals, isovalue 0.050; (E) noncovalent interaction index between BPRB and the three terminal bases (T1, C2, G2), iso-value 0.30. (F) Laplacian of the electron density, iso-value 0.40. A generated in Molden;77 B generated in Chemcraft;78 C−F generated in Multiwfn;79 E generated in Multiwfn79 and visualized in AdfView.69 Displayed distances in Å.

epoxide and its intercalating bases.55 The Laplacian of the electron density, which gives a hyperfine description of the distribution of the electron density, shows that there is an electrostatic interaction between the paraben carbonyl and the N7 atom on guanosine 2 (Figure 6F). This polarization in Laplacian of the electron density, between high and low values, can be observed across the complex and shows how several sites on the molecules are in an electrostatic interaction between large and small spherical densities (high and low electron occupancy). Comparison with Empirical Data. There are no available structures of a crystallized complex of a paraben and the DNA; however, there is mounting evidence that parabens interact with the Golgi-apparatus and potentially the DNA. In a particular study,90 butylparaben was found to increase methylation rates on rate male DNA with exposure on the testes. The results suggest that butylparaben affects the state of the DNA during the mitotic and postmeiotic stages, when the

The complex is analyzed also for wave function properties, where the frontier orbitals (Figure 6C,D) display no geometrical vicinity of occupied and unoccupied states, thus abolishing any reactivity basis for forming adducts between any of the three bases and the BPRB molecule in this current configuration. Interestingly, however, the cytosine residue appears to be the most receptive for electrons of all the bases, accounting for this interaction with paraben. Paraben is however unable to provide electrons or empty orbitals to form a chemical basis for an electron transfer between to the DNA. The contact surface of the BPRB-T1-G2-C2 is another factor of interaction and is also studied in detail (Figure 6E), where the noncovalent interaction index shows a large contact surface between the paraben ring and the guanosine moiety, and the cytosine ring and the aliphatic hydrogens of paraben. This interaction is seemingly π-ring to π-ring, and thus presents quite a stable framework, similar to ring-to-ring interactions observed in the crystal structure of benzo[a]pyrene diol 30


Article


Figure 7. Bonding configurations of benzo[a]pyrene to the DNA. (A) Crystal structure complex, with BAP covalently bound to adenosine;55 (B) simulation no. 2, DNA surface of the open end with BAP bound noncovalently; (C) close-up view of the complex from MD simulation no. 1 (see Table 1 for details), with BAP docked on top of adenosine with the epoxide far beyond the reach of the adenosine amine group; (D) close-up view of the MD simulation no. 2, with BAP docked over adenosine while forming a stable polar bridge between the epoxide oxygen and the amine hydrogen from thymine 21, with a distance of 1.87 Å; (E) close-up view of the MD simulation no. 3 (see Table 1 for details), where BAP is docked over adenosine, however, with its epoxide group oriented up-wards, away from the bases. A, C, D, and E visualized with AdfInput, part of ADF package.69 B visualized with VMD,102 with DNA viewed in “Quicksurf” mode, waters viewed as red and white dots.

and the amine nitrogen on the exposed DNA base, and the covalent bond is formed between benzo[a]pyrene and the base.53,54 This was well studied in detail using quantum chemical calculations and shows that a particular angle as well as distance is required for adduct formation bonding reaction to occur.52 The results of the MD simulation of benzo[a]pyrene diol epoxide and the p53 suppressor gene core show a rather intriguing result, where benzo[a]pyrene intercalates in three out of five simulations to the open end of the DNA (Table 1). Out of the three resulting intercalations resulting from the MD, two have the epoxide group oriented correctly, according to the crystal structure55 and according to the reactivity study of BAP on adduct-formation52 (see Figure 7). Of these two configurations, simulation no. 2 has the reactive groups of the epoxide group from BAP and the amine group (Thymine 21) oriented in a reaction-favorable orientation and distance.52 This configuration is very similar to the crystal structure of benzo[a]pyrene diol epoxide intercalated in the DNA55 and shows the same preserved features of intercalation. These features are that benzo[a]pyrene can bond noncovalently to the open end of the DNA by exposing its epoxide ring toward the base and are reproduced quite accurately in the BAP simulation no. 2 (Table 1) (Figure 7D). In this very simulation run, the BAP molecule docked on top of the cytosine ring on the end of the DNA, pressed the thymine21 residue away from H-bond with adenosine 21, and formed the stable polar interaction with Adenosine 21’s amine group (Figure 7D). This interaction is considered as an adduct-formation precursor and is an excellent example of the potential of molecular simulations as starting platform for intercalation studies. The interaction occurred after 0.8 ns and remained stable throughout the 20 ns period. The interaction oscillated between −50 and −80 kJ/mol in Lennard-Jones potential between the DNA and the BAP molecule (see Supporting Information, Figure S15). Given the excellent orientation of BAP with adenosine 21 in simulation no. 2, simulation nos. 1 and no. 3 are not analyzed by wave

splicing takes place. During these stages, the DNA is copied, thus requiring strand-opening by gyrase enzyme and proofreading by the polymerase enzyme family. This stage is critical for DNA replication, and as the report90 indicates, a protective mechanism triggered toward the DNA, butylparaben can be confirmed to be able to enter the nucleus. However, no titration curve or empirical data on DNA-bonding is provided by Park et al.,90 and as DNA-bonding cannot be confirmed solely by recording hypermethylation, it was then assumed that paraben enters the Golgi apparatus and formed an interaction with primarily DNA processing enzymes, as confirmed by another study.91 A most recent study, however, confirms that the paraben structure (methyl paraben) binds to the DNA.92 Methylparaben has a shorter aliphatic chain than BPRB and apparently intercalates in the DNA, with a bonding-constant of 1.56 (±0.25) × 104 (see study by Baytak et al.92). The intercalation was determined by voltammetry and shows that the preserved benzoic acid moiety, which is common for all parabens, is the most probable anchor for intercalation, which according to our simulations and quantum chemical calculations has the strongest bonding energy to the DNA (H-bonds + π−π stacking). The quantum chemical analysis shows that through the benzoic group the paraben is able to form an intercalating aromatic-plane to aromatic-plane interaction plus H-bond with guanosine 2 in the p53 suppressor gene core domain, which is very similar to the intercalation mode of benzo[a]pyrene diol epoxide, in a sandwich configuration between two base-planes. Positive Control Molecule: Benzo[a]pyrene diol epoxide. The positive control molecule benzo[a]pyrene diol epoxide (BAP) is the active and carcinogenic metabolite generated by the action of the CYP450 system on the inactive precursor, benzo[a]pyrene.3 When it intercalates in the DNA, it poses the epoxide group toward the adenosine amine group in such an orientation52 that an electron transfer takes place from the epoxide bond to the amine group on the interacting base. This forms the electron exchange between the epoxide bond 31


Article


Figure 8. Quantum chemical optimized geometry of simulation no. 2 of the complex of benzo[a]pyrene diol epoxide (BAP) and the two interacting bases (A21, T21) from the terminus of the p53 gene core suppressor domain. (A) Molecular structure of the optimized geometry; (B) complex of BAP and the two bases colored by Mulliken charges (see bar for values); (C) occupied molecular orbitals (HOMO), iso-value 0.050; (D) unoccupied molecular orbitals (LUMO), iso-value 0.050; (E) noncovalent interaction index between BAP and the two terminal bases (A21, T21), iso-value 0.30. (F) Laplacian of the electron density, iso-value −0.22. A generated in Molden,77 B generated in Chemcraft,78 C−F generated in Multiwfn,79 E generated in Multiwfn79 and visualized in AdfView.69 Displayed distances in Å.

BAP intercalation52−55 and the angular benzene ring has its epoxide group oriented toward the amine nitrogen with its high-lying occupied molecular orbitals (Figure 8C) situated on the epoxide oxygen atom. The LUMO (low unoccupied molecular orbital) (Figure 8D) is also situated on the epoxide oxygen and not on the nitrogen from the thymine site, as would be optimal for a frontier interaction; however, the Laplacian of the electron density (LED) shows clearly that the electrons from the epoxide oxygen orbit toward the amine nitrogen with a visible extension of the Laplacian (Figure 8F). Concomitantly, the amine nitrogen has its Laplacian oriented in a perpendicular plane to the orientation of the epoxide oxygen’s LED (Figure 8F). In other words, the amine nitrogen has its LED orbit extending along the ring moiety of the thymine, following the aromatic bond patter of the thymine ring. The epoxide hydroxyl forms additionally a H-bond with the ribose unit of

function analysis and only reported in Figure 7 along with the calculated bonding energies. Wave Function Properties. The wave function analysis of the complex of BAP-DNA resulting from simulation no. 2 shows a highly favorable bonding state with a bonding energy of −7034.66 kJ/mol (Table 1). It is noteworthy to initially state that during the preoptimization with molecular mechanics parameters of the structure of BAP-T21-A21 resulting from the MD, the BAP molecule surprisingly moved away from the DNA bases. However, this was rectified by the QM calculations which posed it back to its original configuration from the MD output, with a distance of 3.06 Å (Figure 8B) between the epoxide oxygen and the amine nitrogen on the thymine 21 residue. The BAP plane is in an excellent alignment with the adenosine plane and has a strong noncovalent interaction index with a large contact surface (Figure 8E). This is standard for 32


Article


The use of docking techniques to the DNA has been used in several cases, where molecular flexibility and ligand torsions,98 also with combination of Flex algorithm,99 as well as other methods for studying bonding modes of several intercalators.100 This study is however focused on including a dynamic solvent interaction with the DNA and the intercalating molecule, which docking cannot reproduce fully. Docking can profile a series of advantages; however, its ranking and score can often be populated by alternative orientations, which do not necessarily imply intercalation. Reviewing the results can also be a laborious work; instead, using MD, a DNA−ligand interaction plot (Supporting Information) can show if interaction has occurred, without necessity to investigate the results visually. Combining docking and ab initio or QM calculations has also been performed by some;101 however, yet again the simulation environment that MD provides, with salt concentration at physiological levels, and temperature inclusion at 37 degrees is expected to give a more realistic picture of the molecular events occurring at an actual time scale. The devised QM approach here has also assured that bonding energies and bonding properties are studied in great detail and that these can be compared to experimental data. The disadvantages of using MD in screening for DNA-intercalation can be the computationally expensive, compared to docking, however, for a small set of molecules, such an approach is quickly feasible. In a cellular environment, the compounds modeled in this study would react with a variety of receptors, compounds, and organelles, which would indeed form stable as well as instable complexes. For the unstable complexes, which are theoretically formed between any of the three compounds and nucleus component, such as the Golgi-apparatus, the compound can therefore be based on the simulations fully migrate further to the DNA and form semistable complexes, as found above. These results supplied here give therefore a quantitative measure on how large is the risk, and given that BAP has been found to reach the DNA and form stable complexes, both DEHP and BPRB will most likely be even more able to reach the DNA as they are more soluble. The results presented herein show also how important it is to limit the spread and presence of PFOS, DEHP, and BPRB in the environment, as they all show specific affinity to bind to the DNA from this study. BPRB, in particular, is daily applied in cosmetics to a large population, and its evaluation for use in cosmetics should therefore proceed with regulatory action. PFOS, in particular, which has also shown several other effects (see above), requires also stringent limitation to prevent its presence in the environment. DEHP, which is still in use in some countries, has also, by the results of this study, been shown to be a template compound for toxicity and ecotoxicity studies. All three, in general, show that they do pertain the ability to interfere with the DNA and the nucleus from the results of this study and should therefore be studied accordingly for DNA interference.

thymine 21. This structure can quite safely be stated as an excellent spontaneously formed precursor of adduct formation using in silico techniques, which, from molecular dynamics simulations and after two optimizations (one in vacuo using molecular mechanics parameters and one with the QM method B3LYP with the 3-21 basis set of electronic wave functions) and one final full calculation (see methods), results as highly similar to the crystal structure. BAP forms adducts preferably with high affinity for guanosine residues and subsequently toward adenosine;55,93−95 however, it is reported to form adducts with thymine as well,96 as resulted in simulation no. 2 (as a precursor to adduct formation). Thymine is the base-partner to adenosine, and forming only two H-bonds may be an easier candidate for dynamical intercalation, as adenosine has a larger surface which interacts better with the large planar surface of BAP, particularly being at the end of the DNA.

■

DISCUSSION The results show a preference of the four toxicants for the terminal parts of the DNA, accurately as for the crystal structure case of BAP in its interaction with the end of the DNA.55 This unique crystal structure reference of DNA-BAP shows that intercalation happens both in the inner parts of the double helix, as well the outer part.55 However, the simulations all resulted with the same orientation, toward either of the ends of the p53 suppressor. Computationally speaking, there can be a preference for the end, given the reduced electrostatic charge distributed on its surface, compared to the inner parts of the double helix; however, the position restraints that are necessary for DNA simulations may also play a role and reduce the number of possible conformations that the toxicants may assume. Removing the restraints from the DNA has been attempted in several preliminary runs (data not shown), however, results in a separation of the two strands during the simulations. There may however be a fine-tuning potential of the GROMACS position restraints during simulations, which allows accommodation of the intercalator without leading to separation of the DNA helix; however, this was out of the scope of the project, and is considered in a subsequent work, to define the relationship between the effects of position restrains and intercalation energy. The results show therefore the most probable intercalation scenarios but probably not all of them. The intercalations at the ends of the DNA occur rather independently of the restraints, as the molecules docked on the surface of the ends and not in between the base-pairs. This shows that the actual simulated events are not artifacts; however, as mentioned afore, there may be additional bonding modes to the DNA of these compounds, as also seen in the crystal structure of benzo[a]pyrene,60 which requires finer tuning of the position restraints. The results show also that benzo[a]pyrene is the potent intercalator as known from the literature52,53,55,93−95 and that its bonding energies to an exposed DNA site, as the terminal region, are up to 300-times stronger than for PFOS for instance and 80-times stronger than butylparaben, which bonded with the strongest energy of the three selected pollutants (Table 1). These results indicate that PFOS, BPRB, and DEHP in particularly are most likely not a considerable threat to the DNA machinery, as adduct-forming compounds, such as PAHs;3,4,53,94,97 however, their reaction toward receptors and the DNA-enzymes may explain their effects on animals and humans, as reported in the introduction section.

■

CONCLUSIONS In this study, a blend of molecular dynamics simulations and quantum chemical calculations has been performed to investigate the probability of three key pollutants to undergo intercalation with the DNA and how stable are the eventual complexes. The results show that there is a low probability of intercalation for DEHP, BPRB, and PFOS(H) on the DNA (1 in 5) and when the complexes are formed to the terminal parts of the DNA the interaction between the pollutants and the 33


Article


(8) Ahrens, L. (2011) Polyfluoroalkyl compounds in the aquatic environment: a review of their occurrence and fate. J. Environ. Monit. 13, 20−31. (9) Ahrens, L., and Bundschuh, M. (2014) Fate and effects of polyand perfluoroalkyl substances in the aquatic environment: A review. Environ. Toxicol. Chem. 33, 1921−1929. (10) Ahrens, L., Norström, K., Viktor, T., Cousins, A. P., and Josefsson, S. (2015) Stockholm Arlanda Airport as a source of per-and polyfluoroalkyl substances to water, sediment and fish. Chemosphere 129, 33−38. (11) Fang, C., Wu, X., Huang, Q., Liao, Y., Liu, L., Qiu, L., Shen, H., and Dong, S. (2012) PFOS elicits transcriptional responses of the ER, AHR and PPAR pathways in Oryzias melastigma in a stage-specific manner. Aquat. Toxicol. 106, 9−19. (12) Sharpe, R. L., Benskin, J. P., Laarman, A. H., MacLeod, S. L., Martin, J. W., Wong, C. S., and Goss, G. G. (2010) Perfluorooctane sulfonate toxicity, isomer-specific accumulation, and maternal transfer in zebrafish (Danio rerio) and rainbow trout (Oncorhynchus mykiss). Environ. Toxicol. Chem. 29, 1957−1966. (13) Dauwe, T., Van de Vijver, K., De Coen, W., and Eens, M. (2007) PFOS levels in the blood and liver of a small insectivorous songbird near a fluorochemical plant. Environ. Int. 33, 357−361. (14) Inoue, K., Okada, F., Ito, R., Kato, S., Sasaki, S., Nakajima, S., Uno, A., Saijo, Y., Sata, F., Yoshimura, Y., et al. (2004) Perfluorooctane sulfonate (PFOS) and related perfluorinated compounds in human maternal and cord blood samples: assessment of PFOS exposure in a susceptible population during pregnancy. Environ. Health Perspect. 112, 1204−1207. (15) de Vos, M. G., Huijbregts, M. A., van den Heuvel-Greve, M. J., Vethaak, A. D., Van de Vijver, K. I., Leonards, P. E., Van Leeuwen, S., De Voogt, P., and Hendriks, A. J. (2008) Accumulation of perfluorooctane sulfonate (PFOS) in the food chain of the Western Scheldt estuary: Comparing field measurements with kinetic modeling. Chemosphere 70, 1766−1773. (16) Kannan, K., Tao, L., Sinclair, E., Pastva, S. D., Jude, D. J., and Giesy, J. P. (2005) Perfluorinated compounds in aquatic organisms at various trophic levels in a Great Lakes food chain. Arch. Environ. Contam. Toxicol. 48, 559−566. (17) Kannan, K., Yun, S. H., Rudd, R. J., and Behr, M. (2010) High concentrations of persistent organic pollutants including PCBs, DDT, PBDEs and PFOS in little brown bats with white-nose syndrome in New York, USA. Chemosphere 80, 613−618. (18) Pérez, F., Nadal, M., Navarro-Ortega, A., Fàbrega, F., Domingo, J. L., Barceló, D., and Farré, M. (2013) Accumulation of perfluoroalkyl substances in human tissues. Environ. Int. 59, 354−362. (19) Renner, R. (2001) Growing concern over perfluorinated chemicals. Environ. Sci. Technol. 35, 154A−160A. (20) Caserta, D., Bordi, G., Ciardo, F., Marci, R., La Rocca, C., Tait, S., Bergamasco, B., Stecca, L., Mantovani, A., Guerranti, C., et al. (2013) The influence of endocrine disruptors in a selected population of infertile women. Gynecol. Endocrinol. 29, 444−447. (21) Fei, C., Weinberg, C. R., and Olsen, J. (2012) Commentary: perfluorinated chemicals and time to pregnancy: a link based on reverse causation? Epidemiology 23, 264−266. (22) Dong, G.-H., Liu, M.-M., Wang, D., Zheng, L., Liang, Z.-F., and Jin, Y.-H. (2011) Sub-chronic effect of perfluorooctanesulfonate (PFOS) on the balance of type 1 and type 2 cytokine in adult C57BL6 mice. Arch. Toxicol. 85, 1235−1244. (23) Nakayama, S., Harada, K., Inoue, K., Sasaki, K., Seery, B., Saito, N., and Koizumi, A. (2004) Distributions of perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) in Japan and their toxicities. Environ. Sci. Int. J. Environ. Physiol. Toxicol. 12, 293−313. (24) Vassiliadou, I., Costopoulou, D., Ferderigou, A., and Leondiadis, L. (2010) Levels of perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA) in blood samples from different groups of adults living in Greece. Chemosphere 80, 1199−1206. (25) Zheng, L., Dong, G.-H., Zhang, Y.-H., Liang, Z.-F., Jin, Y.-H., and He, Q.-C. (2011) Type 1 and Type 2 cytokines imbalance in adult

DNA, which results in a favorable bonding energy, is considerably stable, however, 80−300-times weaker than one of the worst carcinogens and intercalators known to science. The blend of MD and QM shows that there is an excellent potential of simulating the phenomenon of intercalation in a dynamical system; however, there are developments required for future work, particularly evaluating fine-tuning of the DNAposition restrains on the bonding complex formation and stability. A following study is in progress.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.chemrestox.7b00265. All simulation data with energy profiles (PDF) Molecular structure (XYZ) Molecular structure (XYZ) Molecular structure (XYZ) Molecular structure (XYZ) Molecular structure (XYZ) Molecular structure (XYZ)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Sergio Manzetti: 0000-0003-4240-513X Funding

This project was funded by private funds of Fjordforsk A/S Institute for Science and Technology. Notes

The author declares no competing financial interest.

■

ABBREVIATIONS BPRB, butylparaben; BAP, benzo[a]pyrene diol epoxide; DEHP, bis(2-ethylhexyl)-phthalate; PFOS(H), protonated state of perfluorooctanesulfonic acid; PHT, phthalates; QM, quantum mechanics; MM, molecular mechanics; MD, molecular dynamics; T, thymine; A, adenosine; G, guanosine; C, cysteine

■

REFERENCES

(1) Lee, D.-H., Steffes, M. W., Sjödin, A., Jones, R. S., Needham, L. L., and Jacobs, D. R., Jr (2010) Low dose of some persistent organic pollutants predicts type 2 diabetes: a nested case−control study. Environ. Health Perspect. 118, 1235. (2) Rosa, M. D., Zarrilli, S., Paesano, L., Carbone, U., Boggia, B., Petretta, M., Maisto, A., Cimmino, F., Puca, G., and Colao, A. (2003) Traffic pollutants affect fertility in men. Hum. Reprod. 18, 1055−1061. (3) Manzetti, S. (2012) Ecotoxicity of polycyclic aromatic hydrocarbons, aromatic amines, and nitroarenes through molecular properties. Environ. Chem. Lett. 10, 349−361. (4) Manzetti, S., van der Spoel, E. R., and van der Spoel, D. (2014) Chemical Properties, Environmental Fate, and Degradation of Seven Classes of Pollutants. Chem. Res. Toxicol. 27, 713−737. (5) Manzetti, S., and van der Spoel, D. (2015) Impact of sludge deposition on biodiversity. Ecotoxicology 24, 1−16. (6) Hiyama, T. (2013) Organofluorine Compounds: Chemistry and Applications, Springer Science & Business Media. (7) Giesy, J. P., and Kannan, K. (2001) Global distribution of perfluorooctane sulfonate in wildlife. Environ. Sci. Technol. 35, 1339− 1342. 34


Article

Chemical Research in Toxicology male C57BL/6 mice following a 7-day oral exposure to perfluorooctanesulfonate (PFOS). J. Immunotoxicol. 8, 30−38. (26) Mariussen, E. (2012) Neurotoxic effects of perfluoroalkylated compounds: mechanisms of action and environmental relevance. Arch. Toxicol. 86, 1349−1367. (27) Chen, N., Li, J., Li, D., Yang, Y., and He, D. (2014) Chronic exposure to perfluorooctane sulfonate induces behavior defects and neurotoxicity through oxidative damages, in vivo and in vitro. PLoS One 9, e113453. (28) Bischel, H. N., MacManus-Spencer, L. A., and Luthy, R. G. (2010) Noncovalent interactions of long-chain perfluoroalkyl acids with serum albumin. Environ. Sci. Technol. 44, 5263−5269. (29) Chen, Y.-M., and Guo, L.-H. (2009) Fluorescence study on sitespecific binding of perfluoroalkyl acids to human serum albumin. Arch. Toxicol. 83, 255−261. (30) Qin, P., Liu, R., Pan, X., Fang, X., and Mou, Y. (2010) Impact of carbon chain length on binding of perfluoroalkyl acids to bovine serum albumin determined by spectroscopic methods. J. Agric. Food Chem. 58, 5561−5567. (31) Inoue, K., Okada, F., Ito, R., Kato, S., Sasaki, S., Nakajima, S., Uno, A., Saijo, Y., Sata, F., Yoshimura, Y., et al. (2004) Perfluorooctane sulfonate (PFOS) and related perfluorinated compounds in human maternal and cord blood samples: assessment of PFOS exposure in a susceptible population during pregnancy. Environ. Health Perspect. 112, 1204−1207. (32) Loccisano, A. E., Campbell, J. L., Butenhoff, J. L., Andersen, M. E., and Clewell, H. J. (2012) Evaluation of placental and lactational pharmacokinetics of PFOA and PFOS in the pregnant, lactating, fetal and neonatal rat using a physiologically based pharmacokinetic model. Reprod. Toxicol. 33, 468−490. (33) Eriksen, K. T., Raaschou-Nielsen, O., Sørensen, M., Roursgaard, M., Loft, S., and Møller, P. (2010) Genotoxic potential of the perfluorinated chemicals PFOA, PFOS, PFBS, PFNA and PFHxA in human HepG2 cells. Mutat. Res., Genet. Toxicol. Environ. Mutagen. 700, 39−43. (34) Hardell, E., Kärrman, A., van Bavel, B., Bao, J., Carlberg, M., and Hardell, L. (2014) Case−control study on perfluorinated alkyl acids (PFAAs) and the risk of prostate cancer. Environ. Int. 63, 35−39. (35) Stackelberg, P. E., Furlong, E. T., Meyer, M. T., Zaugg, S. D., Henderson, A. K., and Reissman, D. B. (2004) Persistence of pharmaceutical compounds and other organic wastewater contaminants in a conventional drinking-water-treatment plant. Sci. Total Environ. 329, 99−113. (36) Wirnitzer, U., Rickenbacher, U., Katerkamp, A., and Schachtrupp, A. (2011) Systemic toxicity of di-2-ethylhexyl terephthalate (DEHT) in rodents following four weeks of intravenous exposure. Toxicol. Lett. 205, 8−14. (37) Fromme, H., Küchler, T., Otto, T., Pilz, K., Müller, J., and Wenzel, A. (2002) Occurrence of phthalates and bisphenol A and F in the environment. Water Res. 36, 1429−1438. (38) Guo, Y., Wang, L., and Kannan, K. (2014) Phthalates and parabens in personal care products from China: concentrations and human exposure. Arch. Environ. Contam. Toxicol. 66, 113−119. (39) López-Carrillo, L., Hernández-Ramírez, R. U., Calafat, A. M., Torres-Sánchez, L., Galván-Portillo, M., Needham, L. L., Ruiz-Ramos, R., and Cebrián, M. E. (2009) Exposure to phthalates and breast cancer risk in northern Mexico. Environ. Health Perspect. 118, 539. (40) Langer, S., Bekö, G., Weschler, C. J., Brive, L. M., Toftum, J., Callesen, M., and Clausen, G. (2014) Phthalate metabolites in urine samples from Danish children and correlations with phthalates in dust samples from their homes and daycare centers. Int. J. Hyg. Environ. Health 217, 78−87. (41) Philippat, C., Mortamais, M., Chevrier, C., Petit, C., Calafat, A. M., Ye, X., Silva, M. J., Brambilla, C., Pin, I., Charles, M.-A., et al. (2011) Exposure to phthalates and phenols during pregnancy and offspring size at birth. Environ. Health Perspect. 120, 464−70. (42) Wittassek, M., Koch, H. M., Angerer, J., and Brüning, T. (2011) Assessing exposure to phthalates−the human biomonitoring approach. Mol. Nutr. Food Res. 55, 7−31.

(43) Barr, L., Metaxas, G., Harbach, C., Savoy, L., and Darbre, P. (2012) Measurement of paraben concentrations in human breast tissue at serial locations across the breast from axilla to sternum. J. Appl. Toxicol. 32, 219−232. (44) Charles, A. K., and Darbre, P. D. (2013) Combinations of parabens at concentrations measured in human breast tissue can increase proliferation of MCF-7 human breast cancer cells. J. Appl. Toxicol. 33, 390−398. (45) Pugazhendhi, D., Pope, G., and Darbre, P. (2005) Oestrogenic activity of p-hydroxybenzoic acid (common metabolite of paraben esters) and methylparaben in human breast cancer cell lines. J. Appl. Toxicol. 25, 301−309. (46) Błędzka, D., Gromadzińska, J., and Wąsowicz, W. (2014) Parabens. From environmental studies to human health. Environ. Int. 67, 27−42. (47) Kirchhof, M. G., and de Gannes, G. C. (2013) The health controversies of parabens. Skin Ther. Lett. 18, 5−7. (48) Darbre, P., Aljarrah, A., Miller, W., Coldham, N., Sauer, M., and Pope, G. (2004) Concentrations of parabens in human breast tumours. J. Appl. Toxicol. 24, 5−13. (49) Bolton, E. E., Wang, Y., Thiessen, P. A., and Bryant, S. H. (2008) PubChem: integrated platform of small molecules and biological activities. Annu. Rep. Comput. Chem. 4, 217−241. (50) Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N., and Bourne, P. E. (2006) The Protein Data Bank, 1999−, in International Tables for Crystallography Vol. F: Crystallography of Biological Macromolecules, pp 675−684, Springer. (51) Pence, H. E., and Williams, A. (2010) ChemSpider: An Online Chemical Information Resource. J. Chem. Educ. 87, 1123−1124. (52) Lu, T., and Manzetti, S. (2014) Wavefunction and reactivity study of benzo [a] pyrene diol epoxide and its enantiomeric forms. Struct. Chem. 25, 1521−1533. (53) Thakker, D., Yagi, H., Akagi, H., Koreeda, M., Lu, A., Levin, W., Wood, A., Conney, A., and Jerina, D. (1977) Metabolism of benzo [a] pyrene VI. Stereoselective metabolism of benzo [a] pyrene and benzo [a] pyrene 7, 8-dihydrodiol to diol epoxides. Chem.-Biol. Interact. 16, 281−300. (54) Jerina, D., Yagi, H., Lehr, R., Thakker, D., Schaefer-Ridder, M., Karle, J., Levin, W., Wood, A., Chang, R., and Conney, A. (2012) The bay-region theory of carcinogenesis by polycyclic aromatic hydrocarbons. Polycycl. Hydrocarb. Cancer 1, 173−188. (55) Ling, H., Sayer, J. M., Plosky, B. S., Yagi, H., Boudsocq, F., Woodgate, R., Jerina, D. M., and Yang, W. (2004) Crystal structure of a benzo [a] pyrene diol epoxide adduct in a ternary complex with a DNA polymerase. Proc. Natl. Acad. Sci. U. S. A. 101, 2265−2269. (56) O’Boyle, N. M., Banck, M., James, C. A., Morley, C., Vandermeersch, T., and Hutchison, G. R. (2011) Open Babel: An open chemical toolbox. J. Cheminf. 3, 33. (57) Sousa da Silva, A. W., and Vranken, W. F. (2012) ACPYPEAntechamber python parser interface. BMC Res. Notes 5, 367. (58) Lindorff-Larsen, K., Piana, S., Palmo, K., Maragakis, P., Klepeis, J. L., Dror, R. O., and Shaw, D. E. (2010) Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins: Struct., Funct., Genet. 78, 1950−1958. (59) Levine, A. J., Finlay, C. A., and Hinds, P. W. (2004) P53 is a tumor suppressor gene. Cell 116, S67−S70. (60) Chen, Y., Zhang, X., Dantas Machado, A. C., Ding, Y., Chen, Z., Qin, P. Z., Rohs, R., and Chen, L. (2013) Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion. Nucleic Acids Res. 41, 8368−8376. (61) Abraham, M. J., Murtola, T., Schulz, R., Páll, S., Smith, J. C., Hess, B., and Lindahl, E. (2015) GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers, in SoftwareX, Elsevier. (62) Erler, J., Zhang, R., Petridis, L., Cheng, X., Smith, J. C., and Langowski, J. (2014) The role of histone tails in the nucleosome: a computational study. Biophys. J. 107, 2911−2922. 35


Article

Chemical Research in Toxicology (63) Mizan, T. I., Savage, P. E., and Ziff, R. M. (1994) Molecular dynamics of supercritical water using a flexible SPC model. J. Phys. Chem. 98, 13067−13076. (64) Bussi, G., Donadio, D., and Parrinello, M. (2007) Canonical sampling through velocity rescaling. J. Chem. Phys. 126, 014101. (65) Salomon-Ferrer, R., Case, D. A., and Walker, R. C. (2013) An overview of the Amber biomolecular simulation package. Wiley Interdiscip. Rev. Comput. Mol. Sci. 3, 198−210. (66) Fischer, N., Poleto, M. D., Steuer, J., and van der Spoel, D. (2017) Influence of Na+ and Mg2+ ions on RNA structure studied using molecular dynamics simulations. Nucleic Acids Res., DOI: 10.1093/nar/gkn000, in press. (67) Darden, T., York, D., and Pedersen, L. (1993) Particle mesh Ewald: An N· log (N) method for Ewald sums in large systems. J. Chem. Phys. 98, 10089−10092. (68) Hess, B., Bekker, H., Berendsen, H. J., and Fraaije, J. G. (1997) LINCS: a linear constraint solver for molecular simulations. J. Comput. Chem. 18, 1463−1472. (69) Te Velde, G., Bickelhaupt, F. M., Baerends, E. J., Fonseca Guerra, C., van Gisbergen, S. J., Snijders, J. G., and Ziegler, T. (2001) Chemistry with ADF. J. Comput. Chem. 22, 931−967. (70) Allouche, A. (2011) Gabedita graphical user interface for computational chemistry softwares. J. Comput. Chem. 32, 174−182. (71) Becke, A. D. (1992) Density-functional thermochemistry. II. The effect of the Perdew−Wang generalized-gradient correlation correction. J. Chem. Phys. 97, 9173−9177. (72) Hehre, W., Radom, L., Schleyer, P., and Pople, J. (1986) Ab Initio Molecular Orbital Theory, John Wiley. (73) Neese, F. (2012) The ORCA program system. Wiley Interdiscip. Rev. Comput. Mol. Sci. 2, 73−78. (74) Weigend, F., and Ahlrichs, R. (2005) Balanced basis sets of split valence, triple zeta valence and quadruple zeta valence quality for H to Rn: Design and assessment of accuracy. Phys. Chem. Chem. Phys. 7, 3297−3305. (75) Moellmann, J., and Grimme, S. (2014) DFT-D3 study of some molecular crystals. J. Phys. Chem. C 118, 7615−7621. (76) Kendall, R. A., and Früchtl, H. A. (1997) The impact of the resolution of the identity approximate integral method on modern ab initio algorithm development. Theor. Chem. Acc. 97, 158−163. (77) Schaftenaar, G., and Noordik, J. H. (2000) Molden: a pre-and post-processing program for molecular and electronic structures*. J. Comput.-Aided Mol. Des. 14, 123−134. (78) Zhurko, G., and Zhurko, D. (2013) Chemcraft, Version 1.7 (build 365). (79) Lu, T., and Chen, F. (2012) Multiwfn: A multifunctional wavefunction analyzer. J. Comput. Chem. 33, 580−592. (80) Manzetti, S., and Lu, T. (2013) The geometry and electronic structure of Aristolochic acid: possible implications for a frozen resonance. J. Phys. Org. Chem. 26, 473−483. (81) Behzadi, H., Manzetti, S., Dargahi, M., and Roonasi, P. (2017) Application of calculated NMR parameters, aromaticity indices and wavefunction properties for evaluation of corrosion inhibition efficiency of pyrazine inhibitors. J. Mol. Struct. 1151, 34. (82) Mulliken, R. S. (1955) Electronic population analysis on LCAO−MO molecular wave functions. I. J. Chem. Phys. 23, 1833− 1840. (83) Liu, G., Zhang, S., Yang, K., Zhu, L., and Lin, D. (2016) Toxicity of perfluorooctane sulfonate and perfluorooctanoic acid to Escherichia coli: Membrane disruption, oxidative stress, and DNA damage induced cell inactivation and/or death. Environ. Pollut. 214, 806−815. (84) Shi, X., Du, Y., Lam, P. K., Wu, R. S., and Zhou, B. (2008) Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS. Toxicol. Appl. Pharmacol. 230, 23−32. (85) Manzetti, S. (2012) Chemical and Electronic Properties of Polycyclic Aromatic Hydrocarbons: A Review, in Handbook of Polycyclic Aromatic Hydrocarbons: Chemistry, Occurrence, and Health Issues, 1st ed., Nova Sciences Publishers. (86) Butterworth, B. E., Bermudez, E., Smith-Oliver, T., Earle, L., Cattley, R., Martin, J., Popp, J. A., Strom, S., Jirtle, R., and

Michalopoulos, G. (1984) Lack of genotoxic activity of di (2ethylhexyl) phthalate (DEHP) in rat and human hepatocytes. Carcinogenesis 5, 1329−1335. (87) Erkekoglu, P., Rachidi, W., Yuzugullu, O. G., Giray, B., Favier, A., Ozturk, M., and Hincal, F. (2010) Evaluation of cytotoxicity and oxidative DNA damaging effects of di (2-ethylhexyl)-phthalate (DEHP) and mono (2-ethylhexyl)-phthalate (MEHP) on MA-10 Leydig cells and protection by selenium. Toxicol. Appl. Pharmacol. 248, 52−62. (88) von Däniken, A., Lutz, W. K., Jäckh, R., and Schlatter, C. (1984) Investigation of the potential for binding of di (2-ethylhexyl) phthalate (DEHP) and di (2-ethylhexyl) adipate (DEHA) to liver DNA in vivo. Toxicol. Appl. Pharmacol. 73, 373−387. (89) Lutz, W. K. (1986) Investigation of the potential for binding of di (2-ethylhexyl) phthalate (DEHP) to rat liver DNA in vivo. Environ. Health Perspect. 65, 267. (90) Park, C., Nah, W., Lee, J., Oh, Y., and Gye, M. (2012) Butyl paraben-induced changes in DNA methylation in rat epididymal spermatozoa. Andrologia 44, 187−193. (91) Terán, W., Krell, T., Ramos, J. L., and Gallegos, M.-T. (2006) Effector-repressor interactions, binding of a single effector molecule to the operator-bound TtgR homodimer mediates derepression. J. Biol. Chem. 281, 7102−7109. (92) Baytak, A. K., Duzmen, S., Teker, T., and Aslanoglu, M. (2017) Voltammetric determination of methylparaben and its DNA interaction using a novel platform based on carbon nanofibers and cobalt-nickel-palladium nanoparticles. Sens. Actuators, B 239, 330−337. (93) Volk, D. E., Thiviyanathan, V., Rice, J. S., Luxon, B. A., Shah, J. H., Yagi, H., Sayer, J. M., Yeh, H. J., Jerina, D. M., and Gorenstein, D. G. (2003) Solution Structure of a Cis-Opened (10 R)-N 6Deoxyadenosine Adduct of (9 S, 10 R)-9, 10-Epoxy-7, 8, 9, 10tetrahydrobenzo [a] pyrene in a DNA Duplex. Biochemistry 42, 1410− 1420. (94) Frank, E. G., Sayer, J. M., Kroth, H., Ohashi, E., Ohmori, H., Jerina, D. M., and Woodgate, R. (2002) Translesion replication of benzo [a] pyrene and benzo [c] phenanthrene diol epoxide adducts of deoxyadenosine and deoxyguanosine by human DNA polymerase ι. Nucleic Acids Res. 30, 5284−5292. (95) Shou, M., Harvey, R. G., and Penning, T. M. (1993) Reactivity of benzo [a] pyrene-7, 8-dione with DNA. Evidence for the formation of deoxyguanosine adducts. Carcinogenesis 14, 475−482. (96) Leadon, S. A., Stampfer, M. R., and Bartley, J. (1988) Production of oxidative DNA damage during the metabolic activation of benzo [a] pyrene in human mammary epithelial cells correlates with cell killing. Proc. Natl. Acad. Sci. U. S. A. 85, 4365−4368. (97) Manzetti, S. (2013) Polycyclic aromatic hydrocarbons in the environment: environmental fate and transformation. Polycyclic Aromat. Compd. 33, 311−330. (98) Rohs, R., Bloch, I., Sklenar, H., and Shakked, Z. (2005) Molecular flexibility in ab initio drug docking to DNA: binding-site and binding-mode transitions in all-atom Monte Carlo simulations. Nucleic Acids Res. 33, 7048−7057. (99) Holt, P. A., Chaires, J. B., and Trent, J. O. (2008) Molecular docking of intercalators and groove-binders to nucleic acids using Autodock and Surflex. J. Chem. Inf. Model. 48, 1602−1615. (100) Ricci, C. G., and Netz, P. A. (2009) Docking studies on DNAligand interactions: building and application of a protocol to identify the binding mode. J. Chem. Inf. Model. 49, 1925−1935. (101) Al-Otaibi, J. S., Teesdale Spittle, P., and El Gogary, T. M. (2017) Interaction of anthraquinone anti-cancer drugs with DNA: Experimental and computational quantum chemical study. J. Mol. Struct. 1127, 751−760. (102) Humphrey, W., Dalke, A., and Schulten, K. (1996) VMD: visual molecular dynamics. J. Mol. Graphics 14, 33−38.

36


Comparison with Benzo[a] - ACS Publications - American Chemical

Recommend Documents