Complete, Programmable Decoding of Oxidized 5-Methylcytosine

Apr 20, 2018 - Successful transfer to affinity enrichment in a human genome background indicates that this approach enables the fully selective detect...
1 downloads 4 Views 6MB Size
Download PDF
Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE

Complete, Programmable Decoding of Oxidized 5-Methylcytosine Nucleobases in DNA by Chemoselective Blockage of Universal TALE-Binders Mario Giess, Anna Witte, Julia Jasper, Oliver Koch, and Daniel Summerer J. Am. Chem. Soc., Just Accepted Manuscript • DOI: 10.1021/jacs.8b02909 • Publication Date (Web): 20 Apr 2018 Downloaded from http://pubs.acs.org on April 20, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society

Complete, Programmable Decoding of Oxidized 5-Methylcytosine Nucleobases in DNA by Chemoselective Blockage of Universal TALE-Binders Mario Gieß, Anna Witte, Julia Jasper, Oliver Koch and Daniel Summerer* Faculty of Chemistry and Chemical Biology, TU Dortmund University, Otto-Hahn-Str. 6, 44227 Dortmund (Germany)

Supporting Information Placeholder ABSTRACT: 5-methylcytosine (5mC) and its oxidized derivatives are regulatory elements of mammalian genomes involved in development and disease. These nucleobases do not selectively modulate Watson-Crick pairing, preventing their programmable targeting and analysis by traditional hybridization probes. Transcription-activator-like effectors (TALEs) can be engineered for use as programmable probes with epigenetic nucleobase selectivity. However, only partial selectivities for oxidized 5mC have been achieved so far, preventing unambiguous target binding. We here overcome this limitation by destroying and re-inducing nucleobase selectivity in TALEs via protein engineering and chemoselective nucleobase blocking. We engineer cavities in TALE repeats and identify a cavity that accommodates all eight human DNA nucleobases. We then introduce substituents with varying size, flexibility and branching degree at each oxidized 5mC. Depending on the nucleobase, substituents with distinct properties effectively block TALE-binding and induce full nucleobase selectivity in the universal repeat. Successful transfer to affinity enrichment in a human genome background indicates that this approach now enables the fully selective detection of each oxidized 5mC in complex DNA by programmable probes. The epigenetic nucleobase 5mC (Fig. 1a) is a key regulatory element of mammalian transcription with important roles in development and diseases.1 Ten-eleven translocation (TET) dioxygenases can oxidize 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC, Fig. 1a) which are intermediates of active demethylation.2-6 Moreover, oxidized 5mCs exhibit unique interaction profiles with important nuclear proteins,7-11 may influence nucleosome stability,12 and 5fC can form imine-crosslinks with proteins in vitro.13 Understanding the biological significance of these and other observations depends on methods for detecting 5hmC, 5fC, and 5caC at genomic positions of interest. However, 5mC and its oxidized derivatives are not revealed by programmable Watson-Crick hybridization. Instead, detection relies on their unique reactivities utilized e.g. for chemoselective transformations providing added selectivity in bisulfite sequencing, and for the installment of handles for affinity enrichment.14-18 In addition, non-programmable binders and enzymes with selectivity for oxidized 5mC nucleobas-

es are available,19-20 and single molecule sequencing approaches are being developed21-22 (strategies can also be applied in combination1, 23).

Figure 1. Oxidized 5mC nucleobases and DNA recognition by TALEs. a.) Structures of C, 5mC, 5hmC, 5fC, and 5caC. b.) Crystal structure of TALE with DNA (orange, pdb 4GJP24). Frame marks Fig. 1c. c.) Repeat loop with RVD HD binding to C. Hydrogen bonds in red. d.) Features of used TALE constructs. Sequence of one repeat above with RVD in grey box and residues engineered in this study underlined. Right: RVD selectivities.

Selective targeting of epigenetic nucleobases by programmable probes may enable valuable analytical formats in epigenetics that are currently only available for genetic studies relying on traditional hybridization probes. TALE proteins25 provide a promising scaffold for engineering such probes. TALEs recognize one strand of duplex DNA via the major groove26-27 that displays unique chemical information for both canonical and epigenetic nucleobases.28 TALEs consist of multiple repeats, each recognizing one nucleobase via a repeat variable di-residue (RVD) positioned in a loop (Fig. 1b, c).26-27 This recognition follows a simple code, with RVD amino acids NI, NN, NG and HD preferentially binding A, G/A, T, and C,

ACS Paragon Plus Environment

Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

respectively (Fig. 1d).29 TALE repeats with partial selectivity for 5mC and certain oxidized derivatives have been engineered.30-32 This provides a new class of receptors that enabled strand-specific nucleobase detection at single, user-defined genomic positions by affinity enrichment and thus overcomes the limited resolution of non-programmable receptors and tagging approaches.33 This However, achieving TALE-based targeting with full selectivity for each 5hmC, 5fC and 5caC in the context of all five human cytosine nucleobases is not possible, preventing the use of TALEs for unambiguous nucleobase calling.

Figure 2. Design of universal TALE binders. a.) Concept. Dark grey bar: target sequence; spheres: cytosine nucleobases (colorcode in Fig. 1a). Nucleobases bound by TALE repeat are saturated, non-bound nucleobases pale. Ellipses: blocked nucleobases. b.) Repeat designs with RVD in grey box. *: deletion; wt: wild type. c.) Modelled repeats in complex with 5caC in DNA. Repeat in blue, hydrogen bonds in red. d.) EMSA with TALEs and DNA containing a C opposite the repeat as indicated. e.) EMSA with TALEs and DNA containing indicated nucleobase opposite the single indicated repeat. f.) EMSA with TALEs and DNA containing single C, A, G or T opposite repeat SG*GG. g.) Luciferase transcription activation using TALE-VP64 constructs with indicated repeat opposite single C, A, G, or T in the target. -B: no TALE target site. Sc: Control with scrambled wt TALE.

We here report a detection strategy that overcomes this limitation by destroying and re-inducing nucleobase selectivity in TALEs via protein engineering and chemoselective nucleobase blocking (Fig. 2a). We extended our previous strategy to achieve new and relaxed TALE repeat selectivities in accessibility assays by deletion of up to four amino acids at positions

Page 2 of 5

12-15 with S or N at position 11 (Fig. 2b).31, 33 Mutant TALE genes were assembled34 using vector pGFP-ENTRY,33 enabling expression and purification of TALE mutants with Nterminal GFP domain, shortened, AvrBs3-type TALE Nterminal region (NTR) and a His6 tag after the C-terminal region (CTR) in E. coli (Fig. 1d and SI Fig. 1-2). We designed TALEs targeting a 26 nt sequence (TCAGCCGAAGGCTCCATGCTGCTCCC, human chr9 : 21,974,786 - 21,974,811) in the human tumor suppressor gene CDKN2A with the mutant repeat positioned opposite the C of the single CpG dinucleotide. Solubility and circular dichroism measurements did not give any indication that the looptruncations compromised the overall TALE fold (SI Fig. 3).2627 Models of TALE_SG*GG31 and _SG**G in complex with this target DNA exhibited formation of cavities with increasing size, capable of accommodating the sterically most demanding caC (Figure 2c and SI; employed modeling approach was not applicable to repeats with >2 deletions). Electromobility shift assays (EMSA) with oligonucleotide duplexes containing the TALE target sequence revealed comparable binding of TALE_wt and TALE_SG*GG, somewhat reduced binding for TALE_SG**G31, and strongly decreased binding for TALEs with >2 deletions (Fig. 2d; these findings were confirmed in a second sequence context, see SI Fig. 4). We next performed EMSA with TALE_wt and the stronger binding TALE_SG*GG using DNA with C, 5mC, 5hmC, 5fC, or 5caC opposite the variable repeat. In agreement with previous studies, TALE_wt exclusively bound to C, however, TALE_SG*GG bound to all five nucleobases with similar affinities (Fig. 2e and SI Fig. 5).31, 33 TALE repeats exhibiting universal binding also of canonical nucleobases would offer robust targeting of polymorphic targets, e.g. during epigenetic nucleobase analysis or in vivo (epi)genome engineering and transcription control. We thus studied the interaction of TALE_SG*GG with A, G, and T. EMSA (Fig. 2f) and transcription activation assays with a luciferase reporter in HEK293T cells using TALE-VP64 constructs (Fig. 2g) revealed similar binding to all four canonical nucleobases, establishing SG*GG as the first repeat design universally binding to all eight human DNA nucleobases. To re-induce selectivity for each oxidized 5mC nucleobase in repeat SG*GG, we next aimed to deposit blocking groups in the DNA major groove by modification of the unique 5substituents. The major groove of TALE-DNA complexes is partially solvent accessible26-27 and if suitably oriented, even very bulky substituents can be accommodated without interference.35 Rather then mere size, critical aspects of an effective blocking group are thus its orientation and conformational flexibility, both being dictated by the 5-substituent itself. The 5-hydroxymethyl group of 5hmC is found in two different orientiations in crystal structures, indicating rotational flexibility.28 We modified the 5hmC-containing dsDNA oligonucleotide used above by uridine-diphosphate (UDP)-glucosedependent glucosylation with T4-β-glucosyl-transferase (Fig. 3a, b).20 ESI-MS indicated a high yield of 5-glucosyl-hmC (1) formation (see SI). To evaluate potential nucleobase-selective blocking effects of this reaction, we performed EMSA studies with TALE_SG*GG and DNA bearing one of the five cytosine nucleobases reacted or not reacted as before. We observed a strong reduction of DNA binding only for reacted 5hmCDNA, indicating that the large hydrophilic glucose moiety in 1 cannot be accommodated, despite its expected conformational flexibility (Fig. 3c).

2

ACS Paragon Plus Environment

Page 3 of 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society

Figure 3. Chemoselective blockage of universal TALE binders. a.) Glucosylation of 5hmC in dsDNA to 1 by T4-βglucosyltransferase (BGT). b.) Structure of glucosyl substituent. c.) Interaction of TALE_SG*GG with DNA containing nucleobase as indicated and reacted as in Fig. 1a. EMSA data using each 150 nM TALE and reacted DNAs were subtracted from data of unreacted DNA and plotted as % difference (Δ). d.) Conversion of 5fC in DNA to oximes 3a - d. e.) Structures of substituents of 2a d. f.) EMSA data for TALE_SG*GG and DNA containing 5fC reacted with 2a - d. g.) Interaction data as shown in Fig. 3d for DNA reacted with 2d. h - k.) Analogous data as Fig. 3d - g for DNA containing 5caC. l.) EMSA titrations and corresponding KD obtained from dose response fits (lines).

We next aimed to selectively convert 5fC to oximes using hydroxylamines varying in size, flexibility, branching degree and polarity (Fig. 3d, e). The formyl group of 5fC hydrogen bonds to the 4-amino group in crystal structures28, leading to a fixed orientation of oxime substituents. Among a variety of catalysts and reaction conditions, p-phenylenediamine catalyst16 consistently afforded high yields under non-denaturing

conditions, a critical requirement for TALE applications in genomic DNA (gDNA, see SI). In contrast to 5hmC, most substituents did not show an effect in EMSA, including tetrahydropyran (THP) 3b being structurally related to glucose (Fig. 3g). However, t-butyl oxime 3d strongly inhibited TALE binding and ethyl oxime 3a did not, indicating that the quaternary sp3-center of 3d was critical. Indeed, models suggested that even the large and rigid benzyl group of 3c can evade clash by orientation to the groove opening, whereas 3d cannot (SI Fig. 7). EMSA with DNAs reacted and non-reacted with 2d revealed strong and selective blocking of TALE-binding only for 5fC (Fig. 3g). We finally employed amines for amidederivatization of 5caC using 7-azabenzotriazol-1yloxy)tripyrrolidino-phosphonium hexafluorophosphate (PyAOP) as coupling reagent under non-denaturing conditions (Fig. 3h-i). As in 5fC, the carbonyl oxygen of 5caC hydrogen bonds to the nucleobase 4-amino group28, presumably leading to similarly fixed, but differently oriented substituents in amides. Amines 4e - g afforded high yields, whereas t-butylamine 4h reacted poorly (see SI). Interestingly, EMSA revealed different structure-activity relationships compared to 5fC, with only benzylamine 4g leading to effective blocking (Fig. 3j). Models suggested that the benzyl group of 5g cannot evade clash with the repeat backbone (SI Fig. 8) as opposed to the similarly sized, but more flexible sp3-linked THP of 5f. Again, EMSA with DNAs reacted with 4g revealed blocking of TALE_SG*GG only for 5caC DNA (Fig. 3k). Overall, EMSA KD were similar for the unmodified bases, whereas 1, 3d and 5g almost fully blocked TALE-binding (Fig. 3l and SI). We next aimed to achieve fully selective detection of 5hmC, 5fC and 5caC in a human genome background. We previously reported an affinity enrichment assay enabling detection of epigenetic nucleobases at single, user-defined genomic positions in a strand-specific manner.33 Bead-immobilized TALEs are incubated with fragmented gDNA, and the TALE-bound DNA is eluted and quantified by qPCR after washing (Fig. 4a). To ensure unambiguous modification of target sequences, we generated 421 bp PCR products bearing a single 5hmC, 5fC or 5caC via modified primers as spike-ins. To generate a non-modified genome background, we subjected gDNA of a human individual (ENCODE sample NA18507) to wholegenome amplification, fragmented it to ~300-700 bp by sonication and digested it with restriction enzymes cutting within the spike-ins (see SI). We added each spike-in to purified, individual gDNA samples at a concentration of a single genome copy and subjected the samples to each of the reaction conditions above (Fig. 3a, e, j). We purified the DNAs and employed them in affinity enrichments with TALE_SG*GG (Fig. 4a). Assays with non-reacted DNA or with reacted DNA bearing off-target nucleobases showed effective, uniform enrichment, whereas assays with reacted DNA containing ontarget nucleobases, showed only background enrichment (Fig. 4b). This demonstrates fully selective detection of each nucleobase with high confidence in a genomic assay. Ascorbic acid is an inducer of TET dioxygenases36 and has been shown to increase 5hmC/5mC ratios at the CDKN2A promoter to rescue UV-induced apoptosis in skin cancer cells.37 Application of our approach to pure or heterogenous 5mC/5hmC at the CDKN2A target site enabled unambiguous analysis of 5hmC levels (Figure 4c). In conclusion, chemoselective nucleobase modifications can be utilized to create new selectivities in TALE DNA interactions, overcoming the limited selectivity of previous TALE

3

ACS Paragon Plus Environment

Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

repeats. We identified repeat SG*GG to uniformly bind all eight human DNA nucleobases, having implications for the robust targeting of polymorphic/epigenetically variable sites.

Figure 4. Complete decoding of oxidized 5mC nucleobases. a.) Affinity enrichment workflow. b.) qPCR quantification of affinity enrichments with TALE_SG*GG and DNAs bearing single oxidized 5mC reacted as indicated. Copies of control enrichments without TALE were subtracted from enrichments with TALE. c.) as Fig. 4b with 5mC, 5hmC or 1:1 mix. ****: p ≤ 0.00001; n ≥ 5.

Combining this repeat with chemoselective modifications reinduced selectivity and provided a set of interactions for the complete decoding of each oxidized 5mC. Successful transfer to affinity enrichment in a human genome background indicates that this approach allows the detection of oxidized 5mC in complex DNA by programmable probes. Careful TALE design ensuring target uniqueness as well as comparative tagging/enrichments for each oxidized 5mC will help to fully develop the potential of this assay for complex biological samples. Given the nucleotide resolution and strand selectivity offered by TALEs,33 the approach should provide added analytical information in enrichment assays compared to the use of nonprogrammable receptors or tagging approaches alone. The here completed set of selectivities will extend the application scope of TALEs as versatile probes for the programmable targeting and analysis of epigenetic nucleobases.

ASSOCIATED CONTENT Supporting Info. Available free of charge at http://pubs.acs.org.”

AUTHOR INFORMATION *[email protected]

Funding Sources No competing financial interests. This work was supported by the DFG (Su 726/5-1 in SPP1784).

A CKNOWLEDGMENT We thank A. J. Bogdanove and D. F. Voytas for TALE plasmids obtained via Addgene. Structures in Fig. 1-2 have been prepared with PyMOL, Version 1.7.4 Schrödinger, LLC.

REFERENCES 1. Wu, X.; Zhang, Y., Nat. Rev. Genet. 2017, 18(9), 78163-73 2. Tahiliani, M.; Koh, K. P.; Shen, Y.; Pastor, W. A.; Bandukwala, H.; Brudno, Y.; Agarwal, S.; Iyer, L. M.; Liu, D. R.; Aravind, L.; Rao, A., Science 2009, 324, 930-5. 3. Kriaucionis, S.; Heintz, N., Science 2009, 324, 929-30.

Page 4 of 5

4. Ito, S.; Shen, L.; Dai, Q.; Wu, S. C.; Collins, L. B.; Swenberg, J. A.; He, C.; Zhang, Y., Science 2011, 333, 1300-3. 5. He, Y. F.; Li, B. Z.; Li, Z.; Liu, P.; Wang, Y.; Tang, Q.; Ding, J.; Jia, Y.; Chen, Z.; Li, L.; Sun, Y.; Li, X.; Dai, Q.; Song, C. X.; Zhang, K.; He, C.; Xu, G. L., Science 2011, 333, 1303-7. 6. Pfaffeneder, T.; Hackner, B.; Truss, M.; Munzel, M.; Muller, M.; Deiml, C. A.; Hagemeier, C.; Carell, T., Angew. Chem. Int. Ed. Engl. 2011, 50, 70087012. 7. Spruijt, C. G.; Gnerlich, F.; Smits, A. H.; Pfaffeneder, T.; Jansen, P. W.; Bauer, C.; Munzel, M.; Wagner, M.; Muller, M.; Khan, F.; Eberl, H. C.; Mensinga, A.; Brinkman, A. B.; Lephikov, K.; Muller, U.; Walter, J.; Boelens, R.; van Ingen, H.; Leonhardt, H.; Carell, T.; Vermeulen, M., Cell 2013, 152, 1146-59. 8. Iurlaro, M.; Ficz, G.; Oxley, D.; Raiber, E. A.; Bachman, M.; Booth, M. J.; Andrews, S.; Balasubramanian, S.; Reik, W., Genome Biol. 2013, 14, R119. 9. Du, Q.; Luu, P. L.; Stirzaker, C.; Clark, S. J., Epigen. 2015, 7, 1051-73. 10. Hashimoto, H.; Olanrewaju, Y. O.; Zheng, Y.; Wilson, G. G.; Zhang, X.; Cheng, X. D., Gen. Dev. 2014, 28, 2304-2313. 11. Kellinger, M. W.; Song, C. X.; Chong, J.; Lu, X. Y.; He, C.; Wang, D., Nat. Struct. Mol. Biol. 2012, 19, 831-3. 12. Ngo, T. T.; Yoo, J.; Dai, Q.; Zhang, Q.; He, C.; Aksimentiev, A.; Ha, T., Nat. Commun. 2016, 7, 10813. 13. Li, F.; Zhang, Y.; Bai, J.; Greenberg, M. M.; Xi, Z.; Zhou, C., J. Am. Chem. Soc. 2017, 139(31), 10617-20. 14. Pastor, W. A.; Pape, U. J.; Huang, Y.; Henderson, H. R.; Lister, R.; Ko, M.; McLoughlin, E. M.; Brudno, Y.; Mahapatra, S.; Kapranov, P.; Tahiliani, M.; Daley, G. Q.; Liu, X. S.; Ecker, J. R.; Milos, P. M.; Agarwal, S.; Rao, A., Nature 2011, 473, 394-7. 15. Song, C. X.; Szulwach, K. E.; Fu, Y.; Dai, Q.; Yi, C.; Li, X.; Li, Y.; Chen, C. H.; Zhang, W.; Jian, X.; Wang, J.; Zhang, L.; Looney, T. J.; Zhang, B.; Godley, L. A.; Hicks, L. M.; Lahn, B. T.; Jin, P.; He, C., Nat. Biotechnol. 2011, 29, 68-72. 16. Su, M.; Kirchner, A.; Stazzoni, S.; Muller, M.; Wagner, M.; Schroder, A.; Carell, T., Angew. Chem. Int. Ed. Engl. 2016, 55, 11797-800. 17. Booth, M. J.; Branco, M. R.; Ficz, G.; Oxley, D.; Krueger, F.; Reik, W.; Balasubramanian, S., Science 2012, 336, 934-7. 18. Yu, M.; Hon, G. C.; Szulwach, K. E.; Song, C. X.; Zhang, L.; Kim, A.; Li, X.; Dai, Q.; Shen, Y.; Park, B.; Min, J. H.; Jin, P.; Ren, B.; He, C., Cell 2012, 149, 1368-80. 19. Ficz, G.; Branco, M. R.; Seisenberger, S.; Santos, F.; Krueger, F.; Hore, T. A.; Marques, C. J.; Andrews, S.; Reik, W., Nature 2011, 473, 398-402. 20. Josse, J.; Kornberg, A., J. Biol. Chem. 1962, 237, 1968-76. 21. Wescoe, Z. L.; Schreiber, J.; Akeson, M., J. Am. Chem. Soc. 2014, 136(47), 16582-7. 22. Flusberg, B. A.; Webster, D. R.; Lee, J. H.; Travers, K. J.; Olivares, E. C.; Clark, T. A.; Korlach, J.; Turner, S. W., Nat. Methods 2010, 7, 461-5. 23. Booth, M. J.; Raiber, E. A.; Balasubramanian, S., Chem. Rev. 2015, 115, 2240-54. 24. Deng, D.; Yin, P.; Yan, C.; Pan, X.; Gong, X.; Qi, S.; Xie, T.; Mahfouz, M.; Zhu, J. K.; Yan, N.; Shi, Y., Cell Res. 2012, 22, 1502-4. 25. Boch, J.; Bonas, U., Annu. Rev. Phytopath. 2010, 48, 419-36. 26. Deng, D.; Yan, C.; Pan, X.; Mahfouz, M.; Wang, J.; Zhu, J. K.; Shi, Y.; Yan, N., Science 2012, 335, 720-3. 27. Mak, A. N. S.; Bradley, P.; Cernadas, R. A.; Bogdanove, A. J.; Stoddard, B. L., Science 2012, 335, 716-719. 28. Szulik, M. W.; Pallan, P. S.; Nocek, B.; Voehler, M.; Banerjee, S.; Brooks, S.; Joachimiak, A.; Egli, M.; Eichman, B. F.; Stone, M. P., Biochemistry 2015. 29. Boch, J.; Scholze, H.; Schornack, S.; Landgraf, A.; Hahn, S.; Kay, S.; Lahaye, T.; Nickstadt, A.; Bonas, U., Science 2009, 326, 1509-12. 30. Kubik, G.; Batke, S.; Summerer, D., J. Am. Chem. Soc. 2015, 137, 2-5. 31. Maurer, S.; Giess, M.; Koch, O.; Summerer, D., ACS Chem. Biol. 2016, 11, 3294-3299. 32. Zhang, Y.; Liu, L.; Guo, S.; Song, J.; Zhu, C.; Yue, Z.; Wei, W.; Yi, C., Nat. Commun. 2017, 8, 901. 33. Rathi, P.; Maurer, S.; Kubik, G.; Summerer, D., J. Am. Chem. Soc. 2016, 138, 9910-8. 34. Cermak, T.; Doyle, E. L.; Christian, M.; Wang, L.; Zhang, Y.; Schmidt, C.; Baller, J. A.; Somia, N. V.; Bogdanove, A. J.; Voytas, D. F., Nucleic Acids Res. 2011, 39. 35. Flade, S.; Jasper, J.; Giess, M.; Juhasz, M.; Dankers, A.; Kubik, G.; Koch, O.; Weinhold, E.; Summerer, D., ACS Chem. Biol. 2017, 12, 1719-1725. 36. Blaschke, K.; Ebata, K. T.; Karimi, M. M.; Zepeda-Martinez, J. A.; Goyal, P.; Mahapatra, S.; Tam, A.; Laird, D. J.; Hirst, M.; Rao, A.; Lorincz, M. C.; Ramalho-Santos, M., Nature 2013, 500, 222-6. 37. Lin, J. R.; Qin, H. H.; Wu, W. Y.; He, S. J.; Xu, J. H., Cancer Biother. Radiopharm. 2014, 29, 257-64.

4

ACS Paragon Plus Environment

Page 5 of 5

Journal of the American Chemical Society

Table of Contents Artwork 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

5

ACS Paragon Plus Environment