Controlling the Catalytic Functions of ... - American Chemical Society

Article pubs.acs.org/JACS

Controlling the Catalytic Functions of DNAzymes within Constitutional Dynamic Networks of DNA Nanostructures Shan Wang,†,§ Liang Yue,†,§ Zohar Shpilt,† Alessandro Cecconello,† Jason S. Kahn,† Jean-Marie Lehn,‡ and Itamar Willner*,† †

Institute of Chemistry, The Center for Nanoscience and Nanotechnology, The Hebrew University of Jerusalem, Jerusalem 91904, Israel ‡ Institut de Science et d’Ingénierie Supramoléculaires (ISIS), University of Strasbourg, 8 Rue Gaspard Monge, Strasbourg 67000, France S Supporting Information *

ABSTRACT: Mimicking complex cellular dynamic chemical networks being up-regulated or down-regulated by external triggers is one of the challenges in systems chemistry. Constitutional dynamic networks (CDNs), composed of exchangeable components that respond to environmental triggers by self-adaption, provide general means to mimic biosystems. We use the structural and functional information encoded in nucleic acid nanostructures to construct effector (input)-triggered constitutional dynamic networks that reveal adaptable catalytic properties. Specifically, CDNs composed of four exchangeable constituents, AA′, BA′, AB′, and BB′, are constructed. In the presence of an effector (input) that controls the stability of one of the constituents, the input-guided up-regulation or down-regulation of the CDN’s constituents proceeds. As effectors we apply the fuel-strand stabilization of one of the CDN constituents by the formation of the T-A·T triplex structure, or by the K+-ion-induced stabilization of one of the CDN constituents, via the formation of a K+-ion-stabilized G-quadruplex. Energetic stabilization of one of the CDN constituents leads to a new dynamically adapted network composed of up-regulated and down-regulated constituents. By applying counter triggers to the effector units, e.g., an antifuel strand or 18-crown-6-ether, reconfiguration to the original CDNs is demonstrated. The performance of the CDNs is followed by the catalytic activities of the constituents and by complementary quantitative gel electrophoresis experiments. The orthogonal triggered and switchable operation of the CDNs is highlighted.

■

INTRODUCTION

that presents an extended layer of complexities/functionalities into chemical systems. In these self-assemblies, the dynamic interactions among the constituents lead to a self-organization of selected structures, that originates from the ability of the systems to adapt a physically or chemically guided architecture. Ingenious systems that apply the CDC concept have been developed,4 such as the metal-ion-dictated formation of circular metal-complex helicates5 or self-organization of ligand-binding receptors.6 Different applications of CDC were suggested, such as the screening of drugs,7 programmed synthesis,8 and the development of dynamic materials.9 A further increase in the

Chemical transformations in cellular environments emerge often from complex dynamic chemical networks being upregulated or down-regulated by environmental triggers.1 Not surprisingly, substantial research efforts have been directed to further develop the area of systems chemistry, aiming to enhance the complexity and emerging functionalities of chemical systems by designing assemblies mimicking fundamental features of biomaterials and biosystems. Beyond supramolecular chemistry, that has established the grounds of self-assembly, catalysis, and stimuli-responsive switching features of noncovalently linked molecular structures, 2 substantial recent research efforts are directed to the development of the area of constitutional dynamic chemistry (CDC)3 © 2017 American Chemical Society

Received: May 3, 2017 Published: June 19, 2017 9662

DOI: 10.1021/jacs.7b04531 J. Am. Chem. Soc. 2017, 139, 9662−9671

Article

Journal of the American Chemical Society

complementary base-pairing of nucleic acids (number and nature) controls the stabilities of the duplexes14 and dictates the strand-displacement process.15 Structural information encoded in DNA includes the formation of metal-ion-stabilized duplexes (e.g., T-Hg2+-T or C-Ag+-C),16 the pH-induced formation of triplexes (e.g., C-G·C+ or T-A·T triplexes),17 and the stabilization of duplexes by photoisomerizable units (e.g., trans-azobenzene).18 Functional information encoded in nucleic acids includes selective recognition properties of molecular or macromolecular ligands (by aptamers)19 or catalytic functions of sequence-specific nucleic acids, e.g., DNAzymes composed of metal-ion-dependent catalytic nucleic acids20 or the hemin/Gquadruplexes horseradish peroxidase mimicking DNAzymes.21 These unique properties of DNA have been used to develop the area of DNA-based nanotechnology22 and to use nucleic acids for constructing new materials.23 The information encoded in DNA nanostructures was extensively used to assemble 2D and 3D nanostructures24 to develop stimuliresponsive DNA-based machines (e.g., tweezers, walkers) and reversible switches,25 to design new catalysts (nucleoapzymes),26 to assemble sensors,27 and to apply nucleic acids as functional materials for logic gate and computing circuit operations.28 Also, the information encoded in nucleic acids was extensively used to develop functional materials, such as stimuli-responsive hydrogels,29 shape-memory hydrogels,30 and signal-triggered nucleic acid-modified micro/nanoscale nucleic acid-gated carriers, such as SiO2 nanoparticles,31 metal−organic frameworks (MOFs),32 or microcapsules33 for the controlled release of drugs. These unique features of nucleic acids provide a rich “toolbox” for their application, such as functional components of CDNs: (i) The encoded information in the base sequence allows the design of dynamically equilibrated self-organized systems. (ii) The nucleic acid-based CDN can respond and adapt itself through component exchange driven by auxiliary triggers. (iii) It is possible to encode functional information into the networks, reflected by catalytic or mechanical functions. Such functions may provide readout signals for the operating networks. Despite the extensive efforts to design and kinetically characterize complex nucleic acid computing circuits, the use of nucleic acids as the key component to construct CDNs is unexplored. In fact, the possible complexities and significance of nucleic acid-based CDNs were theoretically addressed.34 In the present study, we introduce two different methods to operate DNA-based CDNs. We apply the strand-displacement process15 coupled with triplex stabilization35 or K+-ion-stabilized G-quadruplex/crown ether36 as inputs, acting as effector stimuli, which control the networks. Different features, such as orthogonal triggering and switchable reversible operations, are discussed. We demonstrate the up-regulation and down-regulation of the adaptive catalytic functions of the CDN systems. We further use the catalytic pattern of the CDNs to quantitatively elucidate the changes of the stimuli-controlled concentrations of the dynamic constituents in the different networks.

complexity of constitutional dynamic chemical systems involves the design of constitutional dynamic networks (CDNs).10 In these systems, a set of dynamical interconvertible molecular or macromolecular constituents is generated. Subjecting the network to an external physical or chemical effector triggers the network response by altering the composition, and eventually, the functions of the network, by controlling the content of its constituents (up-regulation or down-regulation). The constitutional dynamic network concept is exemplified in Figure 1, where a mixture of four supramolecular structures,

Figure 1. Trigger-guided reversible switching of dynamic constitutional networks consisting of four exchangeable nucleic acid constituents.

AA′, AB′, BA′, and BB′, exists in equilibrium. While all peripheral constituents are interconnected and share components (antagonists), the constituents at opposite vertices are not directly connected, do not share components, and act as agonists. Subjecting the equilibrated mixture to trigger T1 stabilizes constituent AA′, resulting in its enrichment by the dissociation of BA′ and AB′ and the concomitant increase in the content of the agonistic constituent BB′. Treatment of the network with the counter trigger T1′ destabilizes the constituent AA′, thereby regenerating (adapting) the original network. Similarly, subjecting the initially equilibrated network to the orthogonal trigger T2, which stabilizes BA′, and thus its up-regulation, results in the down-regulation of the content of AA′ and BB′ and the concomitant increase of the content of the agonist constituent AB′. The original equilibrated dynamic mixture is, then, regenerated by applying the counter trigger T2′, which destabilizes BA′. Note that the CDN exhibits, besides self-organization and adaptive features, switchable effector-induced dynamically triggered programmability. In fact, substantial progress has been made in designing molecular or macromolecular CDNs.11 For example, the CDN of equilibrated hydrazones and acrylhydrazones was controlled by orthogonal triggers, i.e., metal ions or light,12 and the formation of grids by polymerization, using equilibrated hydrazone/hydrazine constituents was programmed by the orthogonal Lewis acids or metal ions as triggers.13 The further development of CDNs suffers, however, from fundamental limitations: (i) The diversity of chemical constituents is limited, and the predesign of the programmability is difficult. (ii) The number of orthogonal triggers that reversibly control the network is limited. (iii) The sequential emerging functionalities of the programmable networks are scarce and missing in many of the systems. The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. The

■

RESULTS AND DISCUSSION Supramolecular DNA assemblies, formed by the interaction of an auxiliary triplex-forming oligonucleotide strand with a duplex DNA through Hoogsteen-type interactions, have attracted substantial research interest in the past four decades,37 and the biological implications of these structures were extensively discussed.38 9663


Article


Figure 2. Switchable control of the constituents of DNA-based CDNs by the effector-induced formation or dissociation of T-A·T triplexes, and using C′ as effector. Inset: Schematic readout of the catalytic constituents by the Mg2+-ion-dependent DNAzyme units. “F” and “G” indicate the structures of the constituents in the CDN states before and after subjecting the system to the effector C′ and counter effector C, respectively.

The first CDN exhibiting stimuli-triggered reversible adaptive catalytic functions of dynamically equilibrated DNA nanostructures involves the T-A·T triplex as a triggering motif for controlling the functions of the system. Figure 2 outlines the principles to control the catalytic functions of the CDN of four equilibrated DNA nanostructures, using a promoter nucleic acid as controller and the T-A·T triplex motif as regulator of the CDN. The system is composed of the four nanostructures AA′, AB′, BA′, and BB′ (A = 1; A′ = 2; B = 3; and B′ = 4). The structures consist of the subunits that form the duplexstabilized supramolecular structures of the Mg2+-ion-dependent DNAzymes. The structures AA′ and AB′ are further hybridized with the auxiliary strand C (5), and the structures BA′ and BB′ are functionalized with the auxiliary strand D (6). Note that the hybridization of the strands C and D to the different structures has no effect on the stability of the respective duplex-stabilized DNAzyme loops. Also, note that the sequences of the DNAzyme “arms” in the structures AA′, AB′, BA′, and BB′ differ and allow the cleavage of four different fluorophore/ quencher nucleobase-modified substrates, F1/Q-(7); F2/Q-(8); F3/Q-(9); and F4/Q-(10) (see schematic cleavage process in Figure 2 inset). The cleavage of the substrates 7−10 reflects the catalytic activities (content) of the different constituents in the constitutional dynamic mixture, and the switched-on fluorescence of the different fluorophore-modified fragmented substrates provides a quantitative signal for the content of the respective constituents in the mixture. Using appropriate calibration curves for the individual structures AA′, AB′, BA′, and BB′, the initial content of the different constituents in the CDN can be evaluated (vide inf ra). The strand A includes a sequence “x”, that is capable of forming a triplex T-A·T structure with the sequence “y”, associated with A′. Similarly, the strand B includes the sequence “z”, capable of forming the triplex structure T-A·T with the sequence “y”, associated with A′. The hybridization of strand C or D with the structures AA′ or BA′ prohibits, however, the formation of the respective triplex structures, leading to the control of the contents of the initial equilibrated structures of the mixture. The addition of strand C′ (11) to the system

displaces the blocker unit C (formation of the CC′ duplex). Uncaging of the sequence “x” in AA′ results in the reconfiguration of the structure AA′ into the T-A·T triplexstabilized nanostructure, AA′-T (left side of Figure 2). Note that the release of C from the structures AA′ and AB′ does not affect the stability of the AA′ and AB′ DNAzyme structures. The stabilization of the structure AA′ in the form AA′-T enriches, however, the equilibrated content of AA′-T that results in the equilibrium-driven dissociation of BA′ and AB′ and the concomitant enrichment of the agonist constituent BB′. Re-addition of the blocker unit C dissociates the structure AA′T while recovering the initial concentrations of the network constituents AA′, AB′, BA′, and BB′. Figure 3 presents the switchable operations of the catalytic functions of the constituents composing the CDN, upon subjecting the system to the effector strand C′. The panels I to IV present the timedependent fluorescence changes corresponding to the catalytic activities of AA′, AB′, BA′, and BB′, prior to subjecting the system to effector strand C′, curve (i), and after subjecting the network to the effector C′, curve (ii), and allowing the system to adapt to the new equilibrated network. Note that the initial network of constituents is allowed to equilibrate, after addition of C′, for a time interval of 12 h, and the adapted catalytic functions of the system were evaluated after equilibrium was established. The catalytic functions of the constituents before and after addition of C′ were probed following the timedependent fluorescence changes of the different constituents. Subsequently, using appropriate calibration curves of the individual constituents associated with the two networks, Figures S1 and S2, the time-dependent fluorescence changes were quantified into contents of the different constituents. Figure 3 demonstrates the expected changes in the catalytic functions of the respective DNAzymes upon subjecting the CDN to the effector C′. The catalytic activity of AA′ increases after treatment of the network with C′, panel I, while the catalytic activities of BA′ and AB′ decrease, panels II and III. Concomitant to the enhanced catalytic functions of AA′, the catalytic properties of the agonist constituent, BB′, are enhanced, panel IV. Figure 4 and Table 1 summarize the 9664


Article


functions of the network (e.g., curve (iii) in Figure 3, panels I, II, III, and IV). For the quantitative regeneration of the contents of the CDN constituents, see Figure 4 and Table 1. Similarly, the orthogonal control of the CDN was achieved by subjecting the system to the effector strand D′, Figure 5A. Under these conditions, the formation of the DD′ duplex stimulates the stabilization of the triplex structure BA′-T. As a result, the constituents AA′ and BB′ decrease in their contents, and while the content of BA′ increases, the concomitant increase of the agonist component, AB′, proceeds, as well. Figure S3 depicts the results demonstrating the control over the equilibrated dynamic content of the constituents upon treatment of the initial network with the effector strand D′. As predicted, the catalytic activities of the constituents BA′ and AB′ increase, while the catalytic activities of the constituents AA′ and BB′ decrease. Using the appropriate calibrations, the concentrations of the different constituents of the network, prior to and after treatment with D′, were evaluated, Figure 5B and Table 2. Similarly, by the addition of the counter strand D, the triplex structure BA′-T was separated, and the original BA′ was regenerated. As a result, the original concentrations of the constituents AA′, AB′, BA′, and BB′ in the CDN were recovered, Figure 5B and Table 2. To further support the dynamic control of the contents of the network constituents, upon subjecting the system to the effectors C′ or D′, we performed quantitative native gel electrophoresis experiments, Figure 6. In these experiments, the mixtures of the different networks, before and after subjecting to the respective effectors C′ and D′, were separated while being compared to the individual intact constituents. The respective separated nucleic acid structures were stained with SYBR Gold, and the intensities of the different bands corresponding to the constituents, present in the different networks, were quantitatively analyzed by the software ImageJ, which compares the intensities of the separated bands to the intensities presented by known concentrations of the individual reference constituents. Note, however, that due to the relatively low numbers of bases associated with the different constituents and the close similarities of their molecular weights, as well as the need to retain the constituents in an intact structure, the gel electrophoretic analyses are a challenge. To overcome these difficulties, we applied delicate separation conditions (see Supporting Information), and we further modified the constituents with “innocent” tethers that are not expected to alter the equilibrated system, yet they introduce sufficient structural changes that enable the electrophoretic separation (for the modified constituents used for the electrophoretic experiments: modified B, Bm, 13 instead of 3, and modified A′, A′m, 14 instead of 2 were used; see Figure S4). Figure 6 depicts the image of a continuous single gel comparing the constituents of the systems shown in states “F” and “G” (Figure 2) and states “F” and “H” (Figure 5A) to the bands of the individual separated constituents. Lanes 1 to 6 present the bands corresponding to the individual constituents participating in the effector C′-induced transition of the network shown in Figure 2: lane 1, AA′; lane 2, AB′; lane 3, BA′; lane 4, BB′ (belong to the constituents in state “F”); lane 5, AA′-T; lane 6, AB′-C (constituents presented in state “G”). The separated bands of the constituents of the network depicted in Figure 2 prior to the addition of C′ are presented in lane 7, where the constituents AA′, AB′, BA′, and BB′ are clearly visible. Lane 8 shows the bands corresponding to the constituents of the system presented in Figure 2, after subjecting the network to

Figure 3. Kinetic features of the catalytic nucleic acids associated with the constituents of the CDNs shown in Figure 2. Results show the time-dependent fluorescence changes observed upon cleavage of the fluorophore/quencher-functionalized substrates of the respective Mg2+-dependent DNAzymes. Panel I: AA′ (fluorescence of Cy5); panel II: AB′ (fluorescence of ROX); panel III: BA′ (fluorescence of FAM); and panel IV: BB′ (fluorescence of Cy5.5). Kinetic features of the constituents of the CDNs: curves (i), the CDN “F”; curves (ii), the CDN “G”, after subjecting the CDN “F” to the effector C′; curves (iii), the CDN “F”, after subjecting the CDN “G” to the counter effector C.

Figure 4. Contents of the different constituents of the CDNs shown in Figure 2: (i) the CDN “F”; (ii) the CDN “G” after subjecting the CDN “F” to the effector C′; (iii) the CDN “F” after subjecting the CDN “G” to the counter effector C.

Table 1. Input-Triggered Concentrations of the Constituents Associated with the Dynamic Networks Displayed in Figure 2 systema

[AA′]/μM

[BB′]/μM

[BA′]/μM

[AB′]/μM

i ii iii

0.22 0.72 0.18

0.31 0.75 0.28

0.50 0.15 0.65

0.68 0.14 0.64

(i) The CDN “F”. (ii) The CDN “G” after subjecting the CDN “F” to effector C′. (iii) The CDN “F” after subjecting the CDN “G” to the counter effector C. a

derived content of the constituents. One may realize that the concentrations of the constituents AA′ and BB′ are increased by 227% and 142% upon addition of C′, respectively, while the concentrations of AB′ and BA′ are decreased by 79% and 70% after addition of C′, respectively. In the next step, we have examined the reversible switchable reconfigurations of the CDNs, Figure 2. Treatment of AA′-T with strand C separates the triplex structure and recovers the network consisting of AA′, AB′, BA′, and BB′, which reveals the original catalytic 9665


Article


Figure 5. (A) Switchable control of the constituents of CDNs by the effector-induced formation or dissociation of T-A·T triplexes and using D′ as effector. The catalytic activities of the Mg2+-dependent DNAzymes associated with the different constituents provide readout signals for the quantitative assessment of the concentrations of the constituents. Inset: Schematic cleavage of the fluorophore/quencher-modified substrates of the different Mg2+-dependent DNAzymes associated with the respective constituents (for the kinetic results of the CDNs see Figure S3). “F” and “H” indicate the structures of the constituents in the CDN states before and after subjecting the system to the effector and counter-effector D′ and D, respectively. (B) Triggered switchable control of the contents of the constituents of the CDNs shown in (A): (i) the CDN “F”; (ii) the CDN “H” after subjecting the CDN “F” to the effector D′; (iii) the CDN “F” after subjecting the CDN “H” to the counter effector D.

Table 2. Input-Triggered Concentrations of the Constituents Associated with the Dynamic Networks Displayed in Figure 5 systema

[AA′]/μM

[BB′]/μM

[BA′]/μM

[AB′]/μM

i ii iii

0.22 0.13 0.23

0.31 0.09 0.29

0.50 0.67 0.59

0.68 0.78 0.67

(i) The CDN “F”. (ii) The CDN “H” after subjecting the CDN “F” to effector D′. (iii) The CDN “F” after subjecting the CDN “H” to the counter effector D.

a

Figure 6. SYBR gold stained gel electrophoretic-separated constituents of the CDNs presented in Figure 2 and Figure 5A, and of the reference individual intact constituents (native PAGE gel). For the detailed conditions of the electrophoresis experiments, see Supporting Information. Lane 1, AA′; lane 2, AB′; lane 3, BA′; lane 4, BB′; lane 5, AA′-T; lane 6, AB′-C; lane 7, separated mixture of CDN “F” shown in Figure 2; lane 8, separated mixture of CDN “G” (after subjecting the CDN “F” to effector C′) shown in Figure 2; lane 9, constituent BA′-T of the CDN “H” (after subjecting the CDN “F” to effector D′) shown in Figure 5A; lane 10, constituent BB′-D of the CDN “H” shown in Figure 5A; lane 11, separated constituents of the CDN “H” shown in Figure 5A. (Note, the constituents of the different CDNs were slightly modified by innocent tethers to improve the separation, as described in the text and Figure S4.) For further discussion of the electrophoresis results see Figure S5 and Figure S6, Supporting Information.

C′. Evidently, after the addition of C′, the band of AA′ is depleted and two intense bands of AA′-T and BB′ are observed. Note that the bands corresponding to AB′-C and BA′ are very weak, yet detectable by the imaging software; see Table 3 (these “invisible” bands are marked with rectangles in lane 8). Clearly, subjecting the network presented in Figure 2 to C′ enriched the network constituent AA′-T and increased the content of BB′. Lane 9 and lane 10 present the additional individual, intact reference structures participating in the orthogonal D′-driven transition of the network shown in Figure 5A, namely, the structures BA′-T (lane 9) and BB′-D (lane 10). Lane 11 presents the separated constituents of state “H” (cf. Figure 5A) generated upon treatment of state “F” with the effector D′. These bands are compared to the bands of the individual constituents shown in lane 1 and lane 2, corresponding to AA′ and AB′, and in lane 9 and lane 10, corresponding to BA′-T and BB′-D, respectively. Evidently, in state “H”, two intense bands corresponding to BA′-T (new) and AB′ are formed (higher intensities as compared to the original network). Also, two weak bands corresponding to the AA′ and BB′-D constituents are detected by the imaging software (these weak bands are marked with rectangles in lane 11). Note that BA′, present in the original network (lane 7), is almost completely depleted upon subjecting the network to D′, consistent with the enrichment of BA′-T and AB′. Table 3

summarizes the concentrations of the different constituents as derived from the activities of the different DNAzymes in the networks before and after subjecting the network to C′ and D′, respectively, and the concentrations of the respective constituents derived from the quantitative gel electrophoresis experiments (note that these values correspond to an average of three individual gel electrophoresis experiments). Excellent agreement between the kinetic experiments and the electrophoretic experiments is observed. It should be noted that the elongation of the constituents to yield the structures AA′m, AB′, BmA′m, and BmB′ did not affect the catalytic activities of the 9666


Article


accompanying separation of WX′ and XW′. The separation of the constituents WX′ and XW′ is then accompanied by the concomitant increase in the content of the agonist constituent XX′. The resulting equilibrated CDN assembly yields state “N”. The contents of the constituents WW′ and XX′ are then evaluated by the catalytic activities of the K+-stabilized hemin/ G-quadruplex and the Mg2+-ion-dependent DNAzyme moduli and using the respective calibration curves. Treatment of state “N” with crown ether eliminates the K+ ions from the CDN system, thereby weakening the stability of WW′, resulting in the recovery of state “M”. Thus, the reversible transitions between states “M” and “N” are driven by the K+-ions/crown ether triggers. Figure 8A, panel I, depicts the time-dependent fluorescence changes of the CDNs, originating from the Mg2+-dependent cleavage of 8 by the constituent XX′, before the addition of K+ ions, curve a, and after the addition of K+ ions, 20 mM, curve b. Evidently, the cleavage of the substrate is enhanced upon addition of K+ ions, consistent with the K+induced enrichment of constituent WW′ that is accompanied by the agonistic increase in the content of constituent XX′, upon formation of state “N” of the CDN. Similarly, Figure 8A, panel II, shows the time-dependent absorbance changes resulting from the hemin/G-quadruplex-catalyzed oxidation of ABTS2− to the colored product ABTS•−, before the addition of K+ ions, curve a, and after the addition of K+ ions, 20 mM, curve b. Clearly, the rate of formation of ABTS•− by the CDN “M” is substantially lower than the rate of formation of ABTS•− by the CDN “N”. These results are consistent with the K+-ionguided stabilization of the hemin/G-quadruplex catalytic DNAzyme constituent, WW′, that results in the enhanced catalyzed oxidation of ABTS2− to ABTS•− by H2O2. The low activity of the CDN in state “M” toward the oxidation of ABTS2− is attributed to the low-affinity Na+-stabilized Gquadruplex (Na+ ions are present in the buffer solution), which leads to a low content of the hemin/G-quadruplex in the CDN “M”.39 Using the appropriate calibration curves corresponding to the fluorescence or absorbance changes generated by different concentrations of pure XX′ and WW′, Figure S8, and knowing the overall content of the components (W, W′, X, X′) in the network, we evaluated the concentrations of the different constituents in the networks “M” and “N”, Table 4 (for further support of the contents of the constituents in CDNs “M” and “N” by electrophoresis experiments, vide inf ra).

Table 3. Comparison of the Concentrations of the Constituents Comprising the Different CDNs as Evaluated by the Kinetic Features of the DNAzymes and the Quantitative Electrophoretic Experiments concentrations (μM) evaluated by Mg2+-ion-dependent DNAzymes

concentrations (μM) evaluated by gel electrophoresis

systema

[AA′]

[BB′]

[BA′]

[AB′]

[AA′]

[BB′]

[BA′]

[AB′]

a b c

0.22 0.72 0.13

0.31 0.75 0.09

0.50 0.15 0.67

0.68 0.14 0.78

0.27 0.69 0.15

0.24 0.76 0.10

0.53 0.06 0.69

0.58 0.16 0.73

(a) The CDN “F”. (b) The CDN ″G″ after subjecting the CDN “F″ to effector C′. (c) The CDN “H″ after subjecting the CDN “F″ to effector D′.

a

related Mg2+-ion-dependent DNAzymes, implying that the equilibrated modified constituents exhibit identical composition to the CDNs, cf. Figure S7. The second four-constituent nucleic acids-based dynamic constitutional network that was examined in the present study is displayed in Figure 7. The CDN is reversibly triggered by K+ ions and crown ether via the formation or dissociation of a K+ion-stabilized G-quadruplex. One CDN assembly, “M”, includes the duplex structures WW′ (15/16), XW′ (17/16), WX′ (15/ 18), and XX′ (17/18) as constituents. The strands W and W′ are tethered to the guanosine-rich single strands “p” and “q”, capable of forming the ion-stabilized G-quadruplex. The strands X and X′ include the single-stranded tethers “s” and “t”, and in the constituent structure XX′, the tethers self-assemble, in the presence of Mg2+ ions, into the catalytically active Mg2+dependent DNAzyme. The Mg2+-dependent DNAzyme cleaves the fluorophore (ROX)/quencher-modified substrate (8), resulting in the ROX-fragmented fluorescent product. In the presence of hemin in the system, yet in the absence of K+ ions, a small content of Na+-stabilized hemin/G-quadruplex39 accompanies the constituent WW′. The catalytic features associated with the modules XX′ and WW′, using appropriate calibration curves, Figure S8, are translated to the quantitative contents of these constituents (for further discussion on the contents of the constituents by gel electrophoresis, vide inf ra). Treatment of the CDN “M” with K+ ions stabilizes the Gquadruplex module associated with WW′, resulting in the allosteric energetic stabilization of this constituent. This results in the increase in the equilibrated content of WW′ by the

Figure 7. Switchable reconfiguration of nucleic acid-based CDNs using K+ ions and crown-ether as triggers that stabilize or destabilize G-quadruplex units in the CDNs, respectively. 9667


Article


The reversible transitions between the two CDNs, “M” and “N”, were then examined using the K+ ions as an effector that stabilizes the G-quadruplex, thus stimulating the transition of CDN “M” into “N”, and the application of 18-crown-6-ether, acting as counter trigger to the effector. The crown-ether eliminates the K+ ions from the G-quadruplex, thereby inducing the reverse transition of CDN “N” to “M”. Figure 8B presents the concentrations of the constituents XX′ upon the cyclic switching of the CDNs between states “M” and “N”. Evidently, the concentrations of the constituents are reversibly cycled upon application of the K+ ions and crown-ether as trigger and counter trigger, respectively. Further insight into the contents of the constituents present in the CDNs “M” and “N” was obtained by quantitative gel electrophoresis experiments, Figure S9. In these experiments, the mixtures of constituents, corresponding to the systems “M” and “N”, were separated while being compared to the individual intact constituents (for experimental details see the Supporting Information). Table 4 summarizes the concentrations of the constituents WW′, XX′, WX′, and XW′ in the CDN mixtures “M” and “N”, respectively, as derived from the gel electrophoresis experiments (results presented in brackets), while comparing the contents of the constituents in states “M” and “N”, as derived from the catalytic activities of XX′ and WW′. Evidently, the contents of the different constituents in the networks “M” and “N”, provided by the two methods, are in very good agreement.

■

CONCLUSIONS The study has demonstrated that the structural and functional information encoded in nucleic acids provides a rich “toolbox” of motifs that enable the assembly and operation of stimulitriggered CDNs. Specifically, we highlighted the construction of two different CDNs comprising four exchangeable constituents, AA′, BA′, AB′, and BB′. The composition and catalytic functions of the CDNs could be reversibly controlled by applying external triggers. These included the use of effector strands and counter effector strands that dictate the formation or dissociation of T-A·T triplexes that control the composition/ functions of the CDNs and the use of K+-ions/crown ether as effector stimuli that dictate the formation/dissociation of Gquadruplex units, thereby controlling the compositions/ functions of the switchable CDNs. Beyond the control of the catalytic functions of the DNAzymes associated with the CDNs, the DNAzymes provided a means to quantitatively evaluate the content of the constituents in the different CDN mixtures. The study has highlighted several important features of the nucleic acid-based CDNs: (i) The CDNs responded to the auxiliary triggers by adapting their constituents’ content. (ii) The adaptive features of the trigger-guided dynamic constitutional systems led to up-regulated and down-regulated control of the catalytic functions of the CDNs. (iii) The DNAzymes associated with the CDNs provided useful labels to quantitatively evaluate the compositions of the CDNs. (iv) The obtained results demonstrate reversible agonist amplification. (v) They also illustrate network switching by amplification of either of the two diagonals of the square network under application of different effectors. In this context, it is important to note that quantitative electrophoretic separation of the structures involved with the CDNs nicely complemented the kinetic evaluation of the constituents’ contents in the system, provided by the DNAzymes.

Figure 8. (A) Time-dependent catalytic functions of the CDN constituents before and after treatment of the system shown in Figure 7 with K+ ions. Panel I: Time-dependent fluorescence changes generated by constituent XX′: (a) before addition of K+ ions; (b) after the addition of K+ ions, 20 mM. Panel II: Time-dependent absorbance changes generated by the constituent WW′: (a) before the addition of K+ ions; (b) after the addition of K+ ions, 20 mM. (B) Switchable reconfiguration of the CDNs shown in Figure 7 between states “M” and “N”. State “N” is generated by treatment of the initial state, or any “M” state, with K+ ions, 20 mM. State “M” is generated by subjecting state “N” to 18-crown-6-ether, 25 mM. The reconfiguration of the CDNs is probed by quantitative evaluation of the content of the constituent XX′ by the time-dependent fluorescence changes generated by XX′ and using appropriate calibration curves, Figure S8.

Table 4. Quantitative Evaluation of the Contents of the Constituents in CDNs “M” and “N” Before and After the Addition of K+ Ions constituent

K+/0 mM

WW′ WX′ XW′ XX′

0.58 ± 0.05 (0.7 ± 0.1) 2.42 ± 0.05c (2.5 ± 0.5)d 2.42 ± 0.05c (2.3 ± 0.5)d 0.14 ± 0.02b (0.20 ± 0.04)d a

K+/20 mM d

1.4 ± 0.1a (1.1 ± 0.2)d 1.6 ± 0.1c (1.3 ± 0.3)d 1.6 ± 0.1c (1.9 ± 0.4)d 0.42 ± 0.02b (0.5 ± 0.1)d

a

CDN content evaluated by the catalytic activity of the hemin/Gquadruplex. bContent evaluated by the catalytic activity of the Mg2+dependent DNAzyme. cContent evaluated by knowing the contents of W and W′ and knowing the total concentration of the constituents. d Content evaluated by analyzing the stained bands of the separated constituents.

9668


Article


“H” to state “F”, the CDNs “G” or “H”, lacking the substrates 7, 8, 9, and 10, were treated with the counter effectors C or D, 0.86 μL, 100 μM each, allowed to equilibrate at 25 °C for a time interval of 12 h, and finally treated with the substrates 7, 8, 9, and 10, respectively; subsequently the time-dependent fluorescence changes of the different catalytic constituents were characterized. The results imply that the cleavage of the respective substrates is slow as compared to the equilibration time of the different CDNs. Using the appropriate calibration curves corresponding to the rates of cleavage of the different substrates by different concentrations of the intact constituents (see detailed description in Figure S2), the contents of the constituents in the different CDNs were evaluated. (For experiments that apply different concentrations of the effector C′ to reconfigure CDN “F” to CDN “G”, see Figure S10 and accompanying discussion. For the effect of the time interval used to equilibrate CDN “F” to CDN “G”, see Figure S11 and accompanying discussion.) Similarly, the equilibrated CDN shown in Figure 7, state “M”, consisting of WW′, WX′, XW′, and XX′, was incubated with hemin, 150 nM, for 20 min. Subsequently, the catalytic functions of WW′ and of XX′ were probed by following the time-dependent absorbance changes (as a result of the catalyzed oxidation of ABTS2− by H2O2 to ABTS•−), and the time-dependent fluorescence changes generated by the catalyzed cleavage of substrate (8), by the constituents WW′ and XX′, respectively. Afterward, the CDN in state “M” was treated with KCl, 20 mM, to yield state “N”. After an equilibration time interval of 20 min, the catalytic functions of the constituents WW′ and XX′ were evaluated by probing the time-dependent absorbance changes and time-dependent fluorescence changes, generated by the respective constituents. The CDN in state “N” was reconfigured into the CDN in state “M” by the addition of 18-crown-6-ether, 25 mM. The contents of the different constituents in CDNs “M” and “N” were evaluated by using appropriate calibration curves; see Figure S8.

It should be noted that, at present, CDNs were constructed by only four nucleic acid structures. Nonetheless, the broad possibilities to “engineer” nucleic acid structures suggest that CDNs of enhanced complexities and functionalities could be designed. On the basis of our results, CDNs consisting of more constituents (three-dimensional CDNs) and intercommunication between CDNs may be envisaged.

■

EXPERIMENTAL SECTION

Materials. The chemicals used in the study are detailed in the Supporting Information. The oligonucleic acid sequences used in the study include: (1) 5′-CTGCTCAGCGATCTTACTTTTCTTTT TTAATGACGGTTTTTTCTTTAG-3′, (2) 5′-AAAAAAGAAATCTA AGCACCCATGTTACTCT-3′, (3) 5′-GATATCAGCGATCTTA CTTTTCTTTTTTACCAGGAGTTTTTTCTTTAG-3′, (4) 5′-GAAA AGTAAGCACCCATGTTCGTCA-3′, (5) 5′-AAAAACCGTCAA CAGCTCTC-3′, (6) 5′-AAAAACTCCTGCTTCCACAC-3′, (7) 5′Cy5-AGAGTATrAGGAGCAG-BHQ2-3′, (8) 5′-ROX-TGAC GATrAGGAGCAG-BHQ2-3′, (9) 5′-FAM-AGAGTATrAGGAT ATC-BHQ1-3′, (10) 5′-Cy5.5-TGACGATrAGGATATC-IBRQ-3′, (11) 5′-GAGAGCTGTTGACGGTTTTT-3′, (12) 5′-GTGTGG AAGCAGGAGTTTTT-3′, (13) 5′-GATATCAGCGATCTTACTT TTCTTTTTTACCAGGAGTTTTTTCTTTAGCACACACACACA CACACACACA-3′, (14) 5′-CACAGACAAAAAAGAAATCTAAG CACCCATGTTACTCT-3′, (15) 5′-TGGGTTATTGCCACCCAT GT-3′, (16) 5′-AGCGATGCAATATGGGTAGGGCGGG-3′, (17) 5′-TAATGCCACCCATGTTCGTCA-3′, (18) 5′-CTGCTCAGCG ATGCAATAT-3′. The ribonucleobase cleavage site, rA, in the substrates of the different Mg2+-dependent DNAzymes is indicated in bold, the respective Mg2+-dependent DNAzyme sequences are underlined, and the triplex domains associated with the different structures are presented in italic. Preparation of CDNs. The CDN shown in Figure 2, which includes the constituents AA′, AB′, BA′, and BB′, was prepared by the initial assembly of the A/C and B/D duplexes. A, 5 μM, was hybridized with C, 5 μM, and B, 5 μM, was hybridized with D, 5 μM, in a HEPES buffer solution, 10 mM, that included MgCl2, 20 mM, pH = 7.2. Hybridization was carried out by the initial annealing of the respective mixtures at 95 °C followed by cooling to 25 °C at the rate of 0.47 °C min−1 and allowing the mixture to equilibrate for 2 h at 25 °C. Subsequently, a mixture of A/C, B/D, A′, and B′, 2 μM each, in HEPES buffer 10 mM, pH = 7.2, that included MgCl2, 20 mM, was annealed at 35 °C, cooled to 25 °C at a rate of 0.25 °C min−1, and allowed to equilibrate for 2 h at 25 °C, to yield the mixture of the AA′, AB′, BA′, and BB′ constituents of the CDN. The CDN shown in Figure 7 was prepared by mixing the components W, W′, X, and X′, 3 μM each, in a 10 mM HEPES buffer solution, pH = 7.2, that included NaCl, 20 mM, and MgCl2, 20 mM, with the substrate (8), 6 μM. The mixture was annealed at 95 °C, cooled to 25 °C, and allowed to equilibrate for 30 min at 25 °C, to yield the CDN in state “M”. Probing the Catalytic Functions of CDNs in State “F” and Stimuli-Triggered Re-equilibrated States “G” and “H”, Figures 2 and 5; and States “M” and “N”, Figure 7. The equilibrated mixture of AA′, AB′, BA′, and BB′, 60 μL, was treated with the substrates 7, 8, 9, and 10, 3 μL, 100 μM each, to yield state “F”. Subsequently, the time-dependent fluorescence changes driven by the cleavage of the different catalytic constituents were followed. Also, the mixture of AA′, AB′, BA′, and BB′ was subjected to the effector C′ or D′, 0.72 μL, 100 μM each, allowed to equilibrate at 25 °C for a time interval of 12 h, and then treated with the substrates (7, 8, 9, and 10, to yield the states “G” or “H”, respectively. Subsequently, the timedependent fluorescence changes generated upon the cleavage of the respective substrates by the catalytic constituents were monitored. It should be noted that similar rates of cleavage of the substrates (timedependent fluorescence changes) were observed upon the treatment of state “F” with the effectors C′ or D′, and subsequent monitoring of the fluorescence changes generated by the different catalytic constituents provided the CDN readout. For the reverse transition of states “G” or

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/jacs.7b04531. Materials and instrumentation, methods and systems, measurements, the quantitative evaluation of the contents of the constituents of the CDNs described in Figure 2, Figure 5, and Figure 7 by gel electrophoresis, calibration curves, and additional results (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*[email protected] ORCID

Jean-Marie Lehn: 0000-0001-8981-4593 Itamar Willner: 0000-0001-9710-9077 Author Contributions §

S. Wang and L. Yue contributed equally.

Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS This research is supported by The Minerva Center for Biohybrid Complex Systems. REFERENCES

(1) (a) Jaenisch, R.; Bird, A. Nat. Genet. 2003, 33, 245−254. (b) Barabási, A. L.; Oltvai, Z. N. Nat. Rev. Genet. 2004, 5, 101−113. (c) Yeger-Lotem, E.; Sattath, S.; Kashtan, N.; Itzkovitz, S.; Milo, R.; Pinter, R. Y.; Alon, U.; Margalit, H. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 5934−5939. (d) Davidson, E.; Levin, M. Proc. Natl. Acad. Sci. U.

9669


Article

Journal of the American Chemical Society S. A. 2005, 102, 4935−4942. (e) Vogel, C.; Marcotte, E. M. Nat. Rev. Genet. 2012, 13, 227−232. (2) (a) Lehn, J.-M. Supramolecular Chemistry: Concepts and Perspectives; VCH: Weinheim, 1995. (b) Lehn, J.-M. Chem. - Eur. J. 2000, 6, 2097−2102. (c) Streed, J.; Artwood, J. L. Supramolecular Chemistry, 2nd ed.; Wiley: New York, 2000. (d) Kivala, M.; Boudon, C.; Gisselbrecht, J.-P.; Seiler, P.; Gross, M.; Diederich, F. Angew. Chem., Int. Ed. 2007, 46, 6357−6360. (3) (a) Lehn, J.-M. Chem. Soc. Rev. 2007, 36, 151−160. (b) Moulin, E.; Cormos, G.; Giuseppone, N. Chem. Soc. Rev. 2012, 41, 1031−1049. (c) Lehn, J.-M. Angew. Chem., Int. Ed. 2013, 52, 2836−2850. (d) Zhang, Y.; Barboiu, M. Chem. Rev. 2016, 116, 809−834. (4) (a) Lehn, J.-M. Chem. - Eur. J. 1999, 5, 2455−2463. (b) Rowan, S. J.; Cantrill, S. J.; Cousins, G. R.; Sanders, J. K.; Stoddart, J. F. Angew. Chem., Int. Ed. 2002, 41, 898−952. (c) Corbett, P. T.; Leclaire, J.; Vial, L.; West, K. R.; Wietor, J.-L.; Sanders, J. K.; Otto, S. Chem. Rev. 2006, 106, 3652−3711. (d) Belowich, M. E.; Stoddart, J. F. Chem. Soc. Rev. 2012, 41, 2003−2024. (e) Cougnon, F. B.; Jenkins, N. A.; Pantoş, G. D.; Sanders, J. K. Angew. Chem., Int. Ed. 2012, 51, 1443−1447. (5) (a) Hasenknopf, B.; Lehn, J.-M.; Kneisel, B. O.; Baum, G.; Fensha, D. Angew. Chem., Int. Ed. Engl. 1996, 35, 1838−1840. (b) Hasenknopf, B.; Lehn, J.-M.; Boumediene, N.; Dupont-Gervais, A.; Van Dorsselaer, A.; Kneisel, B.; Fenske, D. J. Am. Chem. Soc. 1997, 119, 10956−10962. (6) (a) Northrop, B. H.; Aricó, F.; Tangchiavang, N.; Badjić, J. D.; Stoddart, J. F. Org. Lett. 2006, 8, 3899−3902. (b) Valade, A.; Urban, D.; Beau, J. M. ChemBioChem 2006, 7, 1023−1027. (7) (a) Ramström, O.; Lehn, J.-M. Nat. Rev. Drug. Discovery 2002, 1, 26−36. (b) Herrmann, A. Chem. Soc. Rev. 2014, 43, 1899−1933. (8) (a) Huc, I.; Lehn, J.-M. Proc. Natl. Acad. Sci. U. S. A. 1997, 94, 2106−2110. (b) Nicolaou, K. C.; Hughes, R.; Cho, S. Y.; Winssinger, N.; Smethurst, C.; Labischinski, H.; Endermann, R. Angew. Chem., Int. Ed. 2000, 39, 3823−3828. (9) (a) Nasr, G.; Macron, T.; Gilles, A.; Moulinea, Z.; Barboiu, M. Chem. Commun. 2012, 48, 6827−6829. (b) Roche, C.; Percec, V. Isr. J. Chem. 2013, 53, 30−44. (10) (a) Ghosh, S.; Mukhopadhyay, P.; Isaacs, L. J. Syst. Chem. 2010, 1, 1−6. (b) Lehn, J.-M. Top. Curr. Chem. 2011, 322, 1−32. (c) Hafezi, N.; Lehn, J.-M. J. Am. Chem. Soc. 2012, 134, 12861−12868. (11) Liu, K.; Kang, Y.; Wang, Z.; Zhang, X. Adv. Mater. 2013, 25, 5530−5548. (12) Vantomme, G.; Jiang, S.; Lehn, J.-M. J. Am. Chem. Soc. 2014, 136, 9509−9518. (13) (a) Giuseppone, N.; Schmitt, J.-L.; Lehn, J.-M. Angew. Chem., Int. Ed. 2004, 43, 4902−4906. (b) Kovaříček, P.; Lehn, J.-M. J. Am. Chem. Soc. 2012, 134, 9446−9455. (14) (a) Zhang, D. Y.; Turberfield, A. J.; Yurke, B.; Winfree, E. Science 2007, 318, 1121−1125. (b) Soloveichik, D.; Seelig, G.; Winfree, E. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 5393−5398. (15) (a) Yurke, B.; Mills, A. P. Genet. Program. Evol. M. 2003, 4, 111− 122. (b) Zhang, D. Y.; Seelig, G. Nat. Chem. 2011, 3, 103−113. (16) (a) Miyake, Y.; Togashi, H.; Tashiro, M.; Yamaguchi, H.; Oda, S.; Kudo, M.; Tanaka, Y.; Kondo, Y.; Sawa, R.; Fujimoto, T.; Machinami, T.; Ono, A. J. Am. Chem. Soc. 2006, 128, 2172−2173. (b) Xue, X.; Wang, F.; Liu, X. J. Am. Chem. Soc. 2008, 130, 3244− 3245. (c) Ono, A.; Cao, S.; Togashi, H.; Tashiro, M.; Fujimoto, T.; Machinami, T.; Oda, S.; Miyake, Y.; Okamoto, I.; Tanaka, Y. Chem. Commun. 2008, 4825−4827. (d) Freeman, R.; Finder, T.; Willner, I. Angew. Chem., Int. Ed. 2009, 48, 7818−7821. (e) Park, K. S.; Jung, C.; Park, H. G. Angew. Chem., Int. Ed. 2010, 49, 9757−9760. (17) (a) Sklenár, V.; Feigon, J. Nature 1990, 345, 836−838. (b) Häner, R.; Dervan, P. B. Biochemistry 1990, 29, 9761−9765. (c) Völker, J.; Botes, D. P.; Lindsey, G. G.; Klump, H. H. J. Mol. Biol. 1993, 230, 1278−1290. (d) Leitner, D.; Schröder, W.; Weisz, K. Biochemistry 2000, 39, 5886−5892. (e) Soto, A. M.; Loo, J.; Marky, L. A. J. Am. Chem. Soc. 2002, 124, 14355−14363. (f) Chen, Y.; Lee, S.-H.; Mao, C. Angew. Chem., Int. Ed. 2004, 43, 5335−5338. (18) (a) Asanuma, H.; Ito, T.; Yoshida, T.; Liang, X.; Komiyama, M. Angew. Chem., Int. Ed. 1999, 38, 2393−2395. (b) Asanuma, H.; Liang,

X.; Yoshida, T.; Komiyama, M. ChemBioChem 2001, 2, 39−44. (c) Phillips, J. A.; Liu, H.; O’Donoghue, M. B.; Xiong, X.; Wang, R.; You, M.; Sefah, K.; Tan, W. Bioconjugate Chem. 2011, 22, 282−288. (19) (a) Osborne, S. E.; Matsumura, I.; Ellington, A. D. Curr. Opin. Chem. Biol. 1997, 1, 5−9. (b) Willner, I.; Zayats, M. Angew. Chem., Int. Ed. 2007, 46, 6408−6418. (c) Goulko, A. A.; Li, F.; Le, X. C. TrAC, Trends Anal. Chem. 2009, 28, 878−892. (d) Famulok, M.; Mayer, G. Acc. Chem. Res. 2011, 44, 1349−1358. (20) (a) Breaker, R. R.; Joyce, G. F. Chem. Biol. 1994, 1, 223−229. (b) Joyce, G. F. Annu. Rev. Biochem. 2004, 73, 791−836. (c) Joyce, G. F. Angew. Chem., Int. Ed. 2007, 46, 6420−6436. (d) Famulok, M.; Hartig, J. S.; Mayer, G. Chem. Rev. 2007, 107, 3715−3743. (e) Willner, I.; Shlyahovsky, B.; Zayats, M.; Willner, B. Chem. Soc. Rev. 2008, 37, 1153−1165. (21) (a) Travascio, P.; Li, Y.; Sen, D. Chem. Biol. 1998, 5, 505−517. (b) Travascio, P.; Bennet, A. J.; Wang, D. Y.; Sen, D. Chem. Biol. 1999, 6, 779−787. (c) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2004, 26, 7430−7431. (d) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 2152−2156. (e) Golub, E.; Lu, C. H.; Willner, I. J. Porphyrins Phthalocyanines 2015, 19, 65−91. (22) (a) Seeman, N. C. Annu. Rev. Biophys. Biomol. Struct. 1998, 27, 225−248. (b) Seeman, N. C. Mol. Biotechnol. 2007, 37, 246−257. (c) Lu, C.-H.; Willner, B.; Willner, I. ACS Nano 2013, 7, 8320−8332. (23) (a) Aldaye, F. A.; Palmer, A. L.; Sleiman, H. F. Science 2008, 321, 1795−1799. (b) Roh, Y. H.; Ruiz, R. C.; Peng, S.; Lee, J. B.; Luo, D. Chem. Soc. Rev. 2011, 40, 5730−5744. (c) Kuzyk, A.; Schreiber, R.; Fan, Z.; Pardatscher, G.; Roller, E. M.; Högele, A.; Simmel, F. C.; Govorov, A. O.; Liedl, T. Nature 2012, 483, 311−314. (d) Schreiber, R.; Luong, N.; Fan, Z.; Kuzyk, A.; Nickels, P. C.; Zhang, T.; Smith, D. M.; Yurke, B.; Kuang, W.; Govorov, A. O.; Liedl, T. Nat. Commun. 2013, 4, 2948−2954. (24) (a) Niemeyer, C. M. Curr. Opin. Chem. Biol. 2000, 4, 609−618. (b) Malo, J.; Mitchell, J. C.; Vénien-Bryan, C.; Harris, J. R.; Wille, H.; Sherratt, D. J.; Turberfield, A. J. Angew. Chem., Int. Ed. 2005, 44, 3057−3061. (c) Sharma, J.; Chhabra, R.; Cheng, A.; Brownell, J.; Liu, Y.; Yan, H. Science 2009, 323, 112−116. (d) Wilner, O. I.; Willner, I. Chem. Rev. 2012, 112, 2528−2556. (25) (a) Yurke, B.; Turberfield, A. J.; Mills, A. P., Jr.; Simmel, F. C.; Neumann, J. L. Nature 2000, 406, 605−608. (b) Simmel, F. C.; Dittmer, W. U. Small 2005, 1, 284−299. (c) Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2, 275−284. (d) Elbaz, J.; Wang, Z.-G.; Orbach, R.; Willner, I. Nano Lett. 2009, 9, 4510−4514. (e) Teller, C.; Willner, I. Curr. Opin. Biotechnol. 2010, 21, 376−391. (f) Wang, Z.-G.; Elbaz, J.; Willner, I. Nano Lett. 2011, 11, 304−309. (g) You, M.; Huang, F.; Chen, Z.; Wang, R.-W.; Tan, W. ACS Nano 2012, 6, 7935− 7941. (h) You, M.; Chen, Y.; Zhang, X.; Liu, H.; Wang, R.; Wang, K.; Williams, K. R.; Tan, W. Angew. Chem., Int. Ed. 2012, 51, 2457−2460. (i) Wang, F.; Liu, X.; Willner, I. Angew. Chem., Int. Ed. 2015, 54, 1098−1129. (26) (a) Golub, E.; Albada, H. B.; Liao, W.-C.; Biniuri, Y.; Willner, I. J. Am. Chem. Soc. 2016, 138, 164−172. (b) Albada, H. B.; Golub, E.; Willner, I. Chem. Sci. 2016, 7, 3092−3101. (27) (a) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 1192−1199. (b) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. J. Am. Chem. Soc. 2006, 128, 3138−3139. (c) Kolpashchikov, D. M. Chem. Rev. 2010, 110, 4709− 4723. (d) Pelossof, G.; Tel-Vered, R.; Willner, I. Anal. Chem. 2012, 84, 3703−3709. (28) (a) Stojanovic, M. N.; Semova, S.; Kolpashchikov, D.; Macdonald, J.; Morgan, C.; Stefanovic, D. J. Am. Chem. Soc. 2005, 127, 6914−6915. (b) Seelig, G.; Soloveichik, D.; Zhang, D. Y.; Winfree, E. Science 2006, 314, 1585−1588. (c) Elbaz, J.; Lioubashevski, O.; Wang, F.; Remacle, F.; Levine, R. D.; Willner, I. Nat. Nanotechnol. 2010, 5, 417−422. (d) Qian, L.; Winfree, E. Science 2011, 332, 1196− 1201. (e) Orbach, R.; Willner, B.; Willner, I. Chem. Commun. 2015, 51, 4144−4160. (29) (a) Liedl, T.; Dietz, H.; Yurke, B.; Simmel, F. Small 2007, 3, 1688−1693. (b) Cheng, E.; Xing, Y.; Chen, P.; Yang, Y.; Sun, Y.; 9670


Article

Journal of the American Chemical Society Zhou, D.; Xu, L.; Fan, Q.; Liu, D. Angew. Chem., Int. Ed. 2009, 48, 7660−7663. (c) Ren, J.; Hu, Y.; Lu, C.-H.; Guo, W.; Aleman-Garcia, M. A.; Ricci, F.; Willner, I. Chem. Sci. 2015, 6, 4190−4195. (d) Li, J.; Zheng, C.; Cansiz, S.; Wu, C.; Xu, J.; Cui, C.; Liu, Y.; Hou, W.; Wang, Y.; Zhang, L.; Teng, I. T.; Yang, H. H.; Tan, W. J. Am. Chem. Soc. 2015, 137, 1412−1415. (e) Kahn, J. S.; Hu, Y.; Willner, I. Acc. Chem. Res. 2017, 50, 680−690. (30) (a) Lee, J. B.; Peng, S.; Yang, D.; Roh, Y. H.; Funabashi, H.; Park, N.; Rice, E. J.; Chen, L.; Long, R.; Wu, M.; Luo, D. Nat. Nanotechnol. 2012, 7, 816−820. (b) Lu, C.-H.; Guo, W.; Hu, Y.; Qi, X.-J.; Willner, I. J. Am. Chem. Soc. 2015, 137, 15723−15731. (c) Guo, W.; Lu, C. H.; Orbach, R.; Wang, F.; Qi, X. J.; Cecconello, A.; Seliktar, D.; Willner, I. Adv. Mater. 2015, 27, 73−78. (31) (a) Chen, C.; Geng, J.; Pu, F.; Yang, X.; Ren, J.; Qu, X. Angew. Chem., Int. Ed. 2011, 50, 882−886. (b) Zhang, Z.; Balogh, D.; Wang, F.; Willner, I. J. Am. Chem. Soc. 2013, 135, 1934−1940. (c) Lu, C.-H.; Willner, I. Angew. Chem., Int. Ed. 2015, 54, 12212−12235. (32) Kahn, J. S.; Freage, L.; Enkin, N.; Garcia, M. A.; Willner, I. Adv. Mater. 2017, 29, DOI: 10.1002/adma.201602782. (33) (a) Liao, W.-C.; Lu, C.-H.; Hartmann, R.; Wang, F.; Sohn, Y. S.; Parak, W. J.; Willner, I. ACS Nano 2015, 9, 9078−9086. (b) Huang, F.; Liao, W.-C.; Sohn, Y. S.; Nechushtai, R.; Lu, C.-H.; Willner, I. J. Am. Chem. Soc. 2016, 138, 8936−8945. (34) (a) Shen-Orr, S. S.; Milo, R.; Mangan, S.; Alon, U. Nat. Genet. 2002, 31, 64−68. (b) Alon, U. Nat. Rev. Genet. 2007, 8, 450−461. (35) (a) Idili, A.; Vallée-Bélisle, A.; Ricci, F. J. Am. Chem. Soc. 2014, 136, 5836−5839. (b) Idili, A.; Porchetta, A.; Amodio, A.; ValléeBélisle, A.; Ricci, F. Nano Lett. 2015, 15, 5539−5544. (c) Hu, Y.; Lu, C.-H.; Guo, W.; Kahn, J. S.; Aleman-Garcia, M. A.; Ren, J.; Willner, I. Adv. Funct. Mater. 2015, 25, 6867−6874. (36) (a) Lu, C.-H.; Qi, X.-J.; Orbach, R.; Yang, H. H.; Mironi-Harpaz, I.; Seliktar, D.; Willner, I. Nano Lett. 2013, 13, 1298−1302. (b) Aleman-Garcia, M. A.; Orbach, R.; Willner, I. Chem. - Eur. J. 2014, 20, 5619−5624. (c) Kahn, J. S.; Trifonov, A.; Cecconello, A.; Guo, W.; Fan, C.; Willner, I. Nano Lett. 2015, 15, 7773−7778. (37) Duca, M.; Vekhoff, P.; Oussedik, K.; Halby, L.; Arimondo, P. B. Nucleic Acids Res. 2008, 36, 5123−5138. (38) (a) Zain, R.; Sun, J. S. Cell. Mol. Life Sci. 2003, 60, 862−870. (b) Guntaka, R. V.; Varma, B. R.; Weber, K. T. Int. J. Biochem. Cell Biol. 2003, 35, 22−31. (39) (a) Lu, M.; Guo, Q.; Kallenbach, N. R. Biochemistry 1992, 31, 2455−2459. (b) Hud, N. V.; Smith, F. W.; Anet, F. A.; Feigon, J. Biochemistry 1996, 35, 15383−15390.

9671


Controlling the Catalytic Functions of ... - American Chemical Society

Recommend Documents