Article pubs.acs.org/JAFC
Metabolic Design of Corynebacterium glutamicum for Production of L‑Cysteine with Consideration of Sulfur-Supplemented Animal Feed Young-Chul Joo,† Jeong Eun Hyeon,†,‡ and Sung Ok Han*,† †
Department of Biotechnology, Korea University, Seoul 02841, Republic of Korea Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, Delaware 19702, United States
‡
S Supporting Information *
ABSTRACT: L-Cysteine is a valuable sulfur-containing amino acid widely used as a nutrition supplement in industrial food production, agriculture, and animal feed. However, this amino acid is mostly produced by acid hydrolysis and extraction from human or animal hairs. In this study, we constructed recombinant Corynebacterium glutamicum strains that overexpress combinatorial genes for L-cysteine production. The aims of this work were to investigate the effect of the combined overexpression of serine acetyltransferase (CysE), O-acetylserine sulfhydrylase (CysK), and the transcriptional regulator CysR on L-cysteine production. The CysR-overexpressing strain accumulated approximately 2.7-fold more intracellular sulfide than the control strain (empty pMT-tac vector). Moreover, in the resulting CysEKR recombinant strain, combinatorial overexpression of genes involved in L-cysteine production successfully enhanced its production by approximately 3.0-fold relative to that in the control strain. This study demonstrates a biotechnological model for the production of animal feed supplements such as Lcysteine using metabolically engineered C. glutamicum. KEYWORDS: sulfur-containing amino acid, animal feed supplements, L-cysteine production, metabolic engineering, Corynebacterium glutamicum
■
INTRODUCTION L-Cysteine is an important sulfur-containing amino acid used in agriculture, animal feed, food additives, and the cosmetic and pharmaceutical industries.1,2 In general, L-cysteine plays crucial roles in the following biological processes: the biosynthesis of Lmethionine, thiamin, biotin, coenzyme A, and others; the antioxidant defense systems that protect against oxidative stress; Fe/S cluster formation in enzyme catalytic domains; and protein folding, assembly, and stability via the formation of disulfide bonds.3−5 In domestic animals, L-cysteine performs important functions such as immune modulation, synthesis of skin and hair, and gut mucosal repair processes in animals. Sheep in particular require very high levels of L-cysteine to produce wool. In the case of broiler chickens, dietary L-cysteine with branched-chain amino acids has a positive effect on the immune system.6 Pig feed appears to be important, as the dietary ratios of L-cysteine and L-methionine determine body weight increase.7 In recent years, biologically based amino acid products have become preferred in commercial and industrial markets.8 Several amino acids are produced using commercial fermentation, but cysteine is still mostly produced using acid hydrolysis and extraction from human or animal hair.9,10 Fermentation technology is considered a more efficient, eco-friendly process for L-cysteine production than chemical hydrolysis.11 The microbial L-cysteine biosynthetic pathways of Escherichia coli and Corynebacterium glutamicum have been well studied, whereas other microorganisms have benefited from only a few limited studies.3,5 Nevertheless, high L-cysteine yields have not yet been achieved using metabolically engineered C. glutamicum. In a previous study, a high concentration of L-cysteine has been achieved in metabolically engineered E. coli. However, one of © 2017 American Chemical Society
the aims of the previous study was to produce the unnatural Lα-amino acids via the L-cysteine metabolic pathway.12 LCysteine is synthesized in most bacteria from the substrates 3,5 L-serine and/or L-methionine and a sulfur source. Its biosynthesis from L-serine proceeds via L-serine O-acetyltransferase (encoded by the cysE gene) and O-acetyl L-serine sulfhydrylase (encoded by the cysK gene). L-Cysteine can also be produced by an uncharacterized reaction via S-sulfocysteine synthase (encoded by the cysM gene) and reductases (thioredoxins or glutaredoxins) from O-acetyl L-serine.13 The biosynthesis of L-cysteine from L-methionine proceeds via direct sulfuration, reverse trans-sulfuration, and trans-sulfuration pathways. C. glutamicum can produce L-cysteine via the Lmethionine biosynthetic pathway but can also utilize the Lserine biosynthetic pathway, as performed in E. coli.3 The Gram-negative bacterium E. coli has the bestcharacterized sulfur assimilation process, which utilizes sulfate and thiosulfate pathways.13,14 These pathways are involved in the assimilation of inorganic sulfur sources such as sulfate and thiosulfate for L-cysteine biosynthesis. This is accomplished via the sulfate-thiosulfate permease complex, which contains four subunits encoded by CysU, CysW, CysA, and CysP (or Sbp).13 The initial step of the pathway for the assimilatory reduction of sulfate to sulfide uses a heterodimer complex of adenosine-5′triphosphate (ATP)-dependent sulfurylase (CysD) and guanosine-5′-triphosphate (GTP)-dependent sulfurylase (CysN) to convert sulfate into adenosine-5′-phosphosulfate (APS).15,16 Received: Revised: Accepted: Published: 4698
March 24, 2017 May 30, 2017 May 31, 2017 May 31, 2017 DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry Table 1. Bacterial Strains and Plasmids Used in This Study strain or plasmid
source, reference, or target
description
strains E. coli DH5α pFLAG-CTS pMT1-s pMT-tac CysE CysK CysR CysEK CysER CysKR CysEKR C. glutamicum ATCC 13032 pMT-tac CysE CysK CysR CysEK CysER CysKR CysEKR ATCC 21586 pMT-tac CysEKR plasmids pFLAG-CTS pMT1-s pMT-tac pMT-tac::cysE pMT-tac::cysK pMT-tac::cysR pMTtac::cysEK pMTtac::cysER pMTtac::cysKR pMTtac::cysEKR a
F− ϕ80dlacΔ(lacZ)M15 Δ(lacZYA-argF)U169 endA1 recA1 hsdR17(rK−, mK+) deoR thi-1 phoA supE44 λ− gyrA96 relA1 E. coli DH5α, pFLAG-CTS E. coli DH5α, pMT1-s E. coli DH5α, pMT-tac E. coli DH5α, pMT-tac::cysE E. coli DH5α, pMT-tac::cysK E. coli DH5α, pMT-tac::cysR E. coli DH5α, pMT-tac::cysEK E. coli DH5α, pMT-tac::cysER E. coli DH5α, pMT-tac::cysKR E. coli DH5α, pMT-tac::cysEKR
this this this this this this this this this this
wild-type strain, auxotrophic for biotin C. glutamicum ATCC 13032, pMT-tac, control strain C. glutamicum ATCC 13032, pMT-tac::cysE C. glutamicum ATCC 13032, pMT-tac::cysK C. glutamicum ATCC 13032, pMT-tac::cysR C. glutamicum ATCC 13032, pMT-tac::cysEK C. glutamicum ATCC 13032, pMT-tac::cysER C. glutamicum ATCC 13032, pMT-tac::cysKR C. glutamicum ATCC 13032, pMT-tac::cysEKR wild-type strain, auxotrophic for biotin C. glutamicum ATCC 21586, pMT-tac, control strain C. glutamicum ATCC 21586, pMT-tac::cysEKR
ATCCb this study this study this study this study this study this study this study this study ATCCb this study this study
tac promoter-based E. coli expression vector, N-terminal OmpA, and C-terminal FLAG P-out-cg0955-MCS-rrnBT1T2 lacI-P-tac-MCS-rrnBT1T2 pMT-tac, carrying cysE gene pMT-tac, carrying cysK gene pMT-tac, carrying cysR gene pMT-tac, carrying cysE and cysK genes
Sigma-Aldrichc 26 this study this study this study this study this study
pMT-tac, carrying cysE and cysR genes
this study
pMT-tac, carrying cysK and cysR genes
this study
pMT-tac, carrying cysE, cysK, and cysR genes
this study
Invitrogena study study study study study study study study study study
Invitrogen Corp., Carlsbad, CA, USA. bATCC, American Type Culture Collection, Manassas, VA, USA. cSigma-Aldrich, St. Louis, MO, USA.
of sulfate into the cytoplasm by sulfate transporters such as CysU, CysA, and other putative permeases, as performed in E. coli, Clostridium perfringens, Mycobacterium tuberculosis, and Pseudomonas sp.18 However, C. glutamicum lacks the reaction route for the reduction of PAPS by CysC that is present in E. coli. Furthermore, unlike E. coli, C. glutamicum catalyzed the assimilatory reduction of APS to sulfite in a single step using a CysH-encoded APS reductase.18 The L-cysteine biosynthetic pathway in C. glutamicum is associated both directly and indirectly with many genes that have no known functions in sulfur metabolism.20 In recent years, the transcriptional regulation of sulfur metabolism in C. glutamicum has been studied intensively. In particular, the transcriptional regulator CysR (Cgl0121) is involved in the transcriptional activation of f pr2-cysIXHDNYZ and ssuR gene clusters for assimilatory sulfate reduction and sulfonate utilization in C. glutamicum.20−24 However, the impact of
The next step uses the ATP-dependent APS kinase (CysC) to convert APS into 3′-phosphoadenosine-5′-phosphosulfate (PAPS). After the reduction of APS, PAPS is converted to sulfite by the NADPH-dependent PAPS reductase (CysH). In the final step of sulfate reduction, sulfite is converted to sulfide by the NADPH-dependent sulfite reductase (CysIJ/G). This sulfide is utilized as a sulfur donor for L-cysteine biosynthesis by CysK, with O-acetylserine as a sulfur acceptor. In the case of the thiosulfate pathway, L-cysteine can be synthesized by the direct assimilatory reduction of thiosulfate (instead of sulfide) through a different route requiring CysM activity.13,14 C. glutamicum is a Gram-positive bacterium with generally regarded as safe17 status. Its genome sequence and a previous study of its sulfur assimilation mechanism suggested that C. glutamicum could utilize both inorganic and organic forms of sulfur, such as sulfate and sulfonates.18,19 The uptake of sulfur sources by C. glutamicum was proposed to involve the transport 4699
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry Table 2. Oligonucleotide Primers Used in This Study
a
primer
sequencea
tac F′ tac R′ (ClaI) lacI F′ (XhoI) lacI R′ cysE F′ (BamHI) cysE R′ (KpnI) cysK F′ (BamHI) cysK R′ (KpnI) cysR F′ (BamHI) cysR R′ (KpnI) OE cysEK MF′ OE cysEK MR′ OE cysER MF′ OE cysER MR′ OE cysKR MF′ OE cysKR MR′ OE cysEKR MF′ OE cysEKR MR′ 16S rRNA F′ 16S rRNA R′ ssuR F′ ssuR R′ fpr2 F′ fpr2 R′ cysI F′ cysI R′ cysX F′ cysX R′ cysH F′ cysH R′ cysD F′ cysD R′ cysN F′ cysN R′ cysY F′ cysY R′ cysZ F′ cysZ R′ ssuD1 F′ ssuD1 R′ ssuC F′ ssuC R′ ssuB F′ ssuB R′ ssuA F′ ssuA R′ ssuI F′ ssuI R′ seuA F′ seuA R′ seuB F′ seuB R′ seuC F′ seuC R′ ssuD2 F′ ssuD2 R′
CCATTCCATGGTGTCTTGACAATTAATCATCGGCTCGTATAATGTGT GGGATCGATATGATATCTCCTGTGTGAAATTGTTATCCG GGGCTCGAGAGCCTGGGGTGCCTAATGAG GACACCATGGAATGGTGCAAAACC GCGCGCGGATCCATGCTCTCGACAATAAAAATGATC CAGGTACCTTAGTGGTGGTGGTGGTGGTGAATGTAATAGTCCGGATCGA GCGCGGATCCATGGGCAATGTGTACAACAA CAGAGGTACCTTAGTGGTGGTGATGATGATGGTCGCGGATGTCTTCGTA GCGCGCGGATCCATGATTGGCTATGGTTTACC CGCGGTACCCTAATGATGATGATGATGATGGGGTACGAGAGTAAGTGG CTAAAAGGAGATATAGATGGGCAATGTGTACAACAACATCACCGAAACC CATCTATATCTCCTTTTAGTGGTGGTGGTGGTGGTGAATGTAATAGTCC AAAAGGAGATATAGATGATTGGCTATGGTTTACCTATGCCCAATCAGGC CATCTATATCTCCTTTTAGTGGTGGTGGTGGTGGTGAATGTAATAGTCC AAAAGGAGATATAGATGATTGGCTATGGTTTACCTATGCCCAATCAGGC GCCAATCATCTATATCTCCTTTTAGTGGTGGTGATGATGATGGTCGCGG AATCCTCGAAGACACCGACGGCAAC GTTGCCGTCGGTGTCTTCGAGGATT GTAATCGCAGATCAGCAACGC AGAAAGGAGGTGATCCAGCC GTTGTCGACCCCGAAGCC CACAAATGCCAACGGATCTTGAC TTGAAGCTCCAAAGCACCAGG GACAATTGCTGGAGCTTCGC GCGTTGAAGGTTTCCAGGTTC CACCAAATCTTCCTCAGCGG ACTGCCCATACTGCGCGG GTTGCGACTCACCTCTTTTGTGT CTCCAATTATCACCTGGTCATTGG GAGTGAAGTCCGCATTCTGTCT AGGAGATCGTCACCAAGACTG GAAGTAGCCTTCCTTCTTGCG TCAACGACAACGAAGCACCAG GATCGACCAGTTATTGCGTAGG AACACAAGGCCGTCCACATC GCAGCGTGGTAACGGGCT GTCACACTGAACCTGCCAAAG CCCTTTGGTTCGGAGACAAC ACAGCCCTTGTGGGCTCG CCCAACAGGTTCCAAAACTCGT CCGCCTGGCTCTCACTGA GTAGCGGAAGGTGTGACGTTC ACACCCGAAACTTGGGAGTTC GGCAGGTGTGGTGATTTCGA ATGAATGGGCGACGATTTTCAGC GCCCTCAAATCGGGTGTCTA GCTTTGAAAACCTTGGGTGGG GCGAGGACACCTGTGAGC GTGCCTGAGCTGCAAAAACTTAG GAGTGGGCTCCCTGGGAA AACTGGATCTTGTCGTCGATAAGG GACAAGGATCCGATCGTGTATTG CCAACGTTTTCGATGCGGTG GCTGCTTAGGCTCACCGG CTATGAGCAAGTCGCGCAAG CTGGAAATAAACGGAGTCGCTAC
Restriction enzyme sites are italicized, the nucleotide long 5′ extensions are underlined, and the ribosomal binding site (RBS) are bold.
CysR on the control of sulfur metabolism in production has not yet been studied.
In this study, we constructed C. glutamicum recombinant strains by transforming C. glutamicum with isopropyl thio-β-D-
L-cysteine
4700
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry
(Sigma-Aldrich). The tac promoter and lacIq gene were ligated into the XhoI−ClaI (Takara Bio, Otsu, Japan) restriction sites of the pMT1-s vector, resulting in the modified shuttle expression vector pMT-tac. The cysE, cysK, or cysR gene was amplified by PCR using the primers indicated in Table 2 and the genomic DNA of C. glutamicum as a template. The cysE, cysK, or cysR single-gene fragments were cloned into the BamHI−KpnI restriction sites of pMT-tac, resulting in pMTtac::cysE, pMT-tac::cysK, and pMT-tac::cysR plasmids. The doubleand triple-gene combinations of cysE, cysK, and/or cysR containing a ribosomal binding site (RBS) region were constructed using overlap extension PCR29 with the overlapping primers indicated in Table 2. The double- and triple-gene combinations were cloned into the BamHI−KpnI restriction sites of pMT-tac, resulting in pMTtac::cysEK, pMT-tac::cysER, pMT-tac::cysKR, and pMT-tac::cysEKR plasmids. Enzyme Assays. The C. glutamicum control strain (empty pMTtac vector) and the CysE, CysK, or CysEK recombinant strain cells were grown in CGXII broth, harvested at 10 h by centrifugation (16,600g at 4 °C for 15 min), and washed twice in 50 mM Tris-HCl (pH 8.5). Cell pellets were disrupted using glass beads according to the methods described by Hwang and Cho.30 The concentrations of crude enzyme extracts were determined using the Bradford assay31 with bovine serum albumin as the standard protein. As in the methods described by Haitani et al.30 and Wada et al.32,33 to measure specific activity, the enzymatic reactions were performed in 50 mM Tris-HCl (pH 8.5) containing 0.4 mM pyridoxal 5′-phosphate, 2.5 mM sodium sulfide, 2 mM dithiothreitol (DTT), 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1 mM acetyl-coenzyme A (acetyl-CoA), 1 mg/mL crude enzyme extracts (CysE or CysK), and 1 mM substrate (L-serine or O-acetyl L-serine) at 30 °C for 15 min, respectively. The specific activity was defined as O-acetyl L-serine or L-cysteine produced in nanomoles per minute (U) per milligram with the CysE or CysK enzyme. The competitive inhibition constant (Ki) was calculated from the Lineweaver−Burk plot. RNA Preparation and Real-Time Reverse Transcription (RT)PCR. For total RNA preparation, the control strain (empty pMT-tac vector) and the CysR recombinant strain cells were grown in CGXII broth and harvested at 10 h by centrifugation (16,600g at 4 °C for 15 min). Total RNA was extracted according to the methods described by Hüser et al.34 All oligonucleotide primers for real-time RT-PCR were designed with an approximately 200 bp length fragment of the inside of the gene to be amplified (Table 2). All real-time RT-PCR measurements were performed using a StepOnePlus thermocycler (Thermo Fisher Scientific, Wilmington, DE, USA) with Reverse Transcription Master Premix (Elpisbio, Daejeon, Korea) and HiPi Real-Time PCR 2x Master Mix (SYBR green) (Elpisbio). Relative mRNA levels were always normalized using the 16S rRNA (Gene ID 444304238) level as an internal reference in the C. glutamicum control strain (empty pMT-tac vector) and CysR recombinant strains according to the methods described by Kim et al.35 The mRNA levels of target genes were calculated relative to an internal reference using the comparative ΔΔCt method. Analytical Methods. C. glutamicum cell growth in the CGXII broth was estimated at OD600 using a UV−vis spectrophotometer (Mecasys Co., Ltd., Seoul, Korea). The dry cell weight of C. glutamicum was estimated on the basis of the correlation model OD600 1 = 0.278 g dry cell weight (DCW)/L (Figure S1). For measurements of intracellular L-cysteine and sulfide, sampling was performed in triplicate by centrifuging (16,600g at 4 °C for 15 min) the cell pellet from 1 mL of CGXII culture medium at 10 or 2.5 h intervals from 0 to 15 h. These pellets were disrupted using glass beads according to the methods described by Hwang and Cho.30 Usually, the L-cysteine concentration was determined using the colorimetric assay such as the O-phthaldialdehyde or ninhydrin response. However, these methods remain highly unstable and degrade easily. Furthermore, these methods measured simultaneously the L-cysteine concentration with nonreducing L-cystine involved in the interference phenomenon. In all experiments, L-cysteine was obtained by reducing L-cystine using 10 mM DTT according to the methods described by Wall.36 The concentration of amino acids was analyzed using a high-performance
galactoside (IPTG)-inducible expression plasmids containing various combinations of one, two, or three L-cysteine biosynthetic genes to determine their effect on enhancing Lcysteine production. We examined the effect of overexpressing the transcriptional regulator CysR on the activation of sulfur metabolism. Furthermore, this work investigated effects from the combinatorial overexpression of CysE, CysK, and/or CysR. In all recombinant strains, L-cysteine production increased compared to the control strain (empty pMT-tac vector). Moreover, the sulfide accumulation and sulfur uptake in strains that overexpress CysR increased compared to the control strain (empty pMT-tac vector). Overexpression of CysE, CysK, and CysR in the CysEKR recombinant strain increased intracellular sulfide accumulation and L-cysteine production in C. glutamicum during growth on glucose. Our results demonstrated the effective production of L-cysteine through CysR-mediated sulfide accumulation and the combinatorial overexpression of CysE, CysK, and CysR in C. glutamicum.
■
MATERIALS AND METHODS
Strains, Plasmids, Media, and Growth Conditions. All reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA). The E. coli DH5α strain was used for all recombinant DNA manipulation in this study. E. coli was grown overnight at 37 °C and 200 rpm on a rotary shaker in Luria−Bertani medium containing 50 μg/mL ampicillin. The plasmid pMT-tac was used as a C. glutamicum/E. coli shuttle vector for cloning and expression from the modified shuttle vector pMT1-s. Transformation of E. coli was performed by heat shock using the methods described by Froger and Hall.25 The wild-type C. glutamicum ATCC 13032 strain was used for the construction of recombinant strains and the experiment for L-cysteine production in this study. Unless otherwise stated, C. glutamicum wild-type and recombinant strains were grown overnight in brain−heart infusion medium containing 25 μg/mL kanamycin at 30 °C and 200 rpm on a rotary shaker for seed culture and preculture. Transformation of C. glutamicum was performed by electroporation as previously described.26 All bacterial strains and plasmids used in this work are listed in Table 1. The precultures were washed once with CGXII broth18 and transferred to CGXII broth at a starting OD600 of 0.7. The main culture used for fermentative production of L-cysteine was cultivated in 50 mL of CGXII broth containing 20 g/L glucose, 25 μg/mL kanamycin, and 1 mM IPTG in 500 mL baffled flasks. L-Cysteine was produced at 30 °C and 200 rpm on a rotary shaker. DNA Manipulations. A genomic DNA template was isolated using a genomic DNA purification kit (Promega, Madison, WI, USA) from C. glutamicum ATCC 13032. The genes encoding the serine acetyltransferase (cysE, cgl2563), cysteine synthase (cysK, cgl2562), and transcriptional regulator (cysR, cgl0121) were amplified by PCR with Taq DNA polymerase (Solgent, Daejeon, Korea) using genomic DNA (GenBank accession no. NC_003450.3) as the template. These PCR products were purified using a PCR purification kit (GeneAll, Seoul, Korea) and ligated using T4 DNA ligase (Enzynomics, Daejeon, Korea) into the BamHI and KpnI (Takara Bio, Otsu, Japan) restriction sites of the plasmid pMT-tac. The resulting plasmids were used for the transformation of E. coli or C. glutamicum strains. Plasmid DNA was extracted using the plasmid purification kit (GeneAll). DNA was quantified using a Nanodrop spectrophotometer (Thermo scientific, Wilmington, DE, USA). Plasmid DNA sequence analysis was performed at the Cosmogenetech facility (Cosmogenetech Co., Ltd., Seoul, Korea). Standard molecular biology techniques were performed using the methods described by Sambrook and Russell.27 Construction of Plasmids. All oligonucleotide primers used in this work are listed in Table 2. The C. glutamicum/E. coli shuttle vector pMT1-s28 was used and modified by replacing the P-out promoter and the sequence of the N-terminal signal peptide with the IPTG-induced tac promoter and the sequence of the lac operon mutant repressor protein LacIq for cytoplasmic gene expression from pFLAG-CTS 4701
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry
Figure 1. Schematic of the strategy for L-cysteine production in C. glutamicum during growth on glucose. (A) Metabolic pathway for L-cysteine biosynthesis in C. glutamicum. The dashed arrow from glucose, sulfonates, and sulfate indicates the involvement of multiple enzymatic steps in the pathway. The large solid arrow indicates the overexpression of CysE and CysK enzymes leading to the biosynthesis of L-cysteine from L-serine. The large solid arrow with a thin head indicates overexpression of the transcriptional regulator CysR controlling transcriptional activation of f pr2cysIXHDNYZ and ssuR gene clusters for utilization of sulfate, sulfonate, and sulfonate ester. (B) Regulatory mechanisms of transcriptional regulators CysR and SsuR in C. glutamicum. The large solid arrow indicates the positively regulated promoter of the f pr2-cysIXHDNYZ gene cluster and transcriptional regulator SsuR gene. The gray solid arrow indicates the positively regulated promoter of ssuI-seuABC-ssuD2 and ssuD1CBA gene clusters. The dashed arrow shows processing of regulatory mechanisms of transcriptional regulators CysR and SsuR. CysD, ATP-dependent sulfurylase; CysE, serine acetyltransferase; CysH, NADPH-dependent PAPS reductase; CysI, NADPH-dependent sulfite reductase; CysK, Oacetylserine sulfhydrylase; CysN, GTP-dependent sulfurylase; CysR, transcriptional regulator; SeuA, FMNH2-dependent alkanesulfonate monooxygenase; SsuD1/2, FMNH2-dependent aliphatic sulfonate monooxygenases; SsuR, transcriptional regulator; f pr2-cysIXHDNYZ, gene cluster of assimilatory sulfate reduction; ssuI-seuABC-ssuD2, gene cluster of sulfonate and sulfonate ester utilization; ssuD1CBA, gene cluster of sulfonate and sulfonate ester utilization. (C) Construction of expression vectors containing cysE, cysK, and/or cysR single-, double- or triple-gene combinations. The plasmid expression vectors containing cysE, cysK, and/or cysR genes were used to produce recombinant strains (see Table 1). AmpR, ampicillin antibiotic resistance gene; FLAG, octapeptide epitope tag; KanR, kanamycin antibiotic resistance gene; LacIq, mutant repressor protein of lac operon; MCS, multiple cloning sites; Omp, secretion signal peptide region of OmpA gene sequence (periplasmic localization); Ori, origin of replication; P-out, out promotor; P-tac, tac promotor (hybrid of E. coli trp and lac promoters); RBS, ribosomal binding site; rrnBT1T2, transcriptional terminator T1 and T2 region of E. coli rrnB gene; Sig-seq, secretion signal peptide region of C. glutamicum cg0955 gene. liquid chromatography (HPLC) system (Binary HPLC pump model 1528, autosampler model 2707, Waters, Milford, MA, USA) using a Waters AccQ-Tag Amino Acid Analysis System,37 a dual λ absorbance
detector (model 2487, Waters)m and a Supelcosil LC-18-DB HPLC column (5 μm particle size, L × i.d., 25 cm × 4.6 mm, Sigma-Aldrich). Sulfate concentrations were determined using the turbidimetric assay. 4702
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry Table 3. Parameters of the CysE or CysK Crude Enzyme Extract from C. glutamicum strain pMT-tac CysE CysE CysE pMT-tac CysK
L-serine
(mM)
O-acetyl L-serine (mM)
L-cysteine
(mM)
Ki (mM)
b
1 1b 0−1c 0−1c
0.2c 1 1
specific activitya (U/mg)
fold
7.7 ± 0.2 54.4 ± 0.1
1.0 7.1
56.4 ± 0.7 437.1 ± 0.8
1.0 7.8
17.1 ± 0.2d
a All data represent means from three independent experiments performed in triplicate and ± indicates standard deviation from the mean. bThe enzyme assays were performed in the presence of substrate. cThe inhibition parameters were performed in the presence of L-serine without or with Lcysteine. dThe competitive inhibition constant (Ki) calculated from the Lineweaver−Burk plot shown in Figure S2.
Sulfide concentrations were determined using the methylene blue assay.38
the CysK enzymes lead to the biosynthesis of L-cysteine from Lserine. Therefore, the two key enzymes are successfully expressed using the modified shuttle expression vector pMTtac by all C. glutamicum recombinant strains. Interestingly, we demonstrated that the relative mRNA levels of all genes belonging to the three sulfur metabolism operons were also more significantly up-regulated in the transcriptional regulator CysR-overexpressing strains than the control strain (empty pMT-tac vector) (Figure 2). These results indicate that
■
RESULTS AND DISCUSSION Strategy for the Enhancement of L-Cysteine Production in C. glutamicum during Growth on Glucose. C. glutamicum has been widely used for the industrial production of amino acids such as L-glutamate and L-lysine, but not cysteine.39,40 The activity of CysE and CysK enzymes that are involved in L-cysteine biosynthesis in C. glutamicum have been well characterized.32,33 However, the role of these enzymes in the L-cysteine biosynthetic pathway had not been investigated in vivo. Furthermore, the transcriptional regulator CysR is involved in the control of genes in the sulfate, sulfonate, and sulfonate ester pathways for their utilization as sulfur sources,20,24 but the role of the transcriptional regulator CysR in the control of sulfur metabolism for L-cysteine biosynthesis is unclear. Therefore, experiments were needed to clarify the contribution of the two L-cysteine biosynthetic enzymes and the transcriptional regulator CysR to the overproduction of L-cysteine. In this study, strategies for engineering C. glutamicum for the enhancement of L-cysteine production were designed to increase sulfur accumulation and overcome metabolic bottlenecks (Figure 1). The first strategy focused on the overexpression of the two L-cysteine biosynthetic enzymes, CysE and CysK, for the synthesis of L-cysteine from glucose-derived L-serine and intracellular sulfide (Figure 1A). The second strategy focused on the assimilatory reduction of sulfur by the CysR-mediated transcriptional activation of three operons (Figure 1B). The third strategy focused on the combined overexpression of CysE, CysK, and CysR to improve L-cysteine production (Figure 1A). Associative Effects of cysE, cysK, or cysR Gene Expression on L-Cysteine Precursor Biosynthesis and Sulfur Metabolism. The cysE, cysK, or cysR gene involved in L-cysteine biosynthesis and sulfur metabolism were previously identified in C. glutamicum.20−24,32,33 However, as in previous studies, the impact of CysR on the actual transcriptional control in the sulfur assimilatory reduction of the three operons was not demonstrated in L-cysteine production with CysE and CysK. CysE enzyme activity is feedback-inhibited by L-cysteine (Table 3 and Figure S2). Nevertheless, the results presented in Table 3 show that the specific activity of the two key enzymes, CysE and CysK, was 7.1- and 7.8-fold higher than the enzymes of the C. glutamicum control strain with the pMT-tac expression vector under the control of the tac promoters, respectively. These findings indicate that the CysE enzymes lead to the biosynthesis of O-acetyl L-serine from L-serine. Furthermore,
Figure 2. Relative mRNA levels of genes belonging to three sulfur metabolism operons in C. glutamicum control strain and CysR recombinant strains. Cells were incubated in 500 mL baffled flasks in CGXII medium with 20 g/L glucose and 25 μg/mL kanamycin for 10 h at 30 °C and 200 rpm. The mRNA expression of genes belonging to three sulfur metabolism operons was quantified by real-time RT-PCR. Relative mRNA levels were always normalized using 16S rRNA level as an internal reference. The open bar indicates relative mRNA levels of genes in C. glutamicum control strain (empty pMT-tac vector), and solid bar indicates relative mRNA levels of genes in CysR recombinant strains. Data represent the means from three independent experiments performed in triplicate, and the error bars are the standard deviations of the means.
CysR affects the expression of f pr2-cysIXHDNYZ (assimilatory sulfate assimilatory reduction cluster, Gene ID 21325585− 21325591), ssuR (transcriptional regulator, Gene ID 21322774), ssuI-seuABC-ssuD2 and ssuD1CBA (sulfonate and sulfonate ester assimilatory reduction cluster, Gene ID 21323778−21323785 and 21323987−21323990, respectively) genes. Accordingly, CysR-mediated transcriptional activation can be up-regulated and can easily express many genes simultaneously in the three operons associated with the assimilatory reduction of sulfur sources. Investigation of L-Cysteine Production Levels in the CysE, CysK, or CysR Recombinant C. glutamicum Strains. The CysE, CysK, and CysR genes were previously reported to be a serine acetyltransferase (Gene ID 1020509), O-acetylserine sulfhydrylase (Gene ID 1020508), and transcriptional regulator (Gene ID 1021152) from C. glutamicum ATCC 13032 (GenBank accession no. NC_003450.3), respectively.18−22,30,31 31 The two key enzymes and the transcriptional regulator were individually cloned and expressed in C. glutamicum with the 4703
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry pMT-tac expression vector under the control of the trp and lac promoters derived from the functional hybrid tac promoter41,42 (Figure 1C). The C. glutamicum control strain (empty pMT-tac vector) and the recombinant strains overexpressing single genes were incubated for 10 h. Following the fermentation, the intracellular L-cysteine concentration was measured by HPLC to determine the effects of overexpressing the cysE, cysK, or cysR genes individually. As shown in Figure 3, L-cysteine levels in the
with many genes (Figure 1B). Because of this, pathway manipulation using genetic engineering or metabolic engineering is not easy. Previously, analysis of mRNA levels using realtime RT-PCR indicated that the transcriptional regulator CysR induced the expression of the f pr2-cysIXHDNYZ and ssuR genes in C. glutamicum. In particular, the transcriptional regulator SsuR involved the unusual regulation of ssuIseuABC-ssuD2 and ssuD1CBA genes in C. glutamicum20−22,24 (Figure 1A). These results indicated that CysR-mediated multitranscriptional activation is an efficient strategy for easily expressing many genes simultaneously in the three operons associated with the assimilatory reduction of organic and inorganic sulfur sources. Improvement of Sulfide Accumulation by Up-regulation of CysR-Mediated Sulfur Metabolism. CysRdependent transcriptional regulation of sulfur metabolism is well-known in C. glutamicum20,23,24 but has not yet been studied for the actual control of sulfur metabolism during Lcysteine production. As depicted in Figure 3, the overexpression of the cysR gene improved L-cysteine production compared to the C. glutamicum control strain (empty pMT-tac vector). The effect of overexpressing the transcriptional regulator CysR on intracellular sulfide accumulation was evaluated using a methylene blue assay. After 10 h of incubation, the CysR recombinant strain accumulated 332.3 μmol/g DCW of intracellular sulfide, whereas the control strain (empty pMT-tac vector) accumulated 121.3 μmol/g DCW of intracellular sulfide (Table 4).
Figure 3. Effect of individually overexpressing either cysE, cysK, or cysR gene on L-cysteine production. The recombinant strains overexpressing single genes were incubated in 500 mL baffled flasks in CGXII medium with 20 g/L glucose and 25 μg/mL kanamycin for 10 h at 30 °C and 200 rpm. The intracellular L-cysteine concentration in recombinant strains was measured by HPLC. Data represent the means from three independent experiments performed in triplicate, and the error bars are the standard deviations of the means.
Table 4. Effects of Transcriptional Regulator CysR on Sulfide Accumulation in C. glutamicuma strain
sulfideb (μmol/L)
dry cell wtc (g DCW/L)
intracellular sulfide content (μmol/g DCW)
fold
pMT-tac CysR
410 ± 26 1090 ± 55
3.38 ± 0.1 3.28 ± 0.0
121.3 ± 4.0 332.3 ± 16.8
1.0 2.7
a
Data represent means from three independent experiments performed in triplicate and ± indicates standard deviation from the mean. bSulfide was measured in cells harvested at 10 h. cDCW was estimated on the basis of the correlation OD600 1 = 0.278 g DCW/L.
control strain (empty pMT-tac vector) and recombinant strains overexpressing a single L-cysteine biosynthetic gene were highest in the CysK (17.9 mg/L) overexpressing strain, followed by the CysE strain (16.1 mg/L) and the CysR strain (15.9 mg/L), and were lowest in the control strain (12.9 mg/ L). The L-cysteine concentration in the CysE, CysK, or CysR recombinant strains was 1.24-, 1.39-, or 1.22-fold higher than that in the control strain (empty pMT-tac vector), respectively (Figure 3). These results indicated that the overexpression of a single gene had a positive effect on L-cysteine production. Several previous studies have reported the successful characterization of enzyme activity and the molecular mass of purified CysE and CysK, key enzymes in the L-cysteine biosynthesis pathway from C. glutamicum.32,33 The specific activity and molecular mass of CysE from C. glutamicum were approximately 0.046 U/mg and 21.7 kDa, respectively.32 The specific activity and the molecular mass for CysK from C. glutamicum were 291 U/mg and approximately 34.5 kDa, respectively.33 Moreover, it was suggested that C. glutamicum synthesized L-cysteine from L-serine via O-acetyl serine through a pathway involving CysE and CysK, as in E. coli.32 In this study, well-characterized CysE and CysK enzymes were overexpressed in a metabolically engineered recombinant C. glutamicum for L-cysteine production. L-Cysteine production requires not only serine as an intermediate but also a sufficient supply of sulfur. However, sulfur metabolism in C. glutamicum is significantly associated
Consequently, the intracellular sulfide accumulation in the CysR recombinant strain was 2.7-fold higher than in the control strain (empty pMT-tac vector) (Table 4). There was no significant difference in cell growth for the control strain (empty pMT-tac vector) and the CysR recombinant strain. Interestingly, there was increased velocity of the assimilatory reduction through the overexpression of the transcriptional regulator CysR compared with the control strain (empty pMTtac vector) (Figure S4AB). Moreover, after 15 h, the conversion of sulfate to sulfide occurred with molar yields of 29.0% (Figure S4A) and 77.4% (Figure S4B) in the control strain and CysRoverexpressing strain, respectively. As a result, the CysRoverexpressing strain increased approximately 2.6-fold more the assimilatory reduction of sulfur source than the control strain (Figure S4AB). Previous work in C. glutamicum ATCC 13032 showed significant differential expression patterns between CR031 (mcbR ΔHTH ssuR ΔHTH cysR const ) and CR032 (mcbR ΔHTH ssuR ΔHTH cysRΔHTH). A microarray analysis of CR031 (constitutively expressing CysR) indicated that mRNA levels of many sulfur metabolism-related genes were increased compared to CR032 (cysRΔHTH recombinant).20 Although 4704
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry only the effects of CysR on the transcription of sulfur metabolism genes in C. glutamicum were described, the work provided an important basis for the study of L-cysteine biosynthesis. On the basis of this prior work, we developed CysR overexpressing strains that successfully induced sulfur metabolism and intracellular sulfide accumulation by direct upregulation of the CysR gene alone, without the need for the complicated construction of a multigene overexpression vector. Combinatorial Overexpression of CysE, CysK, and/or CysR for Increased L-Cysteine Production. The effect of cysE, cysK, or cysR genes on the production of L-cysteine was investigated by overexpressing each gene individually in C. glutamicum. However, to substantially increase L-cysteine production, it was necessary to improve levels of both the serine intermediate precursor and the supply of sulfide through the combinatorial overexpression of cysE, cysK, and/or cysR genes. Figure 1C depicts the double- and triple-gene overexpression plasmids constructed in this study. To further increase L-cysteine production, we attempted to overexpress combinations of CysE, CysK, and/or CysR. Using the same methods described above, a control strain (empty pMT-tac vector) and recombinant strains overexpressing two or three genes were fermented, and their L-cysteine content was measured. The combinatorial overexpression of cysE, cysK, and/ or cysR genes produced L-cysteine levels that were highest in the CysEKR recombinant strain (26.3 mg/L), followed by the CysKR strain (21.1 mg/L), the CysEK strain (21.0 mg/L), the CysER strain (18.3 mg/L), and the control strain (empty pMTtac vector, 13.0 mg/L). The L-cysteine concentrations of the CysEK, CysER, CysKR, or CysEKR recombinant strains were 1.62-, 1.41-, 1.63-, or 2.03-fold higher than control strain (empty pMT-tac vector), respectively (Figure 4). The results presented in Figures 3 and 5 show that all recombinant strains overexpressing the cysK gene had higher L-cysteine concentration than other strains. These findings indicate that CysK is a
Figure 5. L-Cysteine production in C. glutamicum control strain and CysEKR recombinant strains during growth on glucose. (A) Cell growth and (B) L-cysteine production. C. glutamicum control strain (empty pMT-tac vector) (open circle) and CysEKR recombinant strains (solid circle) were incubated in 500 mL baffled flasks in CGXII medium with 20 g/L glucose containing 25 μg/mL kanamycin at 30 °C and 200 rpm. Sampling was performed at 2 h and 30 min intervals. Cell growth was estimated at OD600 using a UV−vis spectrophotometer. DCW was estimated using a calibration curve (OD600 1 = 0.278 g DCW/L). Intracellular L-cysteine concentration in individual recombinant strains was measured by HPLC. Data represent the means from three independent experiments performed in triplicate, and error bars are the standard deviations of the means.
critical enzyme in the final step of L-cysteine production and is essential for the conversion of the L-serine intermediate precursor and a sulfide source into L-cysteine in C. glutamicum. In the case of recombinant strains overexpressing two genes, the CysEK, CysER, and CysKR recombinant strains had higher L-cysteine production than the control strain (empty pMT-tac vector) and the recombinant strains overexpressing the genes individually (Figures 3 and 4). However, the level of L-cysteine in the CysER recombinant strain was not considerably higher
Figure 4. Effects of combinatorial overexpression of cysE, cysK, and/or cysR (cysEK, cysER, cysKR, and cysEKR) on L-cysteine production. Recombinant strains overexpressing multiple genes were incubated in 500 mL baffled flasks in CGXII medium with 20 g/L glucose containing 25 μg/mL kanamycin for 10 h at 30 °C and 200 rpm. Intracellular L-cysteine concentration in individual recombinant strains was measured by HPLC. Data represent the means from three independent experiments performed in triplicate, and error bars are the standard deviations of the means. 4705
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry
levels of L-cysteine production by solving these problems in GRAS status C. glutamicum for animal sulfur-supplemented diets. These studies suggested potential production strategies for sulfur-containing amino acid for agriculture, animal feed, and food additives in GRAS status microorganisms from nonhuman and nonanimal materials.
than the CysEK and CysKR recombinant strains (Figure 4). These results indicated that simultaneously, without overexpression of the cysK gene, the overexpression of cysE and cysR genes produced a metabolic bottleneck upstream in the Lcysteine biosynthetic pathway. Several similar studies have used the combinatorial overexpression of enzymes in a pathway to solve this problem and reported improved product levels and increased metabolic flux.43−48 More importantly, the two key enzymes, CysE and CysK, represent rate-limiting steps in Lcysteine biosynthesis.3,49 To overcome this metabolic bottleneck, the rate-limiting CysE and CysK enzymes were overexpressed with the transcriptional regulator CysR in C. glutamicum. Compared to the results for strains overexpressing one or two genes, the CysEKR recombinant strain produced the highest L-cysteine concentration, increasing by approximately 2.0-fold in C. glutamicum. We suggest that the CysEKR recombinant strain had significantly improved Lcysteine production due to the combinatorial overexpression of three genes that increased metabolic flux toward L-cysteine and the accumulation of sulfur, thereby eliminating the metabolic bottleneck. Comparing L-Cysteine Production Levels between the C. glutamicum Control Strain and CysEKR Recombinant Strain during Growth on Glucose. To improve L-cysteine production, we first attempted to investigate the effects of CysR-mediated sulfide accumulation and increased L-cysteine production using a metabolically engineered C. glutamicum in which combinations of the cysE, cysK, and cysR genes were overexpressed. Cell growth was monitored over 15 h of fermentation by measuring OD600 with a UV−vis spectrophotometer. There was no significant difference between the cell growth rates of the C. glutamicum control strain (empty pMTtac vector) and the CysEKR recombinant strain during the fermentation period (Figure 5A). Notably, the C. glutamicum control strain (empty pMT-tac vector) produced approximately 20.4 mg/L of L-cysteine, whereas the CysEKR recombinant strain produced approximately 60.5 mg/L of L-cysteine (Figure 5B). Furthermore, the amount of L-cysteine in the cysEKRoverexpressing strain was approximately 3.0-fold higher than that in the control strain (empty pMT-tac vector) (Figure 5B). These results suggested that the CysEKR recombinant strain could efficiently produce L-cysteine by increasing CysRmediated sulfur uptake and metabolic flux. A previous study reported that the C. glutamicum ATCC 13032 control strain (empty pVK7 vector) and a recombinant strain overexpressing the cysE gene from E. coli (pVK7-CE vector) produced less than approximately 30 mg/L L-cysteine in 20 mL of C2 medium with 100 g/L glucose and 50 μg/mL kanamycin in a 500 mL flask over 72 h of fermentation. The C. glutamicum IR33 recombinant strain (aecD gene-disrupted, pVK-CEM256I vector) produced approximately 290 mg/L of 1 L-cysteine under the same conditions. However, our study and previous studies did not reach the high level of L-cysteine production required for commercial applications. This may be due to the degradation of L-cysteine products, feedback inhibition of the CysE enzyme by L-cysteine, an inadequate Lserine level, or the toxicity of L-cysteine at elevated concentrations in C. glutamicum. The inadequate L-serine and L-cysteine levels can be overcome by the use of an L-serineproducing strain and the total L-cysteine extraction method (Table S1 and Figure S3). Furthermore, the resulting CysEKR recombinant strain can be used in L-methionine production (Table S1). In future studies, our focus will be to obtain higher
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b01061. Calibration curve of dry cell weight, Lineweaver−Burk inhibition plot of CysE, total L-cysteine concentration, sulfate consumption, sulfide accumulation, and additional main amino acids data (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*(S.O.H.) Phone: +82-2-3290-3151. Fax: +82-2-3290-3151. Email:
[email protected]. ORCID
Sung Ok Han: 0000-0002-2400-2882 Funding
This research was supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIP) (NRF-2014R1A2A1A11049949) and supported by a Korea University Grant. Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Wada, M.; Awano, N.; Haisa, K.; Takagi, H.; Nakamori, S. Purification, characterization and identification of cysteine desulfhydrase of Corynebacterium glutamicum, and its relationship to cysteine production. FEMS Microbiol. Lett. 2002, 217, 103−107. (2) Berehoiu, R. M. T.; Popa, C. N.; Popescu, S. Assessment of the E 920 additive (L-cysteine) in relation to some problems of modern food industry. Sci. Papers Ser., Manage., Econ. Eng. Agric. Rural Dev. 2013, 13, 413−418. (3) Wada, M.; Takagi, H. Metabolic pathways and biotechnological production of L-cysteine. Appl. Microbiol. Biotechnol. 2006, 73, 48−54. (4) Soda, K. Microbial sulfur amino acids − an overview. Methods Enzymol. 1987, 143, 453−459. (5) Ismail, N. I.; Hashim, Y. Z. H. Y.; Jamal, P.; Othman, R.; Salleh, H. M. Production of cysteine: approaches, challenges and potential solution. Int. J. Biotechnol. Wellness Ind. 2014, 3, 95−101. (6) D’Mello, J. P. F. Amino Acids in Animal Nutrition; CABI Publishing: Willingford, Oxon, UK, 2003. (7) Gillis, A. M.; Reijmers, A.; Pluske, J. R.; de Lange, C. F. M. Influence of dietary methionine to methionine plus cysteine ratios on nitrogen retention in gilts fed purified diets between 40 and 80 kg live body weight. Can. Vet. J. 2007, 87, 87−92. (8) Leuchtenberger, W.; Huthmacher, K.; Drauz, K. Biotechnological production of amino acids and derivatives: current status and prospects. Appl. Microbiol. Biotechnol. 2005, 69, 1−8. (9) Ali, N. M.; Shakoori, F. R.; Shakoori, A. R. Improvement in cysteine production by local bacterial isolates. Pak. J. Zool. 2011, 43, 805−808. (10) Piste, P. Cysteine−master antioxidant. Int. J. Pharm., Chem. Biol. Sci. 2013, 3, 143−149. (11) Ikeda, M. Amino acid production processes. Adv. Biochem. Eng./ Biotechnol. 2003, 79, 1−35. 4706
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
Article
Journal of Agricultural and Food Chemistry (12) Maier, T. H. P. Semisynthetic production of unnatural L-αamino acids by metabolic engineering of the cysteine-biosynthetic pathway. Nat. Biotechnol. 2003, 21, 422−427. (13) Nakatani, T.; Ohtsu, I.; Nonaka, G.; Wiriyathanawudhiwong, N.; Morigasaki, S.; Takagi, H. Enhancement of thioredoxin/glutaredoxinmediated L-cysteine synthesis from S-sulfocysteine increases L-cysteine production in Escherichia coli. Microb. Cell Fact. 2012, 11, 62. (14) Barton, L. L. Metabolism of nitrogen and sulfur. In Structural and Functional Relationships in Prokaryotes; Barton, L. L., Ed.; Springer: New York, 2005; pp 680−720. (15) Wei, J.; Liu, C.; Leyh, T. S. The role of enzyme isomerization in the native catalytic cycle of the ATP sulfurylase-GTPase system. Biochemistry 2000, 39, 4704−4710. (16) Liu, C.; Suo, Y.; Leyh, T. S. The energetic linkage of GTP hydrolysis and the synthesis of activated sulfate. Biochemistry 1994, 33, 7309−7314. (17) Gigras, P.; Sahai, V.; Gupta, R. Statistical media optimization and production of ITS alpha-amylase from Aspergillus oryzae in a bioreactor. Curr. Microbiol. 2002, 45, 203−208. (18) Eggeling, L.; Bott, M. Handbook of Corynebacterium glutamicum; CRC Press: Boca Raton, FL, USA, 2005. (19) Litsanov, B.; Brocker, M.; Bott, M. Toward homosuccinate fermentation: metabolic engineering of Corynebacterium glutamicum for anaerobic production of succinate from glucose and formate. Appl. Environ. Microbiol. 2012, 78, 3325−3337. (20) Rückert, C.; Milse, J.; Albersmeier, A.; Koch, D. J.; Pühler, A.; Kalinowski, J. The dual transcriptional regulator CysR in Corynebacterium glutamicum ATCC 13032 controls a subset of genes of the McbR regulon in response to the availability of sulphide acceptor molecules. BMC Genomics 2008, 9, 483. (21) Koch, D. J.; Rückert, C.; Albersmeier, A.; Hüser, A. T.; Tauch, A.; Pühler, A.; Kalinowski, J. The transcriptional regulator SsuR activates expression of the Corynebacterium glutamicum sulphonate utilization genes in the absence of sulphate. Mol. Microbiol. 2005, 58, 480−494. (22) Koch, D. J.; Rückert, C.; Rey, D. A.; Mix, A.; Pühler, A.; Kalinowski, J. Role of the ssu and seu genes of Corynebacterium glutamicum ATCC 13032 in utilization of sulfonates and sulfonate esters as sulfur sources. Appl. Environ. Microbiol. 2005, 71, 6104−6114. (23) Lee, D. S.; Park, J. S.; Kim, Y.; Lee, H. S. Corynebacterium glutamicum sdhA encoding succinate dehydrogenase subunit A plays a role in cysR-mediated sulfur metabolism. Appl. Microbiol. Biotechnol. 2014, 98, 6751−6759. (24) Rückert, C.; Koch, D. J.; Rey, D. A.; Albersmeier, A.; Mormann, S.; Pühler, A.; Kalinowski, J. Functional genomics and expression analysis of the Corynebacterium glutamicum f pr2-cysIXHDNYZ gene cluster involved in assimilatory sulphate reduction. BMC Genomics 2005, 6, 121. (25) Froger, A.; Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. 2007, 253. (26) van der Rest, M. E.; Lange, C.; Molenaar, D. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biotechnol. 1999, 52, 541−545. (27) Sambrook, J.; Russell, D. W. The Condensed Protocols from Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2006. (28) Hyeon, J. E.; Jeon, W. J.; Whang, S. Y.; Han, S. O. Production of minicellulosomes for the enhanced hydrolysis of cellulosic substrates by recombinant Corynebacterium glutamicum. Enzyme Microb. Technol. 2011, 48, 371−377. (29) Bryksin, A.; Matsumura, I. Overlap extension PCR cloning. Methods Mol. Biol. 2013, 1073, 31−42. (30) Hwang, G. H.; Cho, J. Y. Identification of a suppressor gene for the arginine-auxotrophic argJ mutation in Corynebacterium glutamicum. J. Ind. Microbiol. Biotechnol. 2010, 37, 1131−1136. (31) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254.
(32) Haitani, Y.; Awano, N.; Yamazaki, M.; Wada, M.; Nakamori, S.; Takagi, H. Functional analysis of L-serine O-acetyltransferase from Corynebacterium glutamicum. FEMS Microbiol. Lett. 2006, 255, 156− 163. (33) Wada, M.; Awano, N.; Yamazawa, H.; Takagi, H.; Nakamori, S. Purification and characterization of O-acetylserine sulfhydrylase of Corynebacterium glutamicum. Biosci., Biotechnol., Biochem. 2004, 68, 1581−1583. (34) Hüser, A. T.; Becker, A.; Brune, I.; Dondrup, M.; Kalinowski, J.; Plassmeier, J.; Pühler, A.; Wiegräbe, I.; Tauch, A. Development of a Corynebacterium glutamicum DNA microarray and validation by genome-wide expression profiling during growth with propionate as carbon source. J. Biotechnol. 2003, 106, 269−286. (35) Kim, H. I.; Kim, J. H.; Park, Y. J. Transcriptome and gene ontology (GO) enrichment analysis reveals genes involved in biotin metabolism that affect L-lysine production in Corynebacterium glutamicum. Int. J. Mol. Sci. 2016, 17, 353. (36) Wall, J. S. Disulfide bonds: determination, location, and influence on molecular properties of proteins. J. Agric. Food Chem. 1971, 19, 619−625. (37) Waters AccQ-Tag Amino Acid Analysis System, Operator’s Manual; Manual 154-02TP REV O June; Waters, Milford, MA, USA, 1993. (38) Libardi, S. H.; Pindstrup, H.; Cardoso, D. R.; Skibsted, L. H. Reduction of ferrylmyoglobin by hydrogen sulfide. Kinetics in relation to meat greening. J. Agric. Food Chem. 2013, 61, 2883−2888. (39) Kovaleva, G. Y.; Gelfand, M. S. Regulation of methionine/ cysteine biosynthesis in Corynebacterium glutamicum and related organisms. Mol. Biol. 2007, 41, 126−136. (40) Nishio, Y.; Nakamura, Y.; Usuda, Y.; Sugimoto, S.; Matsui, K.; Kawarabayasi, Y.; Kikuchi, H.; Gojobori, T.; Ikeo, K. Evolutionary process of amino acid biosynthesis in Corynebacterium at the whole genome level. Mol. Biol. Evol. 2004, 21, 1683−1691. (41) de Boer, H. A.; Comstock, L. J.; Vasser, M. The tac promoter: a functional hybrid derived from the trp and lac promoters. Proc. Natl. Acad. Sci. U. S. A. 1983, 80, 21−25. (42) Eikmanns, B. J.; Kleinertz, E.; Liebl, W.; Sahm, H. A family of Corynebacterium glutamicum/Escherichia coli shuttle vectors for cloning, controlled gene expression, and promoter probing. Gene 1991, 102, 93−98. (43) Latimer, L. N.; Lee, M. E.; Medina-Cleghorn, D.; Kohnz, R. A.; Nomura, D. K.; Dueber, J. E. Employing a combinatorial expression approach to characterize xylose utilization in Saccharomyces cerevisiae. Metab. Eng. 2014, 25, 20−29. (44) Zhang, J.; Kang, Z.; Chen, J.; Du, G. Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli. Sci. Rep. 2015, 5, 8584. (45) Zhang, H.; Pereira, B.; Li, Z.; Stephanopoulos, G. Engineering Escherichia coli coculture systems for the production of biochemical products. Proc. Natl. Acad. Sci. U. S. A. 2015, 112, 8266−8271. (46) Xu, P.; Gu, Q.; Wang, W.; Wong, L.; Bower, A. G.; Collins, C. H.; Koffas, M. A. Modular optimization of multi-gene pathways for fatty acids production in E. coli. Nat. Commun. 2013, 4, 1409. (47) Xu, P.; Li, L.; Zhang, F.; Stephanopoulos, G.; Koffas, M. Improving fatty acids production by engineering dynamic pathway regulation and metabolic control. Proc. Natl. Acad. Sci. U. S. A. 2014, 111, 11299−11304. (48) Yu, A. Q.; Juwono, N. K. P.; Foo, J. L.; Leong, S. S.; Chang, M. W. Metabolic engineering of Saccharomyces cerevisiae for the overproduction of short branched-chain fatty acids. Metab. Eng. 2016, 34, 36−43. (49) Tantaleán, J. C.; Araya, M. A.; Saavedra, C. P.; Fuentes, D. E.; Pérez, J. M.; Calderón, I. L.; Youderian, P.; Vásquez, C. C. The Geobacillus stearothermophilus V iscS gene, encoding cysteine desulfurase, confers resistance to potassium tellurite in Escherichia coli K-12. J. Bacteriol. 2003, 185, 5831−5837.
4707
DOI: 10.1021/acs.jafc.7b01061 J. Agric. Food Chem. 2017, 65, 4698−4707
