Cu+ Binding

Article pubs.acs.org/biochemistry

Structural and Functional Investigation of the Ag+/Cu+ Binding Domains of the Periplasmic Adaptor Protein SilB from Cupriavidus metallidurans CH34 Patricia Urbina,† Beate Bersch,‡ Fabien De Angelis,† Kheiro-Mouna Derfoufi,† Martine Prévost,† Erik Goormaghtigh,† and Guy Vandenbussche*,† †

Laboratory for the Structure and Function of Biological Membranes, Center for Structural Biology and Bioinformatics, Université Libre de Bruxelles, B-1050 Bruxelles, Belgium ‡ Institut de Biologie Structurale (IBS), Univ. Grenoble Alpes, CEA, CNRS, 38044 Grenoble, France S Supporting Information *

ABSTRACT: Silver ion resistance in bacteria mainly relies on efflux systems, and notably on tripartite efflux complexes involving a transporter from the resistance−nodulation−cell division (RND) superfamily, such as the SilCBA system from Cupriavidus metallidurans CH34. The periplasmic adaptor protein SilB hosts two specific metal coordination sites, located in the N-terminal and C-terminal domains, respectively, that are believed to play a different role in the efflux mechanism and the trafficking of metal ions from the periplasm to the RND transporter. On the basis of the known domain structure of periplasmic adaptor proteins, we designed different protein constructs derived from SilB domains with either one or two metal binding sites per protein chain. ITC data acquired on proteins with single metal sites suggest a slightly higher affinity of Ag+ for the N-terminal metal site, compared to that for the C-terminal one. Remarkably, via the study of a protein construct featuring both metal sites, nuclear magnetic resonance (NMR) and fluorescence spectroscopies concordantly show that the C-terminal site is saturated prior to the N-terminal one. The C-terminal binding site is supposed to transfer the metal ions to the RND protein, while the transport driven by this latter is activated upon binding of the metal ion to the N-terminal site. Our results suggest that the filling of the C-terminal metal site is a key prerequisite for preventing futile activation of the transport system. Exhaustive NMR studies reveal for the first time the structure and dynamics of the functionally important N-terminal domain connected to the membrane proximal domain as well as of its Ag+ binding site.

T

The latter, more often termed periplasmic adaptor protein (PAP),9 belongs to the membrane fusion protein (MFP) family.10 The assembly of these three proteins provides a continuous channel through the bacterial envelope, catalyzing the energy-dependent efflux of the noxious compounds from the cell to the extracellular medium. PAPs function in bacteria in conjunction not only with RND proteins but also with other transporters from the ATP binding cassette (ABC) superfamily or the major facilitator superfamily (MFS).10 A passive role for the linker between the RND and OMF components was initially proposed for the PAPs. It appears now that the PAPs play an active role in the assembly of the tripartite complex and in the transport of substrates.9 By interacting with the RND and OMF proteins, the PAPs participate in the recruitment of the OMF component and stabilize the tripartite efflux complex.11 They also contribute to the open state stabilization of the OMF component12−14 and

he antimicrobial properties of silver have largely been exploited over the centuries. To counteract the toxic effect of silver, Gram-negative bacteria have developed different resistance mechanisms, including the efficient efflux of the metal ions out of the cell. This transport involves a P-type ATPase and/or a tripartite efflux system driven by a cation/ proton antiporter from the resistance−nodulation−cell division (RND) superfamily.1 The first identified tripartite efflux system involved in silver resistance, SilCBA, was found in a silver and antibiotic resistant Salmonella enterica serovar Typhimurium strain isolated from a hospital burn unit.2 This pathogenic resistant strain caused a septicemia that led to the death of three patients and the closure of the burn ward.3 Systems orthologous to SilCBA were detected in the genome of other bacteria and studied in more detail in Escherichia coli (CusCFBA) and Cupriavidus metallidurans CH34 (SilCBA and CusCBA).4−6 These tripartite efflux complexes are canonically formed by the association of an RND inner membrane transporter (the “A” protein), an outer membrane protein from the outer membrane factor (OMF) family (the “C” protein), and a periplasmic protein (the “B” protein).7,8 © XXXX American Chemical Society

Received: January 11, 2016 Revised: April 22, 2016

A

DOI: 10.1021/acs.biochem.6b00022 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry favor substrate transport by the RND.15−17 Some PAPs were reported to bind the substrate transported by the tripartite complex such as HlyD from a type 1 secretion system,18 and more particularly CusB from E. coli and ZneB from C. metallidurans CH34, two adaptors involved in HME−RNDdriven systems (where HME stands for heavy metal efflux).19,20 Both CusB and ZneB undergo significant conformational changes upon metal ion binding that were thought to be important for the activation of the transport system.19−21 The CusCFBA efflux system from E. coli involves a fourth protein, CusF, a small periplasmic metallochaperone that can transfer Ag+/Cu+ ions to CusB, and reciprocally.22 It has recently been demonstrated that the metal-bound form of CusB is required to activate the opening of CusA to the periplasm, allowing CusF to dock and release the metal ion to the RND transporter binding site.23 CusB contains a single metal binding site in an N-terminal stretch that includes three conserved methionine residues (M21, M36, and M38).19 This N-terminal extension or domain is specific to PAPs involved in the transport of monovalent Cu+ and Ag+ ions. The transient CusB−CusF interaction proceeds via regions close to their respective metal binding domains only in the presence of the metal ions.24 While the three-dimensional structure of CusF has been determined,25 no high-resolution structure of the CusB Nterminal domain has been obtained so far as this region was not identified in the electron density maps of CusB crystals.26 Extensive molecular dynamics simulations revealed structural disorder in this CusB N-terminal domain with a local ordering around the coordination site upon metal ion binding.27 The periplasmic adaptor proteins adopt an elongated shape composed of up to four domains: the membrane proximal (MP) domain, the β-barrel domain, the lipoyl domain, and the α-helical domain.9 These characteristic domains are not shared by all the PAPs, some of them comprising only three domains28,29 and others having additional domains. This is the case for SilB and CusB, the periplasmic components from the SilCBA and CusCBA systems, respectively, involved in the resistance to copper and silver in C. metallidurans CH34. Besides the additional N-terminal domain hosting the metal site formed by the three conserved methionine residues, SilB and CusB contain another domain at the C-terminus.8 We previously demonstrated that this additional C-terminal domain in SilB shares with the metallochaperone CusF from E. coli similar structure and Ag+/Cu+ binding properties.30 As a result, SilB and its orthologues contain two Ag+/Cu+ coordination sites located at the N- and C-termini, respectively. To improve our understanding of the role of these two metal binding sites, we designed different SilB protein constructs containing one or two metal ion coordination sites. A chronological order of metal binding events on the two sites is proposed from monitoring the respective Ag+ binding sites using different methodological approaches. More importantly, we determined for the first time the NMR solution structure and dynamics of the N-terminal domain and of its metal binding site.

highest degree of sequence identity (∼38% within the 378amino acid residue overlap with SilB). Four three-dimensional (3D) structural models of the membrane proximal domain containing a Gly-Ser loop designed to bypass the β-barrel, lipoyl, and α-helical domains inserted between two β-strands of the MP domain were built with the automodel module of MODELER31 using CusB as a template and a sequence alignment produced by Promals3D.32 The stereochemistry of all models was assessed with Procheck.33 Expression and Purification. The coding sequence for SilB (A17−P521) was amplified by PCR with Pfu polymerase (Fermentas) using genomic DNA from C. metallidurans CH34. The primers were designed to introduce the restriction sites for NdeI and EcoRI at the 5′ and 3′ ends of the protein coding sequence, respectively, as well as a cleavage site for Protease 3C at the C-terminus (forward primer 5′TATACATATGGCGGGCCTGGGTGGCGCA3′ and reverse primer 5′GAATTCGGTGGGCCTTGAAAAAGAACTTCAAGTGGCTTGGCTCCCGCGGT3′). The amplified SilB coding sequence was cloned in a pET30b vector (Novagen). The construct was transformed into E. coli strain BL21(DE3) (Novagen) for protein expression. The coding sequence for SilB-NMC ([A17−L123]-GS[T344−P521]) was obtained using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Starting from the SilB construct, we deleted the region covering residues [E124−A343] that encodes the β-barrel, the lipoyl, and the αhelical domains by inverse PCR. The primers were designed to introduce the artificial GS loop that maintains the membrane proximal domain integrity according to the homology modeling data (forward primer 5′GGCAGCACAGAACGGCTGCTCGTG3′ and reverse primer 5′GCTGCCCAGCCGGCCGAGCTTTACTTC3′). The coding sequence for SilB-NM ([A17− L123]-GS-[T344−A439]) was obtained using the inverse PCR technique with the SilB NMC construct as a template. Residues corresponding to the CusF-like domain ([G440−P521]) were deleted (forward primer 5′CTTGAAGTTCTTTTTCAAGGCCCAC3′ and reverse primer 5′GCCGGAAGTAGTTTCCTGCATG3′). The SilB-NMC and SilB-NM coding sequences were cloned in a pET30b expression vector (Novagen) using the NdeI and EcoRI restriction sites. The SilB-NM2 construct ([G36−L123]-GS-[T344−G426]) was produced using a synthetic, codon-optimized gene (GeneCust Europe, Luxemburg) inserted between the NcoI and XhoI sites of a pET28a expression vector (Novagen). The sequence contains a Cterminal Protease 3C cleavage site followed by a six-His tag. The expression vectors containing the sequences encoding SilB, SilB-NM, SilB-NM2, and SilB-C were transferred in E. coli strain BL21(DE3), whereas BL21(DE3)pLysS was used for SilB-NMC. Cultures were grown at 37 °C in LB medium containing 30 μg/mL kanamycin for E. coli BL21(DE3) (SilB, SilB-NM, SilB-NM2, and SilB-C) or 15 μg/mL kanamycin and 17 μg/mL chloramphenicol for E. coli BL21(DE3)pLysS (SilBNMC). Isotopically labeled proteins were produced in M9 minimal mineral medium (pH 7.4), supplemented with 0.1 mM MnCl2, 0.05 mM FeCl3, 0.05 mM ZnSO4, a vitamin solution, 30 mg/L kanamycin, and 15NH4Cl (1 g/L) (Cambridge Isotope Laboratories) and [13C6]glucose (2 g/L) (Euriso-top) as the sole nitrogen and carbon sources, respectively. In both media, protein expression was induced when the culture reached an absorbance of 0.6 at 600 nm by addition of 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). After 4 h at 37

■

EXPERIMENTAL PROCEDURES Protein Design. The SilB sequence from C. metallidurans CH34 was obtained from the UniProt data bank (UniProt/ TrEMBL accession number Q58AF3). For protein engineering, comparative models were built. A BLAST search performed using the SilB sequence devoid of its CusF-like domain identified CusB structure (PDB entry 3H9I; entry obsolete because replaced by entry 3OOC) as the best template with the B


Article

Biochemistry °C, the cells were harvested by centrifugation at 4 °C, frozen in liquid nitrogen, and kept at −80 °C. Protein purification was realized by immobilized metal ion affinity chromatography (IMAC) as previously described by Bersch et al.30 For SilB, addition of 1% (w/v) n-dodecyl β-Dmaltoside to the cell lysis buffer was required to extract the protein. No detergent was used in the following purification steps. After six-His tag removal, the proteins were purified in the desired buffer by size exclusion chromatography (SEC) using Superdex 75 10/300 GL (SilB-C) or 200 10/300 GL (SilB, SilB-NMC, SilB-NM, and SilB-NM2) analytical columns connected to an Ä KTApurifier system (GE Healthcare). For the SilB-NMC protein, an additional SEC step on a Superdex 75 10/300 GL column was necessary to remove the remaining contaminants. Purified proteins were concentrated using Vivaspin 5000 or 10000 molecular weight cutoff sample concentrators (GE Healthcare). The protein concentration was determined by measuring the absorbance at 280 nm using calculated molar extinction coefficients of 33920 M−1 cm−1 for SilB, 18450 M−1 cm−1 for SilB-NMC, 12950 M−1 cm−1 for SilBNM, 9970 M−1 cm−1 for SilB-NM2, and 5500 M−1 cm−1 for SilB-C. Mass Spectrometry. Spectra were recorded on an API hybrid quadrupole orthogonal time-of-flight mass spectrometer (Q-Tof Ultima, Waters), equipped with a nanoelectrospray source and operating in positive ion mode. Data were acquired using MassLynx version 4.1. For accurate molecular mass determination, proteins were solubilized in a 50% acetonitrile/ 1% formic acid (v/v) mixture after being desalted on ZipTipC18 (Millipore). Molecular masses were determined after MaxEnt1 deconvolution of the raw m/z data (Waters). The metal binding specificity of proteins was determined in the presence of 10 mM ammonium acetate (pH 6.9). Each protein and metal ions were incubated separately for 10 min at 22 °C at a final protein concentration of 5 μM. Parameters used for binding experiments were set to the following values: capillary voltage of 1600 V, cone voltage of 50 V, source block temperature of 20 °C, and pirani pressure of 2.2 mbar. Metal solutions were prepared using AgNO3, CdCl2, CuCl2, NiCl2, TlCl, and ZnCl2 salts. Cu+ was obtained by reduction of a Cu2+ solution in the presence of sodium ascorbate (pH 6.9) at a copper:reducer molar ratio of 1:4. Fluorescence Spectroscopy. The tryptophan intrinsic fluorescence was measured as described by Bersch et al.30 The proteins were purified in buffer A [20 mM HEPES (pH 7.0)]. The protein, at a final concentration of 30 μM, was titrated with 2.5 mM AgNO3 up to a metal:protein molar ratio of 2 or 3. The titrations were conducted in 0.4 cm × 1 cm quartz cuvettes. Tryptophan emission spectra were recorded on a QuantaMaster 40 fluorimeter (Photon Technology International, Edison, NJ) using an excitation wavelength of 280 nm. The reaction solutions were mixed for 15 min before the emission spectra were recorded. ITC Measurement and Data Interpretation. ITC measurements were performed on a MicroCal (Northampton, MA) VP-ITC microcalorimeter, typically at 25 °C. To determine the binding thermodynamic parameters of SilBNM, SilB-C, and SilB-NM2, the apo forms of the proteins were prepared as follows. Proteins were purified in buffer B [20 mM HEPES (pH 7.0)] and dialyzed overnight in buffer B using Slide-A-Lyzer G2 dialysis cassettes (Thermo Scientific) with a cutoff of 2 or 10 kDa, depending on the protein size. After dialysis, protein samples were collected and centrifuged at

16100gav for 30 min at 4 °C. The supernatant was recovered, and the concentration was determined by measuring the absorbance at 280 nm using a calculated molar extinction coefficient. For the metal ion binding studies, AgNO3 was chosen as the metal ligand. Stock solutions were prepared in Milli-Q water and were diluted to the desired experimental concentration using the dialysis buffer from the protein preparation (buffer B). Before the protein and ligand were loaded into the calorimeter, the concentrations were adjusted to the desired final concentrations with buffer B, and solutions were thoroughly degassed in a ThermoVac apparatus (MicroCal). For a titration experiment, approximately 1.5 mL of the protein solution was placed in a reaction cell into which the ligand was injected. Injection volumes were set to 2 μL for the first and to 8 μL for subsequent injections. A total of 30 injections were made with 5 min intervals between each injection. The following titrations were performed: apo-SilBNM (4 μM, initial concentration) with AgNO3 (56 μM), and apo-SilB-C (4 μM, initial concentration) with AgNO3 (56 μM). Control experiments, in which each protein was titrated with or into the reaction buffer, were conducted to determine the heat absorbed or released due to dilution, mechanical, and other nonspecific effects. During the experiments, the contents of the reaction cell were continuously stirred at 700 rpm. All the experiments were realized in triplicate, and additional control experiments were performed using TlCl as the ligand. Comparative Ag+ titration experiments with apo-SilB-NM2 and apo-SilB-NM were performed on a MicroCal ITC200 microcalorimeter (GE Healthcare) at 25 °C. The proteins were dialyzed overnight at 4 °C in doubly deionized water using Slide-A-Lyzer G2 dialysis cassettes (Thermo Scientific) with a 10 kDa cutoff and processed as described above. For a titration experiment, approximately 300 μL of protein was placed in a reaction cell and injected with the ligand during a period of 4 s. The volume of the first injection was 0.5 μL, and those of all subsequent injections were 2 μL. A total of 19 injections were made with 3 min intervals between injections. AgNO3 (70 μM) was titrated into apo-SilB-NM (7 μM), or apo-SilB-NM2 (7 μM), where the concentrations are the initial protein concentrations. Control experiments were conducted as described above, and data sets were corrected accordingly. For the study of SilB-NM and SilB-C protein−protein interaction in the presence and absence of metal ion, metalbound protein was prepared as follows. The protein in the apo state, prepared as described above, was incubated with 2 molar equiv of AgNO3. After being incubated for 5 min at 4 °C, the mixture was dialyzed for 1 h at 4 °C in buffer B using Slide-ALyzer G2 dialysis cassettes (Thermo Scientific) with the cutoff chosen with respect to the protein (2 or 10 kDa). Metal loading of the samples was checked by fluorescence spectroscopy before and after dialysis. For a titration experiment, approximately 1.5 mL of one protein was placed in the reaction cell while the second protein was used for injection. Injection volumes were set to 2 μL for the first and to 6 μL for subsequent injections. A total of 30 injections were made with 5 min intervals between individual injections. For SilB-NM and SilB-C, the following titration experiments were performed: apo-SilB-C (100 μM) into Ag+−SilB-NM (10 μM), apo-SilBNM (100 μM) into Ag+−SilB-C (10 μM), Ag+−SilB-C (100 μM) into Ag+−SilB-NM (10 μM), and apo-SilB-C (100 μM) into apo-SilB-NM (10 μM). As a control experiment, SilB-NM was incubated with 2 molar equiv of TlCl and dialyzed, and apo-SilB-C (100 μM) was titrated into the SilB NM (10 μM) C


Article

Biochemistry

Figure 1. Protein constructs used in this study. (a) Cartoon representation of a tripartite efflux system. Backbone coordinates were taken from the published CusBA and CusC structures (PDB entries 3NE5 and 3PIK).55,70 The two trimeric membrane proteins, RND and OMF, are colored light blue. The four characteristic domains of the hexameric periplasmic adaptor protein are colored as follows: red, membrane proximal domain; green, βbarrel domain; yellow, lipoyl domain; gray, α-helical domain. The linkers connecting the N-terminal and C-terminal domains observed in SilB to the membrane proximal domain are colored magenta and blue, respectively. The position of the inner and outer membranes is represented by gray lines. (b) Cartoon representation of SilB, the periplasmic adaptor protein of the SilCBA system. Backbone coordinates were taken from the published CusB and SilB440−521 (SilB-C) structures (PDB entries 3OOC and 2L55, respectively).30,55 The different domains of SilB are colored as indicated in panel a, and the N-terminal and CusF-like domains are colored magenta and blue, respectively. Black dots indicate the two Ag+ binding sites on the N- and C-terminal domains. The connection between the membrane proximal domain and the β-barrel domain is magnified. Hydrogen bonds that were considered for the design of the GS turn are indicated. (c) Schematic representation of the protein topology projected onto the amino acid sequences of SilB and of the different designed constructs. The different domains of SilB are abbreviated as follows: N, N-terminal domain; MP, membrane proximal domain; β, β-barrel domain; lip, lipoyl domain; α, α-helical domain; F, C-terminal CusF-like domain. An engineered Gly-Ser loop (GS) substitutes for the β-barrel, lipoyl, and α-helical domains in the SilB-NMC, SilB-NM, and SilB-NM2 constructs. Six-His tags preceded or followed by a Protease 3C cleavage site used in protein purification are indicated.

was conducted at 950 MHz, all with mixing times of 120 ms. An additional 15N-edited 3D-NOESY-HSQC experiment was conducted at 850 MHz at a temperature of 10 °C with a mixing time of 120 ms. For Ag+ titrations or the preparation of Ag+-bound proteins, fresh AgNO3 solutions were prepared in H2O such that the desired amount of Ag+ ions was contained in a volume of 10 μL. Small volumes were added directly to the NMR tube using an automatic analytical syringe (eVol, SGE Analytical Sciences). Weighted chemical shift differences were calculated from (ΔHN2 + ΔN2 × 0.01)1/2. R1, R1ρ, and heteronuclear {1H}−15N NOE relaxation experiments were conducted at 600 MHz and 25 °C using a noncryogenic probe and standard pulse sequences.39,40 During the R1 relaxation delay, cross-correlated relaxation was suppressed by applying a 550 μs cosine-modulated 180° squared pulse every 5 ms with an excitation maximum at 2 kHz from the carrier. R1ρ was measured using a B1 field of 1500 Hz. Recycle delays were set to 3 s for R1 and R1ρ. Relaxation delays of 0.01, 0.02, 0.05, 0.09, 0.15, 0.25, 0.4, 0.6, 0.9, 1.2, 1.5, and 1.8 s and 0.01, 0.02, 0.03, 0.04, 0.05, 0.07, 0.09, 0.11, 0.13, 0.17, 0.25, and 0.4 s were used to explore the magnetization decay for longitudinal and transverse relaxation, respectively. For the heteronuclear {1H}−15N NOE, the amide proton signals were saturated with a 1.7 kHz WALTZ16 decoupling scheme centered at the amide proton frequency. The saturation and recycle delays were set to 3 and 5 s, respectively. NMRViewJ (version 8.0.3, One Moon Scientific) was used to quantify peak intensities and to extract relaxation rates. Experimental data were fitted to a two-parameter single exponential, and errors were estimated from a Monte Carlo simulation, taking into account twice the root-mean-square noise of the spectra. Overlapping resonances were excluded from the analysis. Transverse relaxation rates (R2) were calculated from R1ρ

solution. All data sets were corrected for dilution and other nonspecific effects that were determined in the control experiments (see above). For the determination of the thermodynamic parameters (binding enthalpy change ΔH, association constant Ka, and binding stoichiometry n) of the protein−ligand interaction for SilB-NM, SilB-C, and SilB-NM2, the data were fitted using an independent single-site binding model with the Origin software package (MicroCal). NMR Spectroscopy. NMR experiments were performed on Varian VNMRS 600 and 800 MHz spectrometers, equipped with triple-resonance (1H, 13C, and 15N) cryoprobes and shielded z-gradients, or on Bruker 950 and 850 MHz Avance III HD spectrometers equipped with 5 mm triple-resonance Cryo TCI probes. Unless otherwise stated, NMR experiments were conducted at 25 °C with sample concentrations between 0.5 and 0.7 mM in 50 mM MES buffer (pH 6.0). Chemical shifts were referenced with respect to the H2O signal at 4.77 ppm relative to DSS, using the 1H:X frequency ratios of the zero point according to the method of Markley et al.34 All NMR spectra were processed and analyzed using NMRPipe,35 NMRView,36 and CcpNMR Analysis.37 Sequential backbone resonance assignments of apo-SilB-NM and Ag+−SilB-NM2 were performed using a series of 3D NMR Best-TROSY experiments.38 Ag+−SilB-NM2 aliphatic carbon and proton side chain resonances were assigned from 1H,13CCT-HSQC, 3D-(H)CC(CO)NH, and 15N- and 13C-edited 3DNOESY-HSQC experiments. Aromatic side chain resonances were assigned using 1H,13C-CT-HSQC and 3D-NOESY-HSQC experiments centered on aromatic carbons. The same 3DNOESY-HSQC experiments were also used for the extraction of 1H−1H distance restraints during structure calculation. 13Cedited 3D-NOESY-HSQC experiments were conducted at 850 MHz, whereas the 15N-edited 3D-NOESY-HSQC experiment D


Article

Biochemistry

construct, i.e., upon removal of the β-barrel, the lipoyl, and the α-hairpin domains. Indeed, although a metal binding site was identified at the interface between the β-barrel and the membrane proximal domains in the crystal structure of ZneB, another PAP from C. metallidurans CH34,20 multiple-sequence alignment shows that this binding site is not conserved in SilB or CusB from E. coli (Figure S1 of the Supporting Information). In the crystal structure of E. coli CusB,26 the linker between the membrane proximal and β-barrel domains adopts an antiparallel β-sheet conformation that connects the N- and Cterminal parts of the membrane proximal domain. Hydrogen bonds are formed within this sheet between G102 and M324 as well as between T100 and L326. It is tempting to speculate that a stable protein may be obtained by connecting residues G102 and M324 or L104 and E322 from the linker by a short reverse turn. Sequence alignment of SilB_Cmet with CusB_Ecoli provided the corresponding residues in SilB, G121 and R346 or L123 and T344, which were considered as possible anchor points for an engineered reverse turn (Figure S1 of the Supporting Information). Previous analyses of the potential of different residues for β-turn formation51 were used to design the turn: R in position i + 3 is most compatible with a type I′ turn, whereas T in the same position favors of a type II′ turn. According to Hutchinson and Thornton,51 the most common residues in positions i + 2 and i + 3 of type II′ turns are Gly and Ser, respectively. Therefore, we decided to replace residues from E124 and A343 with a glycine and serine, that are supposed to form a reverse type II′ turn at this position. The introduction of a turn to short-circuit the three β-barrel, lipoyl, and α-helical domains could significantly alter the protein structure, thereby disturbing its stability. In this context, modeling the structure of the protein constructs may be helpful. Therefore, before proceeding to the expression of the different constructs, we built a model of the membrane proximal domain containing the GS loop to check its capacity to fold in a structure close to that of the homologous CusB domain (see Experimental Procedures). All 3D models superimpose on the CusB structure with a root-mean-square deviation ranging between 0.4 and 0.5 Å for the Cα positions, which is a fairly low value. Ramachandran plots showed that all models feature a stereochemistry with no residues in disallowed areas in the conformational space. Furthermore, the backbones of L123 and S125 that are residues of the engineered turn form a H-bond that might contribute to the stabilization of the 3D structure. The quality of the 3D structure prompted us to undertake the production of the chimeric proteins. Different constructs (Figure 1 and Figure S1 of the Supporting Information) varying in their domain composition were produced. The three-domain construct named SilB-NMC contains the N-terminal, the membrane proximal, and the Cterminal domains and spans residues A17−L123 and T344− P521, connected by the short glycine-serine linker. The SilBNMC protein hosts the two metal sites, the one presumably formed by the three N-terminal methionine residues (M68, M83, and M85) and that of the CusF-like domain (H461, W469, M472, and M474). In addition, we also produced two shorter protein constructs for structural and metal binding studies that contain only the N-terminal metal site: SilB-NM (A17−L123 and T344−A439) and SilB-NM2, devoid of some unstructured stretches at the N- and C-termini (G36−L123 and T344−G426), each with the short glycine-serine linker necessary for the folding of the membrane proximal domain

using the relation R2 = [R1ρ − cos2(θ)R1]/[1 − cos2(θ)], with θ = tan−1(2πΔν/γNB1), where Δν is the 15N resonance offset. The exchange rate between the two detected forms of Ag+− SilB-NM2 (forms A and B) was quantified using Bestoptimized, two-dimensional (2D) versions of ZZ exchange experiments.41,42 Nineteen 1H,15N correlation experiments were acquired with the following exchange delays (in milliseconds): 0, 1, 2, 5, 7, 10, 12, 15, 20, 25, 30, 40, 50, 75, 100, 125, 150, 200, and 250. Resolved diagonal and exchange peaks could be obtained for two residues (R31 and R56, SilBNM2 sequence numbering). Peak intensities were extracted using CcpNMR Analysis37 and were fitted using a two-state model, assuming common kAB and kBA rate constants. Structure Calculation. The UNIO’10 software43−45 was used for automatic peak picking, initial NOE assignment, and distance restraint extraction. Initial structures were calculated using the Cyana molecular dynamics algorithm44,46 in the UNIO’10 software. Separated UNIO’10 runs were performed for the A and B forms of Ag+−SilB-NM2, using only resonances from the chosen form as input. TALOS+-derived dihedral restraints were used as additional input data. Final structures were calculated using ARIA 2.3.1/CNS 1.1,47,48 allowing for reassignment of the peaks in the lists initially provided by UNIO’10 and manually corrected for exchange or exchangerelayed cross-peaks. A Ag+ ion was introduced by constructing a nonstandard residue involving coordination to three methionine residues (M34, M49, and M51 with respect to SilB-NM2 sequence numbering corresponding to M68, M83, and M85, respectively, in Q58AF3), as described in the Supporting Information. A trigonal geometry of the Ag+ site was assumed with bond lengths of 2.53 Å for the S−Ag+ bond in accordance with published crystal structures (PDB entries 2QCP and 3NSD) and data from the literature.49,50 One thousand structures were calculated in the eighth ARIA iteration, from which 20 structures with the lowest total energy were selected and further refined in explicit water to give the final structural ensemble.

■

RESULTS Recombinant Protein Design. This study addresses metal ion binding and transfer within the periplasmic adaptor protein SilB from the metal resistant bacterium C. metallidurans CH34 (SilB_Cmet, UniProt/TrEMBL entry Q58AF3). As SilB contains two distinct metal binding domains, we searched to obtain a construct comprising the two sites but still amenable to high-resolution NMR studies. Periplasmic adaptor proteins are modular proteins,9 and C. metallidurans SilB corresponds to a fusion of a CusB-like PAP with a C-terminal CusF-like domain (see Figure 1).30 By analogy with the orthologous proteins CusB and CusF from E. coli, the two metal sites are found in the so far structurally uncharacterized N-terminal part of SilB, and in the C-terminal CusF-like domain (SilB-C) (Figure S1 of the Supporting Information). The two metal binding domains are both connected to the membrane proximal domain. To conserve the native environment of the N- and C-terminal domains, we decided to include the membrane proximal domain in our construct, which, in the linear domain arrangement of the PAP, holds the N- and C-terminal parts together. Because of the topology of the PAP with the N- and C-termini close to each other on one side of the elongated multidomain structure, we had to excise residues belonging to the β-barrel, the lipoyl, and the α-hairpin domains from the SilB sequence. No potential metal binding site will be lost in this E


Article

Biochemistry

Figure 2. Binding of Ag+ ions by SilB-NM and SilB-NM2. (a) Fluorescence spectroscopy results showing the evolution of W64 fluorescence emission upon titration of 30 μM SilB-NM in 50 mM HEPES buffer (pH 7.0) with AgNO3. (b) Isothermal titration calorimetry results showing the titration of 4 μM SilB-NM with 56 μM AgNO3: (top) differential heating power vs time and (bottom) integrated and normalized heat of reaction vs molar ratio. Experimental data are represented by black squares (■). Lines show the best fit to the binding isotherm using a single-site binding model. (c) 1H,15N-HSQC spectra of 0.5 mM apo-SilB-NM (black) and SilB-NM in the presence of 1 molar equiv of AgNO3 (blue). (d) 1H,15NHSQC spectra of 0.7 mM apo-SilB-NM2 (black) and SilB-NM2 in the presence of 1 molar equiv of AgNO3 (red). Cross-peaks that disappear when Ag+ ions are bound are labeled using sequence numbering of the SilB-NM2 sequence. Boxes indicate peaks belonging to two different populations.

(Figure 1). Sequence alignment of the different constructs with the Uniprot Q58AF3 sequence can be found in Figure S1 of the Supporting Information. Expression and Purification of Recombinant Proteins. The recombinant proteins SilB ([A17−P521]), SilB-NMC ([A17−L123]-GS-[T344−P521]), SilB-NM ([A17−L123]-GS[T344−A439]), SilB-NM2 ([G36−L123]-GS-[T344−G426]), and SilB-C ([G440−P521])30 were expressed and purified as described in Experimental Procedures. The quality and the integrity of the recombinant proteins were controlled by sodium dodecyl sulfate−polyacryalmide gel electrophoresis (SDS−PAGE) and electrospray mass spectrometry (ESI-MS) (Figure S2 of the Supporting Information). Isotopic enrichment of the proteins produced for the NMR studies was checked by ESI-MS and shown to be >98%. Metal Binding Specificity of SilB, SilB-NMC, SilB-NM, and SilB-NM2. The metal ion binding on SilB, SilB-NMC,

SilB-NM, and SilB-NM2 was monitored by native mass spectrometry. Proteins were purified in a nondenaturing, volatile solution compatible with the ESI-MS analysis [10 mM ammonium acetate (pH 6.9)]. Mass spectra were recorded after incubation of the proteins in the presence of different metal ions (Ag+, Cd2+, Co2+, Cu+, Cu2+, Ni2+, Tl+, and Zn2+). Addition of Ag+ or Cu+ induced a shift of the protein peaks to higher m/z values corresponding to the binding of one metal ion per protein for SilB-NM and SilB-NM2 and two metal ions per protein for SilB and SilB-NMC (Figure S3 of the Supporting Information). The spectra show the almost total disappearance of the peak corresponding to the apo form upon addition of metal ions, demonstrating that most of the molecules are functional within each protein preparation. No metal−SilB complex was observed with the other metal ions tested, even at a cation:protein molar ratio of 4:1 (data not F


Article

Biochemistry

detected methionine methyl correlation peaks in the apo spectrum, three disappeared in the presence of Ag+, providing experimental evidence that the predicted N-terminal metal site was populated with Ag+ ions (Figure S5A of the Supporting Information). Ag+ was also titrated into SilB-NM2. The behavior of this protein construct was slightly different from that of SilB-NM: while roughly the same peaks disappeared from the SilB-NM2 1 15 H, N-HSQC spectrum of the apo form, many new peaks appeared in the presence of Ag+. Some resonances appeared to be split up into two peaks upon Ag+ binding, as indicated in Figure 2d, suggesting different protein populations. Subsequent addition of up to 2 molar equiv of Ag+ did not lead to further spectral changes. A 1H,13C-HSQC spectrum, recorded for the detection of methionine methyl groups, showed three methionine methyl resonances with the typical 13C downfield shift to chemical shift values of ≥20 ppm in the presence of Ag+ (Figure S5B of the Supporting Information). These resonances were later assigned to M68, M83, and M85 (sequence numbering of the Q58AF3 entry), thus confirming that the N-terminal metal site of SilB is similar to that found in CusB.19,54 SilB-NMC: Ag+ Binding, Domain Interaction, and Metal Transfer. SilB-NMC encompasses both metal sites located on two different domains of the entire SilB protein, held together by the membrane proximal domain. Therefore, it is an ideal model protein for the study of domain−domain interaction and metal transfer between the two binding sites. 1 15 H, N-HSQC spectra of SilB-NM, SilB-C, and SilB-NMC in the apo and metal-bound forms were compared with the aim of detecting possible interactions between the two metal binding domains. NMR is well suited for the detection of such interactions because of the sensitivity of the chemical shift to changes in the electronic environment of the individual spins. No significant chemical shift differences were observed between spectra of SilB-NMC and those of the isolated SilB-NM or SilBC domains. This indicates that the two domains do not interact with each other under the chosen experimental conditions, namely when both of them are in the apo or in the metal-bound state (Figure S6 of the Supporting Information). These domains therefore appear to be completely independent. Binding of Ag+ to SilB-NMC was then studied by fluorescence spectroscopy. This protein construct contains two tryptophan residues that have both been shown to be valuable probes for monitoring binding of Ag+ to either SilBNM (W64) (as mentioned above) or SilB-C (W469).30 In the latter case, titration with metal ions led to a decrease in tryptophan fluorescence emission. Binding to either of the two sites should therefore lead to an increase (binding to the Nterminal metal site) or a decrease (binding to the C-terminal metal site) in tryptophan fluorescence emission. When SilBNMC was titrated with Ag+, the tryptophan fluorescence emission at 340 nm first decreased until the metal:protein molar ratio reached a value of 1:1 (Figure 3a). Subsequent addition of Ag+ ions caused an increase in fluorescence intensity up to a metal:protein molar ratio of 1.75:1. Larger amounts of added Ag+ ions did not further change the signal intensity. This result suggests that within SilB-NMC, Ag+ was preferentially bound to the C-terminal CusF-like domain. NMR spectroscopy further confirms this observation: different amounts of Ag+ ions were added to a SilB-NMC sample, and the resulting 1H,15N-HSQC spectra were compared to 1H,15N-HSQC spectra of apo and Ag+-bound

shown). Our data strongly suggest that SilB, SilB-NMC, SilBNM, and SilB-NM2 specifically bind Ag+ and Cu+. Characterization of Binding of Metal Ion to Constructs Featuring a Single Metal Site. SilB-NM and SilBNM2 contain only the N-terminal metal coordination site. On the basis of sequence similarity with E. coli CusB,19 this site is likely to be formed by M68, M83, and M85 (Figure S1 of the Supporting Information). SilB-NM and SilB-NM2 contain a single tryptophan residue, W64, located close to M68. Therefore, binding of metal ion to SilB-NM was followed by tryptophan fluorescence spectroscopy. Titration of SilB-NM with Ag+ induced an increase in tryptophan fluorescence emission at 336 nm until the metal:protein ratio reached a value of 0.75:1 (Figure 2a). When the protein was titrated with Tl+, no modification of the spectral features of W64 was detected (data not shown). Metal binding constants were determined for the N- and Cterminal metal coordination sites using isothermal titration calorimetry (ITC). The titration of SilB-NM, SilB-NM2, and SilB-C with Ag+ showed a significant change in enthalpy (Figure 2b and Figure S4 of the Supporting Information). Dissociation constants (Kd), calculated from fitting of the titration data using a single-site binding model, were in the tens of nanomolar range, which is at the lower limit for the reliable determination of binding constants using ITC. SilB-NM has a Ag+ affinity 2-fold higher than that of SilB-C, whereas SilB-NM and SilB-NM2 yield comparable binding constants (Table 1). Taken together, the MS, tryptophan fluorescence emission, and ITC data suggest that a single Ag+ ion is bound to SilB-NM, SilB-NM2, and SilB-C. Table 1. Thermodynamic Parameters of the Ag+−SilB-NM, Ag+−SilB-C, and Ag+−SilB-NM2 Interaction n

Kd (nM)

ΔH (kcal/mol)

A (Titration of SilB-NM and SilB-C with AgNO3 in 20 mM HEPES at pH 7.0 and 25 °C) SilB-NM 1.2 ± 0.1 38 ± 8 −4.51 ± 0.59 SilB-C 1.1 ± 0.1 72 ± 3 −10.41 ± 1.02 B (Titration of SilB-NM and SilB-NM2 with AgNO3 in Milli-Q water at 25 °C) SilB-NM 0.9 ± 0.1 27 ± 3 −10.2 ± 0.0 SilB-NM2 0.9 ± 0.1 22 ± 5 −10.5 ± 1.3

NMR was used to gain deeper insight into binding of the metal ion to the different protein constructs. Metal binding can be monitored by spectral changes. Moreover, chemical shift changes of methionine and histidine side chain resonances have been found to be indicative of the direct implication of the respective residues in the metal site52,53 and were used to identify residues of the Ag+ site in the SilB CusF-like domain.30 Here, Ag+ was first titrated into SilB-NM, and 1H,15N-HSQC spectra were acquired at Ag+:protein molar ratios ranging from 0.25:1 to 3.5:1. The intensity of several peaks in the 1H,15NHSQC spectrum was already diminished at the lowest ratio (Figure 2c). With an increase in the Ag+:protein molar ratio from 0.25:1 to 1:1, most of these peaks disappeared. However, no new peaks appeared in the spectrum, suggesting that residues within or close to the metal site probably undergo dynamics on a time scale that leads to peak broadening below the detection limit. 1H,13C-HSQC spectra were recorded on a doubly labeled sample in the absence and after the addition of 0.5−3.5 molar equiv of Ag+ ions. Interestingly, from the five G


Article

Biochemistry

HSQC spectrum. These peaks correspond exclusively to residues within the C-terminal CusF-like domain. After addition of an additional 0.5 molar equiv of Ag+ ions, resonances of the metal-bound CusF-like C-terminal domain were observed whereas those of the apo state had completely disappeared (Figure 3c). For comparison, a similar titration of SilB-C is shown in Figure S7 of the Supporting Information. Increasing the metal concentration above 1 molar equiv (0.5 molar equiv per metal site) did not lead to further changes for peaks corresponding to the C-terminal domain, indicating that at this ratio, the CusF-like metal site approached saturation. Weighted chemical shift differences between amide groups of the C-terminal domain of apo-SilB-NMC and SilB-NMC in the presence of 1 molar equiv of Ag+ are shown in Figure S8 of the Supporting Information. On the other hand, as shown for the SilB-NM construct, binding of Ag+ to the N-terminal metal site of SilB-NMC resulted in the loss of several cross-peaks from amino acid residues close to the metal binding site. When the Ag+:SilB-NMC molar ratio reached 0.5:1, the intensity of these cross-peaks decreased, but most peaks could still be detected at the noise level at a molar ratio of 1:1, indicating that a substantial number of N-terminal metal sites were not occupied under these conditions. Interestingly, the preferential metal ion distribution on the Cterminal site was also observed for mixtures of the isolated SilBNM and SilB-C constructs. Ag+ titration of an equimolar mixture of SilB-NM and SilB-C resulted in the same evolution of tryptophan fluorescence emission (Figure 3b) that was observed for SilB-NMC, indicating that Ag+ is distributed to the SilB-C site at half-saturation. The same result was obtained by native mass spectrometry when an equimolar mixture of SilB-C and SilB-NM was incubated in the presence of 0.5 molar equiv of Ag+ per binding site (Figure S9 of the Supporting Information). The dissociation constants determined by ITC measurements (Table 1), however, indicated a higher Ag+ binding affinity for the N-terminal metal site (SilB-NM and SilB-NM2) with respect to the C-terminal one. In this context, the results from mass spectrometry, and flourescence and NMR spectroscopies described above, suggest that Ag+ ions are transferred from the N-terminal to the C-terminal metal site, perhaps during transient formation of a specific complex. Such complex formation may be detected by isothermal titration calorimetry. Titration of SilB-NM and SilB-C into each other, both being either in the apo or in the Ag+-bound form, showed no heat change (Figure S10C,D of the Supporting Information). The same result was obtained when Ag+−SilB-C was titrated into apo-SilB-NM (Figure S10B of the Supporting Information), suggesting that these proteins do not interact or exchange Ag+ ions. In the reverse experiment, however, significant changes in enthalpy could be detected when Ag+−SilB-NM was titrated into apo-SilB-C (Figure S10A of the Supporting Information). This enthalpy change could be due either to a protein−protein interaction or to some process of metal binding and release. Though we did not attempt to fit the data, they suggest a stoichiometry close to 1:1. A metal ion transfer between Ag+−SilB-NM and apo-SilB-C was clearly evidenced by native mass spectrometry and NMR (Figures S11 and S12 of the Supporting Information), while a much lower level of Ag+ exchange between Ag+−SilB-C and apo-SilB-NM was observed by mass sepctrometry (Figure S11 of the Supporting Information). The same results were obtained by replacing SilB-NM with SilB-NM2, demonstrating

Figure 3. Binding of Ag+ ions by SilB-NMC. (a) Fluorescence spectroscopy results showing the tryptophan fluorescence emission of 30 μM SilB-NMC in 50 mM HEPES buffer (pH 7.0) upon titration with AgNO3. (b) Tryptophan fluorescence emission of an equimolar mixture of 30 μM SilB-NM and SilB-C in 50 mM HEPES buffer (pH 7.0) upon titration with AgNO3. The fluorescence intensity was determined at 340 nm. (c) NMR spectroscopy results showing the superposition of 1H,15N-HSQC spectra acquired with 0 (blue), 0.5 (green), and 1 (pink) molar equiv of Ag+ ions added. Note that SilBNMC has two metal sites; 1 molar equiv of metal ions therefore corresponds to 0.5 molar equiv with respect to the metal sites. Crosspeaks that shift upon metal interaction are labeled (sequence numbering of the Q58AF3 entry). They correspond to peaks of the CusF-like domain. Assignments were obtained from the previous NMR study of the CusF-like domain.30

SilB-NM (only the N-terminal metal site) and SilB-C (only the C-terminal metal site). Upon addition of 0.5 molar equiv of Ag+ to SilB-NMC (i.e., 0.25 molar equiv of metal ion per binding site), some peaks shifted or disappeared from the 1H,15NH


Article

Biochemistry that the first 19 N-terminal residues are not required for the interaction and the transfer of metal ions between the Nterminal and C-terminal sites of SilB (Figure S11 of the Supporting Information). Altogether, our results obtained on the SilB-NMC construct or on mixtures of SilB-NM and SilB-C concomitantly show that when both metal sites are present, Ag+ ions first accumulate in the C-terminal domain before populating the N-terminal metal site. NMR Resonance Assignment of SilB-NM and SilBNM2. For a further characterization of the N-terminal metal site, NMR assignments of apo-SilB-NM and Ag+-bound SilBNM2 were performed. More than 85% of the backbone resonances of the 212-residue SilB-NM protein were assigned. We also assigned the metal-bound form of the shorter SilBNM2 protein, as new peaks appeared in the corresponding spectra upon interaction with metal. During the assignment process of Ag+−SilB-NM2, it became clear that many resonances are doubled. This suggests that in the presence of metal, the SilB-NM2 protein adopts two different conformations that are in slow exchange; 80% of backbone and 65% of side chain resonances were assigned. Resonance assignments obtained on the short SilB constructs (SilB-NM2, SilB-NM, and SilB-C) could be transferred to spectra of SilB-NMC, providing nearly complete backbone resonance assignment of this 294-residue protein. For a further description of the SilB-NM and SilB-NM2 proteins and their comparison, we will adopt the sequence numbering of the SilB-NM2 protein. Correspondence to the original numbering of the SilB protein and that of the SilBNM2 construct can be found in Figure S1 of the Supporting Information. Once the backbone assignments of the apoprotein and Ag+bound protein had been obtained, chemical shift differences were plotted as a function of the protein sequence to obtain information about the metal site as well as about the regions involved in the conformational exchange observed on the metal-bound protein. Figure 4 shows the weighted chemical shift differences determined for amide groups of apo-SilB-NM2 and Ag+−SilB-NM2, as well as for the two forms observed for Ag+−SilB-NM2. It can be seen that in both cases, these differences are located around the presumed metal site formed by methionine residues M34, M49, and M51 (the SilB-NM2

numbering corresponding to M68, M83, and M85, respectively, in Q58AF3). The completed side chain assignment also allows us to confirm that the three methionine methyl resonances that shift upon interaction with Ag+ ions do correspond to M34, M49, and M51. The resonances of the membrane proximal domain are not modified upon addition of Ag+, suggesting that this domain does not interact with the metal ion or with the neighboring N-terminal stretch encompassing the N-terminal metal site. Backbone Dynamics and Characterization of Conformational Exchange by NMR. So far, no structural information about the conserved N-terminal metal site of periplasmic adaptor proteins involved in the transport of monovalent metal ions such as Cu+ or Ag+ has been obtained. The absence of any visible electron density in the X-ray diffraction data of the different CusB crystals, isolated or in complex with CusA, led to the conclusion that this part of the protein is highly dynamic.26,55 15 N relaxation parameters determined by NMR allow characterization of pico- to nanosecond backbone mobility and motional order on a residue level. We measured 15N relaxation rates for apo-SilB-NM as well as Ag+−SilB-NM2 (Figure 5). The relaxation data suggest that these proteins are

Figure 5. 15N relaxation data measured for apo-SilB-NM and Ag+− SilB-NM2. Ratio of transverse and longitudinal relaxation rates (top) and {1H}−15N heteronuclear NOE (bottom) measured for apo-SilBNM (black) and Ag+−SilB-NM2 (red). In green are shown the data obtained for peaks corresponding to the Ag+−SilB-NM2 B form.

composed of two structured domains (residues 26−58 and 79− 157, SilB-NM2 numbering). These domains are characterized by an elevated R2/R1 ratio and {1H}−15N heteronuclear NOEs (hetNOE) of >0.5. Residues 79−157 correspond to the membrane proximal domain, whereas residues 26−58 encompass the N-terminal metal binding site (M34, M49, and M51). The relaxation data therefore provide the first experimental evidence that the latter has a well-defined structure. The two domains are connected through a flexible linker. Interestingly,

Figure 4. Chemical shift comparison for the SilB-NM2 protein in the apo and Ag+-bound states. (a) Weighted 1HN,15N chemical shift differences between apo and Ag+-bound SilB-NM2: red, Ag+−SilBNM2 A form; blue, Ag+−SilB-NM2 B form. (b) Weighted 1HN,15N chemical shift differences between the A and B forms of Ag+−SilBNM2. I


Article

Biochemistry

Figure 6. Solution structure of Ag+−SilB-NM2. (a) Structural ensemble comprising the 20 lowest-energy structures. Backbone atoms of the membrane proximal domains were superimposed (residues 80−88 and 93−150). Secondary structure elements of the membrane proximal domain are colored red (β-sheet) and blue (α-helices). The ordered part of the N-terminal metal binding domain is colored green, and the Ag+ ion is shown as a light blue sphere. As described in the text, the relative orientations of the membrane proximal domain and the N-terminal metal binding loop are completely unconstrained. (b) Schematic representation of the SilB-NM2 topology. Domains are highlighted by shaded squares, and secondary structure elements are numbered sequentially. (c) Representation of the 20 structures of the membrane proximal domain. The N-terminus is located on the back. Some β-strands are numbered according to the topology shown in panel b. The engineered loop is labeled GS. Note the different orientations of the C-terminal helix. (d) N-Terminal metal binding domain. Backbone atoms of residues 28−57 were superimposed for this representation. The Ag+ site is highlighted as well as the W30 residue, which is sandwiched between Pro43 and Pro55. The Ag+ ion and the Cα atoms are shown as spheres.

Table 2. NMR Structure Quality for Ag+−SilB-NM2 (20 structures) rmsd with respect to mean structure (metal binding loop, residues 28−57) backbone heavy atoms rmsd with respect to mean structure (MP domain, residues 80−88 and 93−150) backbone heavy atoms Ramachandran analysis (residues 28−57 and 80−150) core allowed generous disallowed

the R2/R1 ratio, which can be considered to be proportional to the overall rotational correlation time of the structured domains, is much larger for residues of the membrane proximal domain than for residues in the N-terminal metal binding domain. This suggests that the two domains tumble independently in solution. We could not observe any significant differences between the two forms of the metal-bound SilBNM2 protein (Figure 5). Exchange kinetics between the two forms of the metal-bound SilB-NM2 protein was determined from two-dimensional EXSY experiments (Figure S13 of the Supporting Information). Four

0.32 ± 0.07 Å 0.77 ± 0.11 Å 0.55 ± 0.12 Å 1.01 ± 0.16 Å 81.4% 16.9% 1.4% 0.3%

isolated peaks could be observed for residues R31 and R56. Simultaneous fitting of these peaks using a model for two-site exchange allowed an estimation of the relative populations (0.53 and 0.47 for the A and B forms, respectively) as well as of the exchange rates (kAB = 7.5 ± 1.0 s−1, and kBA = 8.4 ± 1.1 s−1). Solution Structure of Ag+−SilB-NM2. 15N relaxation data suggested the presence of a well-structured domain encompassing the N-terminal metal site. Therefore, we set out to determine its solution structure in the context of the Ag+-bound SilB-NM2 construct. As described above, we could obtain J


Article

Biochemistry

conformation. In our case, in which the determination of exact NOE-derived distances is hindered by the presence of chemical exchange, chemical shifts might provide information about possible conformational differences between the two detected conformers. Comparing backbone chemical shifts for the two Ag+−SilB-NM2 conformers reveals that the largest chemical shift differences cluster around residues W30, D41, and P55 (Figure S14 of the Supporting Information). W30 and P55 belong to the short β-sheet on which the two methioninecontaining lobes are anchored. D41 is located in a loop, which stacks on the short sheet. TALOS+, a hybrid system for the empirical prediction of protein ϕ and ψ dihedral angles,57 was used in the process of structure calculation for generating dihedral angle constraints from chemical shifts. Inspection of TALOS+-derived backbone dihedrals reveals only a single, significant difference for the ψ angle of L28: this angle is predicted to to −27 ± 40° for the A form and 135 ± 40° for the B form. In the structural ensembles, these constraints result in a different orientation of Y29 HN, and of the Y29 side chain. It has to be noted that L28 gives a very weak cross-peak in the 1 15 H, N-HSQC spectrum and that no such peak was observed for Y29. This points to possible dynamics occurring on the level of these residues. Interestingly, the orientation of the nearby W30 side chain also differs between the two forms. Differences in aromatic side chain orientations are certainly the reason for the observed variations in 1H chemical shifts.

nearly complete backbone and side chain assignment for the A and B forms, which differ from each other only in the proximity of the metal site. The major problem we encountered was the presence of slow conformational exchange. With time constants on the order of 115 ms, chemical exchange interferes with cross-relaxation during the NOE mixing time. Indeed, analysis of the EXSY spectra acquired under identical experimental conditions showed very weak peaks even with a mixing time of 0 ms. This is due to magnetization transfer during the INEPT steps in the EXSY sequence. A 15N-edited NOESY HSQC experiment was conducted at 10 °C with the aim of disentangling exchange relayed from true NOESY peaks. However, we are conscious that the presence of chemical exchange is a possible source of errors in peak volumes and therefore distances obtained from the 3D NOESY experiments. All strips involving resonances undergoing chemical exchange were analyzed and assigned by hand to remove the maximal number of exchange and exchange-relayed cross-peaks. A silver ion, covalently bound to the three methionine sulfur atoms, was integrated into the structure calculation. Figure 6 shows the resulting structural ensemble of the major form (A form) of the Ag+−SilB-NM2 protein. Statistics of the structure calculation can be found in Table 2 and Table S1 of the Supporting Information. No NOE cross-peaks were detected between the N-terminal domain and the membrane proximal domain; therefore, their relative orientation is completely unconstrained, as expected from the results of the 15N relaxation experiments. The structure of the membrane proximal domain is welldefined with a backbone root-mean-square deviation (rmsd) of 0.55 ± 0.12 Å (residues 80−88 and 93−150; C, CA, and N atoms) and a heavy atom rmsd of 1.01 ± 0.15 Å (Figure 6a,c). Its superimposition onto the corresponding E. coli CusB membrane proximal domain produces a backbone rmsd of 1.03 Å, demonstrating that our engineered protein construct is correctly folded. Note that the C-terminal helix is unconstrained. In the two PAP chains within the CusAB complex, similar helices are seen in different orientations close to the interface with the RND component CusA.55 Detailed structural information was also obtained for residues 28−57, including the N-terminal metal site (Figure 6d). For the 20 structures in the final ensemble, the rmsd values were determined to be 0.32 ± 0.07 and 0.77 ± 0.11 Å for backbone and heavy atoms of residues 28−57, respectively. This domain contains a short βsheet, involving residues W30, R31, I54, and P55. This can be considered as a kind of stem, which is stabilized by numerous hydrophobic interactions (L28, Y29, W30, V56, and Y57). The bulky W30 side chain is sandwiched between P43 and P55 (Figure 6d). Anchored onto this stem are two lobes, which are arranged around the bound Ag+ ion via the three methionine residues of the binding site. This domain contains many highly conserved residues: a BLAST alignment of residues I27−A62 (I61−A96 by the original SilB numbering) against the UniRef50 cluster56 reveals that P33, M34, G44, P47, M49, M51, L53, and Y57 are strictly conserved within the 50 sequence clusters with the highest score. In addition, Y29, W30, P36, P43, S46, and P55 are conserved in most sequences and, if not, are replaced by similar residues. We also calculated the structure of the second (B) form of the metal binding loop. Because the two parts of the Ag+-bound SilB-NM2 protein are completely independent, we considered only residues 24−62. Both structures adopt roughly the same fold. Chemical shifts are sensitive to local structure, and in particular, backbone chemical shifts can be related to backbone

■

DISCUSSION Tripartite efflux systems involving a proton/metal ion antiporter are expressed in different bacteria in response to intracellular toxic concentrations of metal ions. These complexes span the whole cell envelope and efficiently detoxify the periplasmic space by transporting metal ions out of the cell. Whereas the efflux systems exporting bivalent metal cations are composed of an inner membrane secondary transporter (HMERND), an outer membrane protein, and a periplasmic adaptor protein, an additional small periplasmic membrane chaperone can be found in systems transporting monovalent copper and silver ions such as in the well-characterized E. coli CusCFBA complex.4 In this system, the small metal chaperone CusF is actively involved in the trafficking of metal ions from the periplasm to the RND component CusA23 whereas the conformational change undergone by the PAP upon metal ion binding could act as a switch to activate the transport by the RND component.21,23 Interestingly, the 61-residue N-terminal region of CusB, which comprises the metal binding site, was sufficient for the activation of CusA-mediated transport.54 In the orthologous transport system SilCBA from C. metallidurans CH34, the periplasmic metal chaperone is fused to the periplasmic adaptor protein SilB polypeptide chain and forms an additional C-terminal domain.30 SilB therefore should be able to transfer Ag+ ions from the periplasm to SilA by means of the C-terminal domain, while binding of Ag+ to the N-terminal site may induce the conformational switch necessary for transport activation. To improve our understanding of the role of the two metal binding sites within SilB and to gain insight into the structure of the so far uncharacterized N-terminal metal site, we designed model proteins that encompass either the individual metal site or both metal sites. The solution structure was determined for a construct composed of the MP domain and the N-terminal part, including the N-terminal metal site. The SilB MP domain shows a fold very similar to that in E. coli CusB (rmsd of 1.03 Å, K


Article

Biochemistry 155 backbone atoms, PDB entry 3NE5) and in C. metallidurans ZneB (rmsd of 1.53 Å, 162 backbone atoms, PDB entry 3LNN). A superposition of the three MP domain structures is shown in Figure S15A of the Supporting Information. More interestingly, we show for the first time the welldefined structure of a stretch of 38 residues that encompasses the N-terminal metal binding site of SilB. 15N relaxation data indicate that this region is structured in the absence and presence of bound metal ion. Three conserved methionine residues located between the tip of the short β-sheet and a loop, forming a sort of clamp, bind the Ag+ ion. A search of the Protein Data Bank using the Dali server58 did not provide any relevant structural homologue for the N-terminal metal binding loop. Two different conformations were observed for this protein part, and exchange kinetics could be determined. Our NMR data suggest that these two conformations may originate from different orientations of some aromatic residues situated in the proximity of the short β-sheet. The same slow conformational exchange can be detected in the published NMR spectra of the isolated, 61-residue CusB N-terminal region (CusB-NT) in the presence of Ag+.54 The 1H,15NHSQC spectra of constructs derived from the two PAP proteins of different bacteria show remarkable similarities. (1) In the presence of Ag+ ions, some peaks exhibit significant downfield shifts and split up into two peaks with similar intensities. (2) The resonances of the tryptophan side chain (W30 in SilBNM2) are invisible in the spectra of the apo form and pop up as two peaks in slow conformational exchange in the lower left part of the spectrum in the presence of Ag+. (3) A characteristic glycine residue (G44 in SilB-NM2) with a 15N shift around 105 ppm also splits up into two peaks in the presence of metal ions. NMR experiments show that binding of Ag+ ions to SilB-NM and SilB-NMC and even to SilB-C constructs involves protein dynamics on different time scales. Besides the slow conformational exchange characterized in detail for Ag+−SilB-NM2, exchange was also observed for SilB-NM and SilB-NMC. Indeed, many cross-peaks belonging to residues within or close to the three methionine metal binding sites disappear from NMR spectra acquired in the presence of Ag+ ions, probably because of line broadening induced by slow conformational exchange. Finally, Ag+ titrations of the C-terminal CusF-like domain of SilB in the isolated form or within the SilB-NMC construct reveal that the system is in fast exchange at halfsaturation of the Ag+ binding site. Cross-peaks at intermediate positions are observed for some residues, whereas they disappear for others, as shown in Figure 3c and Figure S7 for SilB-NMC and SilB-C, respectively. Interestingly, the observations made for different SilB-C residues cannot be explained by a single exchange constant, suggesting that this is due to the metal hopping in and off its binding site and involves the conformational dynamics of the protein chain. In summary, when SilB-NM, SilB-NMC, and SilB-C are titrated with Ag+ ions, the resulting NMR spectra display chemical or conformational exchange in the intermediate or fast regime. This is unexpected for proteins with dissociation constants for metal binding in the tens of nanomolar range. Considering a two-state exchange between free and bound protein, one would expect to be in the slow exchange regime, in which spectra of both forms are simultaneously observed with relative intensities weighted by the populations. Observation of exchange processes in the intermediate or fast regime could indicate that changes in conformational entropy contribute to

the binding free energy. This contribution could be substantially different within the tripartite efflux complexes. How are the N- and the C-terminal domains of SilB organized at the surface of the tripartite SilCBA efflux complex? An increasing number of experimental data support a RND:PAP:OMF stoichiometry of 3:6:3 within the tripartite efflux systems.55,59−62 The crystal structure of the orthologous CusBA complex (PDB entry 3NE5)55 shows that the MP domains of the two CusB molecules that interact with a single CusA molecule largely cover the surface of the RND periplasmic domain (Figure S15B,C of the Supporting Information). In this structure, the first N-terminal visible residue (A79) of both CusB molecules is close to the periplasmic cleft that, in the open state, leads to the metal binding site of CusA. The metal binding site formed by M49, M64, and M66 in CusB is therefore located in the neighborhood of this cleft. The last C-terminal CusB residues detected in the CusBA structure (S400 in molecule 1 and S402 in molecule 2) are slightly more distant from the CusA metal binding pocket. Because of high degrees of sequence and function similarity, it is likely that E. coli CusBA and C. metallidurans SilBA complexes share the same conformation. In the study presented here, we demonstrated that Ag+ ions are transferred from the N-terminal metal site to the C-terminal CusF-like domain possibly involving transient formation of a very specific complex. This would then require the mobility of these two domains to allow their interaction at the surface of the SilAB complex. Periplasmic adaptor proteins are characterized by hinge flexibility at the interdomain linkers that notably facilitates interactions with their two partners.20,26,63−67 Our data show that the two- and three-domain constructs of SilB feature highly flexible linkers that connect individual domains, whose relative orientation appears to be completely unconstrained. The transfer of metal from the periplasm to SilA seems to require consecutive and specific interactions between the two metal binding domains of SilB, and with SilA. One could imagine that the N-terminal metal binding domain of SilB moves relative to the tripartite complex from one orientation promoting exchange of bound metal with the Cterminal domain to an orientation in which it interacts with the HME−RND protein to induce or stabilize the conformational switch leading to metal export. Long and flexible linkers connect the two metal binding domains of SilB to the MP domain. This flexibility could be conserved within the full functional complex and be a prerequisite for such interactions. Because of the apparent length of these linkers (approximately 15 and 20 residues for the flexible regions up- and downstream of the β-sheet structure of the MP domain, respectively), we cannot conclude whether the interaction between the two metal binding domains is intramolecular or involves neighboring SilB molecules. Interestingly, whereas Ag+ dissociation constants determined for the SilB metal sites are in the same range as those found for E. coli CusB and CusF proteins,19,68 the distribution of Ag+ ions between the N- and C-terminal metal sites differs from what has been reported for the E. coli Cus proteins. In the latter, a 50% distribution of the metal ions between CusB and CusF was observed, which could be explained by the comparable binding affinities of both proteins.19,22,54,68 Here, despite a higher metal binding affinity observed for the N-terminal site, fluorescence and NMR spectroscopies concordantly reveal that Ag+ ions are preferentially bound to the CusF-like C-terminal domain of SilB at equilibrium and are transferred from the N-terminal to L


Article

Biochemistry

between Ag+−SilB-NM and apo-SilB-C (Figure S12), quantification of slow chemical exchange rates for Ag+− SilB-NM2 (Figure S13), absolute chemical shift differences between backbone atoms of Ag+-bound SilB-NM2 form A and form B (Figure S14), and structure and environment of the membrane proximal domain (Figure S15) (PDF)

the C-terminal metal binding site. As demonstrated by our ITC measurements, this metal ion transfer could result from the interaction between the two domains that is only possible when the N- and C-terminal sites are in the metal-bound and the apo form, respectively. This process probably takes place in two steps: in the first one, in agreement with the respective binding affinities, the metal ions are bound to the N-terminal site of SilB; in the second step, the specific interaction between the empty C-terminal site and the metal-bound N-terminal site could influence the metal binding affinity of this latter, leading to the transfer of the metal ions to the C-terminal site. Consequently, Ag+ ions preferentially undergo a unidirectional transfer from the N- to C-terminal metal site of SilB, as demonstrated for the isolated domains by NMR and mass spectrometry. According to the switch model, this means that SilA would be activated only once the CusF-like C-terminal metal sites are saturated and metal starts to occupy the Nterminal binding site in SilB. This ensures that for each transport-competent SilA protein a Ag+-bound metal chaperone is present in the vicinity, leading to efficient metal export and preventing futile proton influx. In the orthologous system CusCFBA, the situation appears to be different, with the metal being distributed equivalently between the two sites. A proteomic study of a silver resistant E. coli strain showed that CusF is constitutively expressed at a level apparently higher than that of CusB.69 Thus, the experimentally observed 50% equilibrium distribution within an equimolar mixture of CusB and CusF in vitro would result in a redistribution of metal ions toward the metallochaperone, in excess in the E. coli periplasm. Therefore, in SilCBA as well as in CusCFBA, the metallochaperone presumably accumulates metal before the PAP undergoes its metal-dependent conformational switch that is required for activation of the RND component.

■

Accession Codes

Chemical shift assignments, restraint lists, and molecular coordinates have been deposited in the BioMagResBank under accession number 25658 and the Protein Data Bank as entry 5A4G.

■

AUTHOR INFORMATION

Corresponding Author

*Laboratory for the Structure and Function of Biological Membranes, Center for Structural Biology and Bioinformatics, Université Libre de Bruxelles, Boulevard du Triomphe CP 206/ 02, B-1050 Bruxelles, Belgium. Phone: +32 2 650 53 80. Fax: +32 2 650 53 82. E-mail: [email protected]. Funding

P.U. is a short-term postdoctoral researcher for the Fonds de le ̂ and Recherche Scientifique-FNRS. M.P. and E.G. are Maitre Directeur de Recherches at the FRS-FNRS, respectively. This work was supported by the Fonds de le Recherche ScientifiqueFNRS (FRFC 2.4577.12), the Commissariat à l’Energie Atomique et aux Energies Alternatives, le Centre National de la Recherche Scientifique, and l’Université Grenoble Alpes. This work used the platforms of the Grenoble Instruct center (ISBG; UMS 3518 CNRS-CEA-UJF-EMBL) with support from FRISBI (ANR-10-INSB-05-02) and GRAL (ANR-10-LABX49-01) within the Grenoble Partnership for Structural Biology (PSB). Financial support by the Access to Research Infrastructures activity in the 7th Framework Programme of the EC (Project 261863, Bio-NMR) for conducting the research is also acknowledged.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.6b00022. Protocol for the construction and force-field parameters of the nonstandard residue for the Ag+ site using CNS, NMR structural statistics for Ag+−SilB-NM2 (Table S1), multiple-sequence alignment of different PAPs (Figure S1), SDS−PAGE and mass spectra of the purified proteins (Figure S2), native mass spectra of the proteins in the presence of Ag+ or Cu+ (Figure S3), titration of AgNO3 into SilB-NM2 and SilB-C monitored by ITC (Figure S4), comparison of the 1H,15N-HSQC spectra of apo-SilB-NM and Ag+−SilB-NM and −SilB-NM2 centered in the region of methionine methyl correlation peaks (Figure S5), superposition of 1H,15N-HSQC spectra of SilB-NMC, SilB-NM, and SilB-C in the absence of metal ions (Figure S6), 1H,15N-HSQC spectra of the Ag+ titration of SilB-C (Figure S7), weighted chemical shift differences between amide groups of the C-terminal domain of apo-SilB-NMC and Ag+−SilBNMC (Figure S8), ESI mass spectra of a mixture of SilBC and SilB-NM, and SilB-C and SilB-NM2 in the presence of Ag+ (Figure S9), domain−domain interaction of SilB-NM and SilB-C monitored by ITC (Figure S10), transfer of metal ions between Ag+−SilBNM and SilB-C monitored by MS (Figure S11), metal exchange

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to Dr. Abel Garcia-Pino for helpful discussions and assistance during the ITC measurements and to Dr. Adrien Favier for his expertise and assistance with the setup of the NMR experiments.

■

ABBREVIATIONS ESI-MS, electrospray ionization mass spectrometry; HEPES, 2[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid; HME, heavy metal efflux; IPTG, isopropyl β-D-1-thiogalactopyranoside; ITC, isothermal titration calorimetry; MES, 2-(Nmorpholino)ethanesulfonic acid; MP, membrane proximal; NMR, nuclear magnetic resonance; OMF, outer membrane factor; PAP, periplasmic adaptor protein; PCR, polymerase chain reaction; PDB, Protein Data Bank; RND, resistance− nodulation−cell division; SEC, size exclusion chromatography.

■

REFERENCES

(1) Silver, S. (2003) Bacterial silver resistance: Molecular biology and uses and misuses of silver compounds. FEMS Microbiol. Rev. 27, 341− 353.

M


Article

Biochemistry (2) Gupta, A., Matsui, K., Lo, J. F., and Silver, S. (1999) Molecular basis for resistance to silver cations in Salmonella. Nat. Med. 5, 183− 188. (3) Larkin McHugh, G., Moellering, R. C., Hopkins, C. C., and Swartz, M. N. (1975) Salmonella typhimurium resistant to silver nitrate, chloramphenicol, and ampicillin. Lancet 305, 235−240. (4) Franke, S., Grass, G., Rensing, C., and Nies, D. H. (2003) Molecular analysis of the copper-transporting efflux system CusCFBA of Escherichia coli. J. Bacteriol. 185, 3804−3812. (5) Monsieurs, P., Hobman, J. L., Vandenbussche, G., Mergeay, M., and Van Houdt, R. (2015) Response of Cupriavidus metallidurans CH34 to metals. In Metal Response in Cupriavidus metallidurans, Vol. I (Mergeay, M., and Van Houdt, R., Eds.) pp 45−89, Springer International Publishing AG, Cham, Switzerland. (6) Nies, D. H., Rehbein, G., Hoffmann, T., Baumann, C., and Grosse, C. (2006) Paralogs of genes encoding metal resistance proteins in Cupriavidus metallidurans strain CH34. J. Mol. Microbiol. Biotechnol. 11, 82−93. (7) Delmar, J. A., Su, C.-C., and Yu, E. W. (2013) Structural mechanisms of heavy-metal extrusion by the Cus efflux system. BioMetals 26, 593−607. (8) Vandenbussche, G., Mergeay, M., and Van Houdt, R. (2015) Insights into the structure-function relationship of proteins. In Metal Response in Cupriavidus metallidurans, Vol. II (Mergeay, M., and Van Houdt, R., Eds.) pp 1−70, Springer International Publishing AG, Cham, Switzerland. (9) Symmons, M. F., Marshall, R. L., and Bavro, V. N. (2015) Architecture and roles of periplasmic adaptor proteins in tripartite efflux assemblies. Front. Microbiol. 6, 513. (10) Dinh, T., Paulsen, I. T., and Saier, M. H. (1994) A family of extracytoplasmic proteins that allow transport of large molecules across the outer membranes of gram-negative bacteria. J. Bacteriol. 176, 3825−3831. (11) Misra, R., and Bavro, V. N. (2009) Assembly and transport mechanism of tripartite drug efflux systems. Biochim. Biophys. Acta, Proteins Proteomics 1794, 817−825. (12) Janganan, T. K., Zhang, L., Bavro, V. N., Matak-Vinkovic, D., Barrera, N. P., Burton, M. F., Steel, P. G., Robinson, C. V., BorgesWalmsley, M. I., and Walmsley, A. R. (2011) Opening of the outer membrane protein channel in tripartite efflux pumps is induced by interaction with the membrane fusion partner. J. Biol. Chem. 286, 5484−5493. (13) Weeks, J. W., Bavro, V. N., and Misra, R. (2014) Genetic assessment of the role of AcrB β-hairpins in the assembly of the TolCAcrAB multidrug efflux pump of Escherichia coli. Mol. Microbiol. 91, 965−975. (14) Xu, Y., Moeller, A., Jun, S.-Y., Le, M., Yoon, B.-Y., Kim, J.-S., Lee, K., and Ha, N.-C. (2012) Assembly and channel opening of outer membrane protein in tripartite drug efflux pumps of Gram-negative bacteria. J. Biol. Chem. 287, 11740−11750. (15) Zgurskaya, H. I., and Nikaido, H. (1999) Bypassing the periplasm: reconstitution of the AcrAB multidrug efflux pump of Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 96, 7190−7195. (16) Aires, J. R., and Nikaido, H. (2005) Aminoglycosides are captured from both periplasm and cytoplasm by the AcrD multidrug efflux transporter of Escherichia coli. J. Bacteriol. 187, 1923−1929. (17) Verchère, A., Broutin, I., and Picard, M. (2012) Photo-induced proton gradients for the in vitro investigation of bacterial efflux pumps. Sci. Rep. 2, 306. (18) Balakrishnan, L., Hughes, C., and Koronakis, V. (2001) Substrate-triggered recruitment of the TolC channel-tunnel during type I export of hemolysin by Escherichia coli. J. Mol. Biol. 313, 501− 510. (19) Bagai, I., Liu, W., Rensing, C., Blackburn, N. J., and McEvoy, M. M. (2007) Substrate-linked conformational change in the periplasmic component of a Cu(I)/Ag(I) efflux system. J. Biol. Chem. 282, 35695− 35702. (20) De Angelis, F., Lee, J. K., O’Connell, J. D., Miercke, L. J. W., Verschueren, K. H., Srinivasan, V., Bauvois, C., Govaerts, C., Robbins,

R. A., Ruysschaert, J.-M., Stroud, R. M., and Vandenbussche, G. (2010) Metal-induced conformational changes in ZneB suggest an active role of membrane fusion proteins in efflux resistance systems. Proc. Natl. Acad. Sci. U. S. A. 107, 11038−11043. (21) Kim, E.-H. H., Nies, D. H., McEvoy, M. M., and Rensing, C. (2011) Switch or funnel: How RND-type transport systems control periplasmic metal homeostasis. J. Bacteriol. 193, 2381−2387. (22) Bagai, I., Rensing, C., Blackburn, N. J., and McEvoy, M. M. (2008) Direct metal transfer between periplasmic proteins identifies a bacterial copper chaperone. Biochemistry 47, 11408−11414. (23) Chacón, K. N., Mealman, T. D., McEvoy, M. M., and Blackburn, N. J. (2014) Tracking metal ions through a Cu/Ag efflux pump assigns the functional roles of the periplasmic proteins. Proc. Natl. Acad. Sci. U. S. A. 111, 15373−15378. (24) Mealman, T. D., Bagai, I., Singh, P., Goodlett, D. R., Rensing, C., Zhou, H., Wysocki, V. H., and McEvoy, M. M. (2011) Interactions between CusF and CusB identified by NMR spectroscopy and chemical cross-linking coupled to mass spectrometry. Biochemistry 50, 2559−2566. (25) Loftin, I. R., Franke, S., Blackburn, N. J., and McEvoy, M. M. (2007) Unusual Cu(I)/Ag(I) coordination of Escherichia coli CusF as revealed by atomic resolution crystallography and X-ray absorption spectroscopy. Protein Sci. 16, 2287−2293. (26) Su, C.-C., Yang, F., Long, F., Reyon, D., Routh, M. D., Kuo, D. W., Mokhtari, A. K., Van Ornam, J. D., Rabe, K. L., Hoy, J. a, Lee, Y. J., Rajashankar, K. R., and Yu, E. W. (2009) Crystal structure of the membrane fusion protein CusB from Escherichia coli. J. Mol. Biol. 393, 342−355. (27) Ucisik, M. N., Chakravorty, D. K., and Merz, K. M. (2013) Structure and dynamics of the N-terminal domain of the Cu(I) binding protein CusB. Biochemistry 52, 6911−6923. (28) Greene, N. P., Hinchliffe, P., Crow, A., Ababou, A., Hughes, C., and Koronakis, V. (2013) Structure of an atypical periplasmic adaptor from a multidrug efflux pump of the spirochete Borrelia burgdorferi. FEBS Lett. 587, 2984−2988. (29) Hinchliffe, P., Greene, N. P., Paterson, N. G., Crow, A., Hughes, C., and Koronakis, V. (2014) Structure of the periplasmic adaptor protein from a major facilitator superfamily (MFS) multidrug efflux pump. FEBS Lett. 588, 3147−3153. (30) Bersch, B., Derfoufi, K.-M., De Angelis, F., Auquier, V., Ngonlong Ekendé, E., Mergeay, M., Ruysschaert, J.-M., and Vandenbussche, G. (2011) Structural and metal binding characterization of the C-terminal metallochaperone domain of membrane fusion protein SilB from Cupriavidus metallidurans CH34. Biochemistry 50, 2194−2204. (31) Sali, A., and Blundell, T. L. (1993) Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779− 815. (32) Pei, J., Kim, B.-H., and Grishin, N. V. (2008) PROMALS3D: a tool for multiple protein sequence and structure alignments. Nucleic Acids Res. 36, 2295−2300. (33) Laskowski, R., MacArthur, M., Moss, D., and Thornton, J. (1993) PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 26, 283−291. (34) Markley, J. L., Bax, A., Arata, Y., Hilbers, C. W., Kaptein, R., Sykes, B. D., Wright, P. E., and Wüthrich, K. (1998) Recommendations for the presentation of NMR structures of proteins and nucleic acids. J. Mol. Biol. 280, 933−952. (35) Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G., Pfeifer, J., and Bax, A. (1995) NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR 6, 277−293. (36) Johnson, B. A., and Blevins, R. A. (1994) NMR View: A computer program for the visualization and analysis of NMR data. J. Biomol. NMR 4, 603−614. (37) Vranken, W. F., Boucher, W., Stevens, T. J., Fogh, R. H., Pajon, A., Llinas, M., Ulrich, E. L., Markley, J. L., Ionides, J., and Laue, E. D. (2005) The CCPN data model for NMR spectroscopy: development of a software pipeline. Proteins: Struct., Funct., Genet. 59, 687−696. N


Article

Biochemistry (38) Solyom, Z., Schwarten, M., Geist, L., Konrat, R., Willbold, D., and Brutscher, B. (2013) BEST-TROSY experiments for time-efficient sequential resonance assignment of large disordered proteins. J. Biomol. NMR 55, 311−321. (39) Farrow, N. A., Muhandiram, R., Singer, A. U., Pascal, S. M., Kay, C. M., Gish, G., Shoelson, S. E., Pawson, T., Forman-Kay, J. D., and Kay, L. E. (1994) Backbone dynamics of a free and phosphopeptidecomplexed Src homology 2 domain studied by 15N NMR relaxation. Biochemistry 33, 5984−6003. (40) Mulder, F., de Graaf, R. A., Kaptein, R., and Boelens, R. (1998) An off-resonance rotating frame relaxation experiment for the investigation of macromolecular dynamics using adiabatic rotations. J. Magn. Reson. 131, 351−357. (41) Montelione, G. T., and Wagner, G. (1989) 2D Chemical exchange NMR spectroscopy by proton-detected heteronuclear correlation. J. Am. Chem. Soc. 111, 3096−3098. (42) Schanda, P., Van Melckebeke, H., and Brutscher, B. (2006) Speeding up three-dimensional protein NMR experiments to a few minutes. J. Am. Chem. Soc. 128, 9042−9043. (43) Serrano, P., Pedrini, B., Mohanty, B., Geralt, M., Herrmann, T., and Wüthrich, K. (2012) The J-UNIO protocol for automated protein structure determination by NMR in solution. J. Biomol. NMR 53, 341− 354. (44) Herrmann, T., Güntert, P., and Wüthrich, K. (2002) Protein NMR structure determination with automated NOE assignment using the new software CANDID and the torsion angle dynamics algorithm DYANA. J. Mol. Biol. 319, 209−227. (45) Herrmann, T., Güntert, P., and Wüthrich, K. (2002) Protein NMR structure determination with automated NOE-identification in the NOESY spectra using the new software ATNOS. J. Biomol. NMR 24, 171−189. (46) Güntert, P., Mumenthaler, C., and Wüthrich, K. (1997) Torsion angle dynamics for NMR structure calculation with the new program DYANA. J. Mol. Biol. 273, 283−298. (47) Linge, J. P., Habeck, M., Rieping, W., and Nilges, M. (2003) ARIA: automated NOE assignment and NMR structure calculation. Bioinformatics 19, 315−316. (48) Rieping, W., Habeck, M., Bardiaux, B., Bernard, A., Malliavin, T. E., and Nilges, M. (2007) ARIA2: automated NOE assignment and data integration in NMR structure calculation. Bioinformatics 23, 381− 382. (49) Singh, S. K., Roberts, S. A., McDevitt, S. F., Weichsel, A., Wildner, G. F., Grass, G. B., Rensing, C., and Montfort, W. R. (2011) Crystal structures of multicopper oxidase CueO bound to copper(I) and silver(I): functional role of a methionine-rich sequence. J. Biol. Chem. 286, 37849−37857. (50) Leung, B. O., Jalilehvand, F., Mah, V., Parvez, M., and Wu, Q. (2013) Silver(I) complex formation with cysteine, penicillamine, and glutathione. Inorg. Chem. 52, 4593−4602. (51) Hutchinson, E. G., and Thornton, J. M. (1994) A revised set of potentials for beta-turn formation in proteins. Protein Sci. 3, 2207− 2216. (52) Sarret, G., Favier, A., Covès, J., Hazemann, J. L., Mergeay, M., and Bersch, B. (2010) CopK from Cupriavidus metallidurans CH34 binds Cu(I) in a tetrathioether site: characterization by X-ray absorption and NMR spectroscopy. J. Am. Chem. Soc. 132, 3770−3777. (53) Pelton, J. G., Torchia, D. A., Meadow, N. D., and Roseman, S. (1993) Tautomeric states of the active-site histidines of phosphorylated and unphosphorylated IIIGlc, a signal-transducing protein from Escherichia coli, using two-dimensional heteronuclear NMR techniques. Protein Sci. 2, 543−558. (54) Mealman, T. D., Zhou, M., Affandi, T., Chacón, K. N., Aranguren, M. E., Blackburn, N. J., Wysocki, V. H., and McEvoy, M. M. (2012) N-Terminal region of CusB is sufficient for metal binding and metal transfer with the metallochaperone CusF. Biochemistry 51, 6767−6775. (55) Su, C.-C., Long, F., Zimmermann, M. T., Rajashankar, K. R., Jernigan, R. L., and Yu, E. W. (2011) Crystal structure of the CusBA heavy-metal efflux complex of Escherichia coli. Nature 470, 558−562.

(56) Suzek, B. E., Huang, H., McGarvey, P., Mazumder, R., and Wu, C. H. (2007) UniRef: comprehensive and non-redundant UniProt reference clusters. Bioinformatics 23, 1282−1288. (57) Shen, Y., Delaglio, F., Cornilescu, G., and Bax, A. (2009) TALOS+: a hybrid method for predicting protein backbone torsion angles from NMR chemical shifts. J. Biomol. NMR 44, 213−223. (58) Holm, L., and Rosenström, P. (2010) Dali server: conservation mapping in 3D. Nucleic Acids Res. 38, W545−549. (59) Rensing, C., Pribyl, T., and Nies, D. H. (1997) New functions for the three subunits of the CzcCBA cation-proton antiporter. J. Bacteriol. 179, 6871−6879. (60) Narita, S. I., Eda, S., Yoshihara, E., and Nakae, T. (2003) Linkage of the efflux-pump expression level with substrate extrusion rate in the MexAB-OprM efflux pump of Pseudomonas aeruginosa. Biochem. Biophys. Res. Commun. 308, 922−926. (61) Stegmeier, J. F., Polleichtner, G., Brandes, N., Hotz, C., and Andersen, C. (2006) Importance of the adaptor (membrane fusion) protein hairpin domain for the functionality of multidrug efflux pumps. Biochemistry 45, 10303−10312. (62) Janganan, T. K., Bavro, V. N., Zhang, L., Matak-Vinkovic, D., Barrera, N. P., Venien-Bryan, C., Robinson, C. V., Borges-Walmsley, M. I., and Walmsley, A. R. (2011) Evidence for the assembly of a bacterial tripartite multidrug pump with a stoichiometry of 3:6:3. J. Biol. Chem. 286, 26900−26912. (63) Higgins, M. K., Bokma, E., Koronakis, E., Hughes, C., and Koronakis, V. (2004) Structure of the periplasmic component of a bacterial drug efflux pump. Proc. Natl. Acad. Sci. U. S. A. 101, 9994− 9999. (64) Akama, H., Matsuura, T., Kashiwagi, S., Yoneyama, H., Narita, S.-I., Tsukihara, T., Nakagawa, A., and Nakae, T. (2004) Crystal structure of the membrane fusion protein, MexA, of the multidrug transporter in Pseudomonas aeruginosa. J. Biol. Chem. 279, 25939− 25942. (65) Vaccaro, L., Koronakis, V., and Sansom, M. S. P. (2006) Flexibility in a drug transport accessory protein: molecular dynamics simulations of MexA. Biophys. J. 91, 558−564. (66) Mikolosko, J., Bobyk, K., Zgurskaya, H. I., and Ghosh, P. (2006) Conformational flexibility in the multidrug efflux system protein AcrA. Structure 14, 577−587. (67) Symmons, M. F., Bokma, E., Koronakis, E., Hughes, C., and Koronakis, V. (2009) The assembled structure of a complete tripartite bacterial multidrug efflux pump. Proc. Natl. Acad. Sci. U. S. A. 106, 7173−7178. (68) Kittleson, J. T., Loftin, I. R., Hausrath, A. C., Engelhardt, K. P., Rensing, C., and McEvoy, M. M. (2006) Periplasmic metal-resistance protein CusF exhibits high affinity and specificity for both CuI and AgI. Biochemistry 45, 11096−11102. (69) Lok, C. N., Ho, C. M., Chen, R., Tam, P. K. H., Chiu, J. F., and Che, C. M. (2008) Proteomic identification of the Cus system as a major determinant of constitutive Escherichia coli silver resistance of chromosomal origin. J. Proteome Res. 7, 2351−2356. (70) Kulathila, R., Kulathila, R., Indic, M., and van den Berg, B. (2011) Crystal structure of Escherichia coli CusC, the outer membrane component of a heavy metal efflux pump. PLoS One 6, e15610.

O


Cu+ Binding

Recommend Documents