Cu2-xS for Multimode Imaging Diagnostic and

Subscriber access provided by Kaohsiung Medical University

Biological and Medical Applications of Materials and Interfaces

Intelligent MnO2/Cu2-xS for Multimode Imaging Diagnostic and Advanced Single-Laser Irradiated Photothermal-/Photodynamic Therapy Yu Cao, Xiangdan Meng, Dongdong Wang, Kai Zhang, Wenhao Dai, HaiFeng Dong, and Xueji Zhang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b05050 • Publication Date (Web): 08 May 2018 Downloaded from http://pubs.acs.org on May 8, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Intelligent MnO2/Cu2-xS for Multimode Imaging Diagnostic and Advanced Single-Laser Irradiated Photothermal-/Photodynamic Therapy Yu Cao, Xiangdan Meng, Dongdong Wang, Kai Zhang, Wenhao Dai, Haifeng Dong*, Xueji Zhang*

Beijing Key Laboratory for Bioengineering and Sensing Technology, Research Center for Bioengineering and Sensing Technology, School of Chemistry & Biological Engineering University of Science & Technology Beijing, Beijing 100083, P.R. China

KEYWORDS: Multimodal imaging; RNA interference; Photothermal/photodynamic therapy; MiRNA detection; Manganese dioxide/copper sulfide.

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Lately, photothermal therapy (PTT) and photodynamic therapy (PDT) dual-modal therapy has attracted much attention in cancer therapy as a synergistic therapeutic model. However, the integration of PDT and PTT in single nanoagent for cancer therapy is still a challenging task. Herein, an intelligent MnO2/Cu2-xS-siRNA nanoagent simultaneously overcoming inherent limitations of PDT and PTT with remarkable PTT/PDT therapeutic efficiency enabling multimode accurate tumor imaging diagnostic is designed. We first develop a general method to decorate Cu2-xS on the surface of MnO2 nanosheet (MnO2/Cu2-xS), then, it was loaded with heat shock protein (HSP) 70 siRNA to obtain MnO2/Cu2-xS-siRNA. The intracellular microRNA (miRNA) imaging can be realized by loading miRNA detection probes. In the tumor acidic microenvironment, the MnO2 is reduced to Mn2+ ion, and trigger the decomposition of H2O2 into O2 to relieve tumor hypoxia. The reduced Mn2+ ions significantly enhance magnetic resonance imaging (MRI) contrast and the Cu2-xS acts as a powerful photoacoustic (PA) and photothermal (PT) imaging agent, leading to tri-modal accurate tumor-specific imaging and detection. Under a single NIR laser irradiation, the nanosystem exhibits superiority of PTT/PDT efficiency owing to siRNA-mediated blocked heat-shock response and MnO2-related relieved tumor hypoxia. This work highlights the great promise of modulating tumor cellular defense mechanism and microenvironment with intelligent multifunctional nanoagents to achieve a comprehensive fighting cancer effect.


Page 2 of 30

Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Despite great efforts have been devoted to identify an efficient approach to fight against cancer over the past decades, precise detection and treatment of cancer at an early stage is still a big challenging task.

1-3

The combined use of complementary

multimodel imaging diagnostic, such as magnetic resonance imaging (MRI) 4, 5, X-ray computed tomography (CT) imaging

6, 7

and photoacoustic imaging (PAI)

therapeutic functions of surgery, chemotherapy phototherapy 14, 15

10, 11

, radiotherapy

8, 9

, and

12, 13

and

in one single intelligent multifunctional theranostic platforms are

highly desirable. Among the emerging theranostic approaches, integrating the noninvasive phototherapy mainly including photothermal therapy (PTT) and photodynamic therapy (PDT) with additional multimodal imaging components that allow simultaneous accurate monitoring and cancer destruction with enhanced cancer killing specificity and reduced side effects have become considerably attractive. 16-19 As a noninvasive therapeutic model, nanomaterials-mediated PTT is a hyperthermia treatment of tumorigenic cells to thermally ablate them with spatiotemporal selectivity and remote-control properties.

20-22

However, hyperthermia

treated cells have been confirmed to readily acquire tolerance to heat stress by heat shock response in mean of producing rapidly heat shock protein (HSP), termed as thermoresistance, leading to therapeutic resistance and reduced therapeutic efficacy. 23-25

As for PDT, it utilizes the reactive oxygen species (ROS) such as 1O2 produced

by photosensitizer (PS) that transfers the photon energy to surrounding oxygen molecules under appropriate light irradiation to locally kill cancer cells.

26

Clinic

practical application of PDT is often limited by the unsolved challenges like the local hypoxia of tumors and limited penetration depth of light.

27-29

Lately, the dual PDT

and PTT for anti-cancer treatment becomes the subject of interest due to the enhanced



anti-cancer synergetic therapeutic effect. 30-33 Although considerable efforts have been made in this field, achieving combined PDT/PTT in single smart nanoagents overcoming inherent limitations of PDT and PTT is still a challenge. Herein, we report an intelligent MnO2/Cu2-xS-siRNA nanoagents with simultaneously remarkable PTT/PDT synergetic therapeutic efficiency as well as multimode accurate tumor imaging diagnostic through an engineering design. In this system, as an ideal nanoagent for cancer therapy,12, 34, 35 NIR plasmonic colloidal Cu2-xS was in situ decorated on the surface of MnO2 nanosheet (MnO2/Cu2-xS), after surface modification, siRNA of heat shock protein (HSP) 70 was loaded to obtain MnO2/Cu2-xS-siRNA (Scheme 1). In the tumor microenvironment, the MnO2 nanostructure would be reduced into Mn2+ and trigger the decomposition of H2O2 to generate O2. The Mn2+ enhanced T1-magnetic resonance imaging (MRI) contrast,

36, 37

and the released Cu2-xS exhibited great ability for photoacoustic

imaging (PAI) and photothermal imaging (PTI) due to the distinct surface plasmon resonance (SPR) band at NIR region,

16, 38

allowing tumor-specific imaging and

detection. The larger surface exhibited great feasibility for intracellular cancer-related miRNA imaging by carrying detection probes. Under NIR laser irradiation, the NIR plasmonic colloidal Cu2-xS acted as an emerging PT agent for PTT and concomitantly generated elevated ROS levels for parallel PDT. Importantly, the loaded siRNA are able to block the heat-shock response and MnO2-triggered O2 generation relieves tumor hypoxia, which concurrently overcomes the inherent primary limitation of PTT and PDT. The in vitro and in vivo studies revealed remarkably anticancer efficacy of the dual action of PTT and PDT triggered by single NIR laser light. This work highlights the potential of MnO2/Cu2-xS-siRNA nanoagent for multimodal imaging-guided enhanced synergetic


Page 4 of 30

Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PTT&PDT.

Scheme 1. Schematic presentation of MnO2/Cu2-xS-siRNA nano platform for multiplexed imaging, intracellular miRNA detection and advanced single-laser irradiated Photothermal-/Photodynamic Therapy.

EXPERIMENTAL SECTION

Synthesis of PEG-MnO2 nanosheets. The MnO2 nanosheets were synthesized as in previous reports with some modification. 37, 39 In brief, 20 mL of 0.6 M tetramethylammonium hydroxide and 3 wt % H2O2 mixed solution was added into 10 mL of 0.3 M MnCl2 solution within 15 s. The color of the solution changed to dark brown immediately, indicating that Mn2+ was oxidized to Mn4+. The resulting suspension was stirred vigorously overnight at room temperature. The as-prepared bulk manganese dioxide was centrifuged at 2000 rpm for 10 minutes and washed with



Page 6 of 30

copious amounts of distilled water and methanol for 3 times. After that, the bulk manganese dioxide was vacuum dried at 60 oC and kept for use. In order to get the MnO2 nanosheets, 20 mL bulk MnO2 aqueous solution (0.5 mg/mL) was ultrasonicated (1000 W) for 2 h with ultrasonic cell disruptor. Then the dispersion was centrifuged at 2000 rpm for 15 min, and the supernatant was kept for further use. For PEGylation, the PEG5000-NH2 was added into MnO2 nanosheets aqueous solution and the solution was ultrasonicated for 4h, then the step was repeated for three times to guarantee the efficient PEGylation.

Synthesis of PEGylated MnO2/Cu2-xS. The Cu2-xS was grew onto the surface of the MnO2 nanosheets as in previous method with some modification.

40, 41

In brief, 10 mL of CuCl2∙5H2O aqueous solution (1 mM) was added to 1 mL of MnO2-PEG solution (1.0 mg/mL) under stirring in a three-neck flask, and stirred for 30 min. Then, 100 µL of Na2S solution (0.1 M) was added into the reaction solution under stirring and kept for 10 min. Then the mixture was heated to 90 oC and stirred for 15 min until the color of the solution changed to dark-green. Finally, the resulting mixture was centrifuged under 11000 rpm for 15 min and washed with water for three times. The resulting MnO2/Cu2-xS were obtained and stored at 4 oC for further use.

Characterizations of MnO2/Cu2-xS. The morphologies of MnO2 sheets and MnO2/Cu2-xS were recorded with atomic force microscopy (AFM) (Nanoscope IIIa, USA) under tapping mode and a FEIF20 transmission electron microscope (TEM) (FEI, USA). The X-ray-photoelectron spectroscopy (XPS) analysis was examined with an ESCALAB 250 spectrometer (Thermo-VG Scientific, USA). X-ray diffraction (XRD) pattern was examined with a Bruker-AXS X-ray diffractometer with Cu Kα radiation (λ = 1.5418 Å). Fourier transform infrared spectra (FTIR) was recorded on Nicolet 400 Fourier transform infrared spectrometer (Madison, WI). The


Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UV−visible (UV−vis) absorption analysis was recorded with an UV-1800 spectrophotometer (Shimadzu, Japan). All the fluorescence measurements were carried out a confocal laser scanning fluorescence microscope (CLSM, FV1200, Olympus, Japan).

Cell Viability. The cells were cultured and treated as in our previous report.38,46 A549 and MCF-7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% (v/v) fetal bovine serum (FBS) and 1% antibiotics (penicillin and streptomycin) at 37 °C in a humidified atmosphere containing 5% CO2. 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay was carried out to estimate the cell viability. In brief, A549 cells and MCF-7 cells (1.0 × 105 cells per well) were first seeded in a 96-well plate for 24 h containing 100 µL DMEM with 10% (v/v) FBS and 1% antibiotics in each well. Then Opti-MEM medium containing MnO2/Cu2-xS at different concentrations (0, 25, 50, 100, 200 and 400 µg/mL) were added to each well to replace the DMEM medium and incubated for another 4 h. Afterward, the medium was replaced with fresh DMEM and cultured for another 12 h. Then, 10 µL MTT (5 mg/mL) was added to each well and incubated for another 4 h. Afterward, the media were removed, the existing crystal violet was solubilized by adding 100 µL dimethyl sulfoxide (DMSO). Then, the absorbance at 492 nm was detected to determine cell viability.

Photothermal Performance of the MnO2/Cu2-xS. The photothermal performance was performed as in our previous report.38,46 In brief, the quartz cuvette containing 1 mL MnO2/Cu2-xS aqueous solution(100 µg/mL) was irradiated with NIR laser at a power of 0.72 W/cm2, an OMEGA 4-channel datalogger thermometer was used to detect the temperature of the of the solution. An infrared camera was carried out to take the thermal images.



Page 8 of 30

Intracellular MiRNA Imaging. The intracellular miRNA detection was performed as in our previous report.38,46 After the cultivation of A549 cells , MDA-MB-231 cells and NHDF cells for 12 h in confocal dishes, 1 mL of Opti-MEM medium containing MnO2/Cu2-xS (100 µg/mL, 50 nM loaded MB) was added to remove the medium and cultivated for another 4 h. After washing with PBS (10 mM, pH 7.4) twice, 1 mL fresh DMEM medium with 10% (v/v) FBS and 1% antibiotics was added to the dish and cultivated for another 12 h. Then, the cell images were taken by using a CLSM. Excitation of the nuclei and the MB was performed with laser at 405 and 488 nm.

Cell uptake of MnO2/Cu2-xS-siRNA and Evaluation of Gene Silencing Efficiency. The sequences were as follow: HSP 70 siRNA: 5’-AAC UUG CUA AGA AUC AUG GAA-3’ (Synthesized by GenePharma, Shanghai, China). After the A549 cells incubated with MnO2/Cu2-xS-siRNAFAM (100 µg/mL, 50 nM loaded siRNA) as same as the previous steps, the cellular uptake of MnO2/Cu2-xS-siRNAFAM was analyzed by using a CLSM. The cells were cultured as in our previous report.38,46 To evaluate the gene silencing efficiency, after the cultivation of A549 cells for 24 h, the 1 mL of fresh Opti-MEM containing PBS (10 mM, pH 7.4), MnO2/Cu2-xS (100 µg/mL) and MnO2/Cu2-xS-siRNA (100 µg/mL) was then respectively added to replace the medium and cultivated for 4 h. After washing with PBS twice, 1 mL of fresh DMEM medium with 10% (v/v) FBS and 1% antibiotics was added and cultured for another 12 h. After with NIR laser irradiation or not, the expression of HSP 70 on the mRNA and protein levels was detected by real-time quantitative PCR, immunostaining analysis and western blotting. The primer sequences in the real-time quantitative PCR were as follow:

forward

(5’-3’)

ACCAAGCAGACGCAGATCTTC,


reverse

(5’-3’)

Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CGCCCTCGTACACCTGGAT. The primary antibody against HSP 70 were obtained from Thermo Fisher Scientific.

Immunofluorescent analysis of Heat Shock Protein 70. The cells were cultured as in our previous report.38,46 In brief, after the cultivation of A549 cells for 24 h, the fresh Opti-MEM (1 mL) containing PBS (10 mM, pH 7.4) or MnO2/Cu2-xS (100 µg/mL) or MnO2/Cu2-xS-siRNA (100 µg/mL) was added to replace the medium and cultivated for 4 h. After washing with PBS twice, 1 mL of fresh DMEM medium with 10% (v/v) FBS and 1% antibiotics was added and cultured for another 12 h. After different treatments (with or without a 980 nm NIR laser irradiation for 10 min), the cells were fixed with formaldehyde and then cultured with 0.2% Triton X-100 for 5 min prior to staining. Cells were probed with the primary anti-HSP70 (1:5000, A0240, Beyotime) at a dilution of 1:200 overnight at 4 °C, and then was washed with PBS(10 mM, pH 7.4) and incubated with a DyLight-488 conjugated secondary antibody for another 30 min. Then the cells images were taken by using a CLSM.

Western blots. The western blots were performed as in previous report.23 The harvested cells were lysed by using repeated freezing and thawing method. After collecting the denatured protein, the concentrations of collected protein were detected using the BCA Protein Assay Kit (Beyotime Institute of Biotechnology, China). Subsequently,

30

µg

of

protein

was

separated

using

a

10%

sodium

dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membrane. Then the 5% nonfat dry milk was used to block the membrane to prevent nonspecific binding. After the blocked membrane was incubated with the primary anti-HSP70 (1:5000, A0240, Beyotime) at 4 oC overnight, the membrane was incubated with horseradish peroxidase-conjugated goat anti-mouse



secondary antibody for 30 min at room temperature. Finally, the protein were visualized with a chemiluminescence kit and photographed.

Photodynamic Performance of the MnO2/Cu2-xS. The photodynamic performance was performed as in our previous report.46 To detect 1O2, 20 µL 1,3-diphenylisobenzofuran (DPBF) solution (10 mM in DMF) was added to 2 mL of Cu2-xS or MnO2/Cu2-xS solutions (100 µg/mL). The water was set as the control. With the irradiation of 980 nm NIR laser (0.72 W/cm2), the UV-vis absorbance spectra of the solution was measured every minute for 10 min. ESR was recorded on a Bruker-E500 ESR spectrometer by detecting 2,2,6,6-tetramethylpiperide (TEMP) to estimate 1O2 generation, which had typical triplet ESR signal. In a typical experiment, 20 µL TEMP was mixed with 100 µL Cu2-xS or MnO2/Cu2-xS solutions (100 µg/mL). Then samples were injected into quartz capillaries and irradiated with 980 nm NIR laser for 5 min. Furthermore, the intracellular 1O2 production ability was measured by using the singlet oxygen sensor green (SOSG) regent as in our previous report.46 After the transfection of MnO2/Cu2-xS and Cu2-xS, A549 cells were irradiated with 980 nm laser (0.72 W/cm2) for 5 min. Then, the cells were stained with 2 mM of SOSG for 15 min after washing with PBS thrice. The nuclei was dyed with Hoechest 33342. Then the cells images were taken by using a CLSM. Excitation of the nuclei and the SOSG was performed with laser at 405 and 488 nm.

In Vitro PTT&PDT Therapy. After the cultivation of A549 cells for 24 h, the cells were incubated with Cu2-xS, MnO2/Cu2-xS solutions (100 µg/mL) or PBS for 4 h in opti-MEM. After NIR laser irradiating for 5 min, the cells were cultured for another 12 h. Then the MTT assay was carried out to determine the cell viability after incubation for another 24 h.


Page 10 of 30

Page 11 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For live/dead cell staining assay, A549 cells were seeded in a culture dish and cultured for 24 h and then the cells were incubated with Cu2-xS, MnO2/Cu2-xS solutions (100 µg/mL) or PBS for 4 h in opti-MEM. Then the culture medium was refreshed with fresh DMEM, and the cells were incubated with or without NIR laser irradiation for 5 min. Then all cells were dyed with calcein-AM (4 µM) and PI solutions (4 µM) for 15 min. Finally, the cells were washed with PBS three times and imaged by CLSM. Excitation of the calcein-AM and PI was performed with lasers at 488 and 543 nm, respectively.

In Vivo PTT&PDT Therapy. The in vivo experiment was performed as in our previous report.38 Female BALB/c nude mice (4 weeks old) were bought from Beijing Vital River Laboratory Animal Technology Co., Ltd. All the animal experiments were performed in agreement with the Use Committee of the Beijing institute of Basic Medical Science (Beijing, China) and the Institutional Animal Care. The tumors were obtained by subcutaneously injecting 5 x 106 B16 cells (suspended in 100 µL PBS) into right armpit region of the female nude mice. The environment was kept in a normal day-night cycle with the temperature of 24 ± 2 oC. After the tumor size achieved approximately 100 mm3, the nude mice were divided into five experimental groups (n = 4) and treated with (1) PBS (10 mM), (2) PBS + NIR (980 nm, 0.72 W/cm2), (3) MnO2/Cu2-xS, (4) MnO2/Cu2-xS + NIR, (5) MnO2/Cu2-xS-siRNA + NIR. The temperature changes of the tumor sites were monitored by an infrared thermal camera during the irradiation and the infrared thermal images were taken at the same time. The body weight and the tumor volume of the mice was measured every two days by using an electronic balance and a vernier caliper, respectively. Moreover, the H&E and TUNEL staining and immunofluorescence staining were carried out to evaluate the tissue destruction and cell apoptosis after therapy and antitumor



mechanism.

RESULTS AND DISCUSSION

Preparation and characterization of MnO2/Cu2-xS. MnO2 nanosheets were synthesized from bulk manganese dioxide through ultrasonic treatment. The TEM images and the AFM images showed a uniform lateral diameter of about 200 nm and the thickness of about 1 nm of the as-prepared MnO2 nanosheets, indicating the monolayer structure (Figure S1). The modification of MnO2 with polyethylene glycol (PEG) induced the size increase to ~220 nm (Figure S2), and the PEG functionalization was also verified by the FTIR spectra analysis (Figure S3), the characteristic peaks of MnO2 (739 cm-1) and PEG (944, 1358 and 2878 cm-1) were presented in the FTIR spectrum of MnO2-PEG. The plamonic colloidal Cu2-xS NPs were further in situ decorated on the surface of MnO2 nanosheet (MnO2/Cu2-xS). It revealed plentiful uniform Cu2-xS nanoparticles with the size of 3-5 nm were deposited on the surface of the MnO2 nanosheets (Figure 1A). Obvious crystal structure with lattice spacing of 0.277 nm corresponded to the (101) facet of Cu2-xS was observed from the high-resolution TEM (HRTEM) (Figure 1B). The AFM revealed the height of MnO2/Cu2-xS increased to 4-5 nm after the decoration of Cu2-xS (Figure 1C, S4). The hydrodynamic diameter assessed by the dynamic light scatting (DLS) of the as-prepared MnO2/Cu2-xS nanoagents was 49.2 nm (Figure 1D), consisting with the TEM analysis. The X-ray diffraction (XRD) spectra, UV-spectra and the X-ray photoelectron spectroscopy (XPS) further characterized the MnO2/Cu2-xS nanoagents. XRD spectra of MnO2/Cu2-xS showed the obvious characteristic peaks assigned to MnO2 and Cu2-xS (Figure 1G), and the characteristic peaks of MnO2 (365.4 nm) and Cu2-xS (910.6 nm) were presented in the UV-spectra of MnO2/Cu2-xS (Figure 1E). The X-ray


Page 12 of 30

Page 13 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


photoelectron spectroscopy (XPS) of MnO2/Cu2-xS presented the characteristic peaks associated with S 2p, Cu 2p and Mn 2p (Figure S5). The high-resolution XPS spectra (Figure 1F) of Cu 2p showed two peaks centered at 929.1 and 949.6 eV for the Cu 2p3/2 and Cu 2p1/2, and the Cu 2p3/2 was further deconvoluted into two peaks centered at 929.6 and 931.5 eV attributed to the Cu (I) and Cu(II) sites, confirming the presence of both Cu (I) and Cu(II).

42

Collectively, the results verified the successful

decoration of Cu2-xS nanoparticles onto the surface of MnO2 nanosheets. The as-prepared MnO2/Cu2-xS exhibited excellent stability in aqueous solution, PBS, DMEM cell medium and serum (Figure S6). The good stability was resulted from the hydrophilic PEG chain extending into the aqueous phase while solubilizing and stabilizing the MnO2/Cu2-xS in physiological conditions.

Figure 1. (A) TEM, (B) HRTEM and (C) AFM images of MnO2/Cu2-xS. (D) Hydrodynamic diameter distribution of MnO2/Cu2-xS measured by DLS. (E) UV−vis absorption spectra of MnO2, Cu2-xS and MnO2/Cu2-xS. (F) Cu 2p high-resolution XPS scan of the MnO2/Cu2-xS. (G) XRD spectra of MnO2/Cu2-xS.



Photothermal and Photodynamic properties of MnO2/Cu2-xS. The photothermal effect of MnO2/Cu2-xS was systematically evaluated. As shown in Figure 2A and B, under a NIR laser irradiation, the temperature increase showed a nanoparticle concentration-dependent pattern that the temperature increased accordingly with the increase of the MnO2/Cu2-xS concentration, indicating the heat generation could be finely turned with an exact control. After 10 min of 980 nm laser (0.72 W/cm2) irradiation, the temperature of the MnO2/Cu2-xS solution (200 µg/mL) increased to 62.1 oC, whereas the temperature of water just increased to 38.0 oC. The photothermal stability experiment demonstrated the great stability and superb reproducibility of the MnO2/Cu2-xS during the repeated cycle of laser on/off for 10 times (Figure 2C). The photothermal conversion efficiency of MnO2/Cu2-xS to was assessed to be 25.69% by the NIR laser heat-cool cycle and time constant for heat transfer curve (Figure S7).

43

It was higher than that of gold shells (13%), gold

nanorods (21%) and Cu2-xSe nanocrystals (22%).

44, 45

The photothermal conversion

of MnO2/Cu2-xS in vivo was investigated using B16-tumor-bearing mice. After intravenous injection of MnO2/Cu2-xS, the photothermal effect was recorded at selected time points by an IR thermal imaging camera (Figure 2D,E). The local temperature of the tumor tissues increased rapidly over the course of a 980 nm laser NIR irradiation. The temperature of tumor tissue reached to 50.8 oC after NIR irradiation for 5 min, which was high enough to ablate tumor cells in PTT. In contrast, the tumor temperature of the control group showed no significant temperature change under the same irradiation condition. These results demonstrate the good photothermal conversion properties of the MnO2/Cu2-xS nanoagents.


Page 14 of 30

Page 15 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A) Photothermal photography and (B) Photothermal heating curve of MnO2/Cu2-xS solution at various concentration (0, 25, 50, 100, 200 µg/mL) during a laser irradiation (980 nm, 0.72 W/cm2). (C) The photothermal conversion cycling test of MnO2/Cu2-xS solution (100 µg/mL)

under a 980 nm laser (0.72 W/cm2) irradiation. (D) In vivo thermal images of mice after intravenous injection of PBS and MnO2/Cu2-xS upon NIR irradiation for different time. (E) Temperature increase curve of the tumor tissues during the NIR irradiation.

The 1,3-diphenylisobenzofuran (DPBF) chemical probe was carried out to evaluate the singlet oxygen (1O2) production ability of Cu2-xS and MnO2/Cu2-xS, revealing the superior 1O2 production ability of MnO2/Cu2-xS to Cu2-xS under acidic environment at pH 6.0 (Figure S8). The intracellular 1O2 production ability of Cu2-xS and MnO2/Cu2-xS were further investigated by using the fluorescent singlet oxygen sensor green (SOSG) probe, which could react with 1O2 and produce strong green fluorescence.46 It was obvious that MnO2/Cu2-xS-treated cells exhibited stronger green fluorescence than that of Cu2-xS-treated cells (Figure 3A) owing to the MnO2-meidated O2 generation under slight tumor acidic environment. As control, negligible green fluorescence was observed in Cu2-xS-treated or MnO2/Cu2-xS-treated cells without irradiation (Figure S9). The mean fluorescence intensity of the former was 2.2-folds higher compared to that of Cu2-xS-treated cells (Figure 3B). Electron



spin resonance spectroscopy (ESR) was further used to characterize the

Page 16 of 30

1

O2

generation capability using the 2,2,6,6-tetramethylpiperide (TEMP) probe. As shown in Figure 3C, under irradiation by a 980 nm laser at pH 7.4, the Cu2-xS (blue curve) or MnO2/Cu2-xS (red curve) displayed a similar typical three lines ESR signals assigned to 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO), a stable nitroxide radical generated from TEMP and 1O2. Notably, the MnO2/Cu2-xS at pH 6.0 displayed an obvious stronger ESR signal (yellow curve) compared to both of Cu2-xS or MnO2/Cu2-xS at pH 7.4, which verified the enhancement of the production of 1O2. It demonstrated that the MnO2-triggered decomposition of endogenous H2O2, inducing the O2 generation and reliving the hypoxia for potential enhanced PDT antitumor treatment.

Figure 3. (A) CLSM images of cells after 980 nm laser (0.72 W/cm2) irradiation, scale bars: 80 µm. (B) Corresponding mean intensity of the green fluorescence in (A). *p < 0.01. (C) ESR spectra of Cu2-xS and MnO2/Cu2-xS measured by TEMP probe under a 980 nm laser (0.72 W/cm2) irradiation.

Intracellular Biomarker Detection and SiRNA-mediated HSP 70 Silence. The large surface available of the MnO2/Cu2-xS allowed to cellular delivery gene probe for in intracellular cancer-related biomarker detection and gene regulation. In order to detect miRNA-155, the molecular beacon (MB) probes were absorbed onto MnO2/Cu2-xS and transfered into cells with nucleus dyed by Hoechst 33342 to


Page 17 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


blue color (blue field) for intracellular miRNA-155 detection (Figure 4). As shown in Figure 4A,B and 4C,D, strong green fluorescence was observed in the A549 and MDA-MB-231 cells because of the high expression of miRNA-155. In contrary, due to the low expression of miRNA-155, the NHDF cells showed no obvious green fluorescence (Figure 4E,F), indicating the MnO2/Cu2-xS was an terrific nano-deliver for efficient cancer diagnostic.

Figure 4. (A,C,E) CLSM images of A549 cells, MDA-MB-231 cells and NHDF cells, scale bars: 40 µm. (B,D,F) Corresponding fluorescence intensities of A549 cells, MDA-MB-231 cells and NHDF cells in figure 4A, C and E.

To monitor the uptake ability of A549 cells for MnO2/Cu2-xS-siRNA, siRNA was labeled with fluorescent FAM. The strong green fluorescence observed in the MnO2/Cu2-xS-siRNA treated cells indicated the efficient transfection capability (Figure S10A). The fluorescence intensity analysis clearly verified the results (Figure S10B). Real-time PCR, western blots and immunostaining imaging were used to investigate the siRNA-mediated HSP 70 silencing efficiency. After the 980 nm laser irradiation for 5 min, the mRNA level of HSP 70 was markedly overexpressed for the MnO2/Cu2-xS treated cells due to the fundamental cellular defense mechanism of heat shock response. In contrast, the mRNA level of HSP 70 for the MnO2/Cu2-xS-siRNA treated cells was significantly reduced compared to the MnO2/Cu2-xS treated group



(Figure S11). The HSP 70 protein immunostaining analysis was consistent with the mRNA results that the expression level of HSP 70 protein in MnO2/Cu2-xS-siRNA treated cells was efficiently inhibited compared to that of MnO2/Cu2-xS-treated cells (Figure 5A,B). The Western blotting analysis were performed to further verify the silencing efficiency of the MnO2/Cu2-xS-siRNA. As shown in figure 5C and 5D, a strong expression of HSP 70 was clearly observed for A549 cells treated with MnO2/Cu2-xS after 980 laser irradiation in comparison to cells without treatment. In contrast, MnO2/Cu2-xS-siRNA treated cells showed obvious inhibition of HSP 70 expression. These results indicated the superb HSP 70 silencing efficiency of MnO2/Cu2-xS-siRNA for promising PTT application.

Figure 5. (A) CLSM images of HSP 70 by immunostaining. Scale bars: 40 µm. (B) Corresponding mean intensity of green fluorescence in (A). *p < 0.01, **p < 0.05. (C) Western blots analysis of HSP70 expression in A549 cells of (1) control, (2) control with NIR irradiation, (3) MnO2/Cu2-xS with NIR irradiation, (4) MnO2/Cu2-xS-siRNA with NIR irradiation, (5) MnO2/Cu2-xS and (6) MnO2/Cu2-xS-siRNA. (D) Quantitative results of the relative protein expression in figure 5C.

In vitro PTT&PDT. The superior photothermal conversion and 1O2 generation properties impelled us to explore its PTT&PDT application. The in vitro cytotoxicity


Page 18 of 30

Page 19 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of MnO2/Cu2-xS-siRNA was first tested using MTT assay. MnO2/Cu2-xS-siRNA exhibited negligible effect on the survival of both MCF-7 and A549 cells, even at a concentration up to 400 µg/mL (Figure 6A), indicating low cytotoxicity of MnO2/Cu2-xS-siRNA nanoagents. Then, the in vitro anticancer capability of MnO2/Cu2-xS-siRNA was further evaluated. As shown in Figure 6B, the MnO2/Cu2-xS (100 µg/mL) treated MCF-7 cells showed 29.68% of cells alive under irradiation by a 980 nm laser (0.72 W cm-2) for 5 min due to the PTT&PDT synergetic effect. Notably, MnO2/Cu2-xS -siRNA (100 µg/mL) treated MCF-7 cells exhibited a cell survival ratio down to only 10.75%, indicating the enhanced the antitumor therapeutic efficacy of MnO2/Cu2-xS-siRNA owing to the specific HSP 70 gene silencing. The Calcein-AM/PI staining analysis was consistent with MTT results (Figure 6C), as time goes by, more MnO2/Cu2-xS -siRNA (100 µg/mL) treated MCF-7 cells have died than MnO2/Cu2-xS (100 µg/mL) treated cells after NIR laser irradiation, further confirming the extraordinary PTT&PDT efficacy of MnO2/Cu2-xS-siRNA.

Figure 6. (A) Cell viability of A549 and MCF-7 cells after incubation with different concentrations of MnO2/Cu2-xS-siRNA (25, 50, 100, 200, 400 µg/mL). (b) Cell viability and (C) CLSM images of MCF-7 cells treated with PBS, MnO2/Cu2-xS and MnO2/Cu2-xS-siRNA (100 µg/mL) without or with NIR laser irradiation. Scale bars: 40 µm.



Page 20 of 30

In vivo MR/PA dual modal imaging, Blood Circulation and Bio-distribution. MR/PA dual modal imaging, compensating the intrinsic limitations of each single modality, is a prospective for accurate cancer diagnosis with spatial resolution and good imaging sensitivity. The distinct SPR band at NIR region and photo-stability also make the MnO2/Cu2-xS-siRNA an ideal candidate for PA imaging. To assess the property for in vitro PA imaging, MnO2/Cu2-xS nanoagnents at different concentrations, the photoacoustic imaging phantoms were detected on a multispectral optical tomography (MSOT) imaging system in the range of 700−900 nm. Figure 7A showed the in vitro dependence of PA imaging on the concentration of MnO2/Cu2-xS nanoagnents. The PA signal linearly increased alongside with the increase of MnO2/Cu2-xS-siRNA concentration of from 0 to 100 µg mL−1. Then, the MnO2/Cu2-xS-siRNA

nanoagents

were

intravenously

injected

into

the

B16-tumor-bearing mice for in vivo PA imaging (Figure 7B). It was obvious that the PA signal intensities in the tumor area were 2.1-folds enhanced after the injection compared to the control group (Figure S12), suggesting that the MnO2/Cu2-xS-siRNA could be accumulated in the tumor region by an enhanced permeability and retention effect (EPR). Under acidic environment, the MnO2 nanosheets would be decomposed into Mn2+, which was known to be a promising T1-shortening agent in MR imaging due to the five unpaired 3d electrons.

5, 47

The in vivo MnO2/Cu2-xS-siRNA MR imaging on

B16-tumor-bearing mice was subsequently proceeded. As shown in Figure 7C after injection of MnO2/Cu2-xS-siRNA, an intense enhancement of MR signal at the tumor site was observed. The T1-MR signals showed 2.2-folds-positive enhancement in the tumor

region

(Figure

MnO2/Cu2-xS-siRNA

via

7D), the

demonstrating EPR

effect.

high

tumor

These


accumulation

results

verify

of that

Page 21 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MnO2/Cu2-xS-siRNA can act as an ideal contrast agent for MR/ PA dual-modal imaging. The blood retention of MnO2/Cu2-xS-siRNA over a span of 24 h after injection was studied. As shown in Figure 7E, the MnO2/Cu2-xS-siRNA presented a two-compartment model the blood circulation curve with a first- and second- phase blood circulation time 0.39 ± 0.15 h and 5.52 ± 1.37 h, respectively. The relatively long in vivo blood circulation time was favorable for effective tumor accumulation. After 24 h, all mice tumors and major organs were reaped and analyzed by ICP-MS to measure the Cu content in major organs for biodistribution study (Figure 7F). It was obviously observed that MnO2/Cu2-xS-siRNA nanoagents were remarkably enriched in the liver and kidney tissues, and the heart and lung showed lower Cu amount due to the reticuloendothelial system (RES) response.

Figure 7. (A) In vitro PA images of MnO2/Cu2-xS in different concentration and linear relationship between PA signal intensity and concentration of MnO2/Cu2-xS, (B) In vivo tumor PA-imaging before and after intravenous injection of MnO2/Cu2-xS-siRNA. (C) In vivo T1-MR imaging before and after intravenous injection of MnO2/Cu2-xS-siRNA. (D) T1-MR signals intensity in muscle and tumor in (C). E) Blood circulation and F) biodistribution of MnO2/Cu2-xS-siRNA in B16 tumor-bearing mice after intravenous injection by measuring Cu2+ concentration with ICP-MS.



Page 22 of 30

In vivo PTT&PDT. The in vivo antitumor effect of MnO2/Cu2-xS-siRNA was further investigated using BALB/c B16 tumor-bearing nude mice as model. After tumor volumes reached about 100 mm3, the mice were divided into five groups (n = 4) and treated with (1) PBS (10 mM), (2) PBS + NIR (980 nm, 0.72 W/cm2), (3) MnO2/Cu2-xS, (4) MnO2/Cu2-xS + NIR, (5) MnO2/Cu2-xS-siRNA + NIR. As seen in Figure 8A, similar to PBS control group, neither NIR irradiation nor MnO2/Cu2-xS showed significant effect on the tumor repression. In contrast, the tumor growth of group 4 (MnO2/Cu2-xS + NIR) was significantly inhibited owing to PTT/PDT synergetic effect after post-treatment for 8 days, but tumor relapse was observed. Notably, the treatment of group 5 (MnO2/Cu2-xS-siRNA + NIR) significantly and efficiently inhibited the tumor growth, and no relapse was observed. No remarkable body weight variation was observed for all the experimental groups, indicating negligible systemic side effects were caused during PTT/PDT treatment (Figure 8B). The representative photographs of tumor tissue (Figure 8C) and mice (Figure 8D) received different treatments further proved the best therapy efficiency of MnO2/Cu2-xS-siRNA under NIR irradiation. Immunofluorescence staining results indicated that HSP 70 (Figure 8E,F) was obviously up-regulated under photothermal treatment (MnO2/Cu2-xS+NIR group). In contrary, the HSP 70 expression in MnO2/Cu2-xS-siRNA and MnO2/Cu2-xS-siRNA+NIR groups prominently decreased. These results indicated that MnO2/Cu2-xS-siRNA could silence HSP 70 expression in vivo, leading the enhancement of the PTT efficacy. It was known that cancer cells are able to constitutively produce H2O2 inside the tumor,

48

and MnO2/Cu2-xS-siRNA

might be able to produce O2 in situ to relieve tumor hypoxia by decomposing H2O2. The hypoxyprobe immunofluorescence assay was proceeded to examine the tumor hypoxia (Figure 8G,H). Compared to the control group, tumor slices from mice


Page 23 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


treated with MnO2/Cu2-xS exhibited negligible green fluorescence, indicating the greatly reduction of tumor hypoxia in the tumor site. After 980 nm laser irradiation, the O2 was consumed by PS to produce 1O2, the tumor hypoxia recovered. The histology and immunofluorescence analysis of the tumor tissues was carried out to further investigate the deep mechanism of tumor inhibition and the combined therapy efficiency of MnO2/Cu2-xS-siRNA in vivo. The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay revealed the maximum apoptotic cells of the MnO2/Cu2-xS-siRNA + NIR group among all groups (Figure 8I,J). The typical hematoxylin and eosin (H&E) staining demonstrated neither NIR nor MnO2/Cu2-xS induced cell damage (Figrue 8H). The group 4 presented severe cell necrosis and apoptosis, and more necrotic and apoptotic cells were observed for group 5. Furthermore, no evident inflammation or damage was observed in the major organs in different treatment groups by H&E staining, confirming no side effects or toxicity was associated with the MnO2/Cu2-xS (Figure S13). These results verified the superior

efficacy

in

suppressing

tumors

of

single-laser

irradiated

dual

photothermal-/photodynamic therapy owing to simultaneously overcoming inherent limitations of thermoresistance and tumor hypoxia.



Figure 8. (A) Relative tumor growth curves and (B) body weight of mice of different groups. (C) Representative photograph of tumor tissues. (D) Photographs of the mice with different treatments. (E) Immunofluorescent staining of HSP 70 of tumors after different treatment. (F) Quantitative analysis of HSP 70 expression. (G) Representative immunofluorescence images of tumor slices after different treatment. The nuclei and hypoxia areas were stained with DAPI (blue) and anti-pimonidazole antibody (green), respectively. (H) Quantification of hypoxia areas in tumors. (I) TUNEL staining and (J) the percentage of TUNEL positive apoptotic cells in tumor tissues collected from different groups after treatments. The nuclei and the apoptotic cells were stained with DAPI (blue) and FITC (green), respectively. (K) H&E staining of tumor tissues collected from different groups (*p < 0.01).

CONCLUSION In summary, an intelligent theranostic platform of MnO2/Cu2-xS-siRNA was designed for multimode accurate tumor-specific imaging and improved synergetic PTT&PDT antitumor efficiency owing to blocked heat-shock response and relieved tumor hypoxia. The MnO2/Cu2-xS was synthesized by in situ growing of NIR plasmonic colloidal Cu2-xS on the surface of MnO2 nanosheet (MnO2/Cu2-xS), after surface modification, and gene probes was loaded to generate MnO2/Cu2-xS-siRNA. The intracellular oncogenic miRNA detection can be realized by loading miRNA gene


Page 24 of 30

Page 25 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


probe onto the surface,. Under the acidic tumor microenvironment, MnO2 degraded to Mn2+ and triggered decomposition of endogenous H2O2 to produce O2. The reduced Mn2+ ions significantly improved magnetic resonance imaging (MRI) contrast, and the Cu2-xS plasmonic acted as powerful photoacoustic (PA) and photothermal (PT) imaging agents, leading to multimode accurate tumor-specific imaging and detection. The siRNA targeting HSP70 gene efficiently blocked the heat-shock response for advanced PTT, while the relived hypoxia enhanced PDT, achieving a remarkable synergetic therapeutic effect in vitro and in vivo. This work highlights the great potential of realizing a comprehensive fighting cancer effect by modulating tumor cellular defense mechanism and microenvironment with intelligent multifunctional nanoagents. ASSOCIATED CONTENT The Supporting Information is available free of charge on the ACS Publications website. Additional information as noted in the text, including TEM and AFM images of MnO2 nanosheets, size distribution of MnO2 and MnO2-PEG, FTIR spectra, the height of MnO2 nanosheets, XPS spectra of MnO2/Cu2-xS, photothermal effect, cell uptake of MnO2/Cu2-xS-siRNA, relative mRNA expression of HSP 70, the quantification of photoacoustic signals, images of lung, liver, kidney and heart stained with hematoxylin and eosin.

AUTHOR INFORMATION *Haifeng Dong. Tel.: +86 10 82375840. E-mail: [email protected]. *Xueji Zhang. Tel./fax: +86 10 82376993. E-mail: [email protected].



ACKNOWLEDGMENT The work was supported by the Open Research Fund Program of Beijing Key Lab of Plant Resource Research and Development, Beijing Technology and Business University (PRRD-2016-YB2); the Special Foundation for State Major Research Program of China (Grant Nos. 2016YFC0106602 and 2016YFC0106601) and the National Natural Science Foundation of China (Grant No. 21645005, 21475008).

REFERENCES 1. Chen, G.; Roy, I.; Yang, C.; Prasad, P. N. Nanochemistry and Nanomedicine for Nanoparticle-based Diagnostics and Therapy. Chem. Rev. 2016, 116, 2826-2885. 2. Pelaz, B.; Alexiou, C.; Alvarez-Puebla, R. A.; Alves, F.; Andrews, A. M.; Ashraf, S.; Balogh, L. P.; Ballerini, L.; Bestetti, A.; Brendel, C.; Bosi, S.; Carril, M.; Chan, W. C.; Chen, C.; Chen, X.; Chen, X.; Cheng, Z.; Cui, D.; Du, J.; Dullin, C.; Escudero, A.; Feliu, N.; Gao, M.; George, M.; Gogotsi, Y.; Grunweller, A.; Gu, Z.; Halas, N. J.; Hampp, N.; Hartmann, R. K.; Hersam, M. C.; Hunziker, P.; Jian, J.; Jiang, X.; Jungebluth, P.; Kadhiresan, P.; Kataoka, K.; Khademhosseini, A.; Kopecek, J.; Kotov, N. A.; Krug, H. F.; Lee, D. S.; Lehr, C. M.; Leong, K. W.; Liang, X. J.; Ling Lim, M.; Liz-Marzan, L. M.; Ma, X.; Macchiarini, P.; Meng, H.; Mohwald, H.; Mulvaney, P.; Nel, A. E.; Nie, S.; Nordlander, P.; Okano, T.; Oliveira, J.; Park, T. H.; Penner, R. M.; Prato, M.; Puntes, V.; Rotello, V. M.; Samarakoon, A.; Schaak, R. E.; Shen, Y.; Sjoqvist, S.; Skirtach, A. G.; Soliman, M. G.; Stevens, M. M.; Sung, H. W.; Tang, B. Z.; Tietze, R.; Udugama, B. N.; VanEpps, J. S.; Weil, T.; Weiss, P. S.; Willner, I.; Wu, Y.; Yang, L.; Yue, Z.; Zhang, Q.; Zhang, Q.; Zhang, X. E.; Zhao, Y.; Zhou, X.; Parak, W. J. Diverse Applications of Nanomedicine. ACS Nano. 2017, 11, 2313-2381. 3. Mura, S.; Couvreur, P. Nanotheranostics for personalized medicine. Adv Drug Deliv Rev. 2012, 64, 1394-416. 4. Yang, G.; Xu, L.; Chao, Y.; Xu, J.; Sun, X.; Wu, Y.; Peng, R.; Liu, Z. Hollow MnO2 as a tumor-microenvironment-responsive biodegradable nano-platform for combination therapy favoring antitumor immune responses. Nat. Commun. 2017, 8, 902. 5. Chen, Y.; Ye, D.; Wu, M.; Chen, H.; Zhang, L.; Shi, J.; Wang, L. Break-up of two-dimensional MnO2 nanosheets promotes ultrasensitive pH-triggered theranostics of cancer. Adv. Mater. 2014, 26, 7019-7026. 6. Cheng, L.; Liu, J.; Gu, X.; Gong, H.; Shi, X.; Liu, T.; Wang, C.; Wang, X.; Liu, G.; Xing, H.; Bu, W.; Sun, B.; Liu, Z. PEGylated WS2 nanosheets as a multifunctional theranostic agent for in vivo dual-modal CT/photoacoustic imaging guided photothermal therapy. Adv. Mater. 2014, 26, 1886-1893. 7. Yang, G.; Gong, H.; Liu, T.; Sun, X.; Cheng, L.; Liu, Z. Two-dimensional magnetic WS2@Fe3O4 nanocomposite with mesoporous silica coating for drug delivery and imaging-guided


Page 26 of 30

Page 27 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


therapy of cancer. Biomaterials. 2015, 60, 62-71. 8. Zhu, H.; Wang, Y.; Chen, C.; Ma, M.; Zeng, J.; Li, S.; Xia, Y.; Gao, M. Monodisperse Dual Plasmonic Au@Cu2-xE (E= S, Se) Core@Shell Supraparticles: Aqueous Fabrication, Multimodal Imaging, and Tumor Therapy at in Vivo Level. ACS Nano. 2017, 11, 8273-8281. 9. Yang, T.; Tang, Y.; Liu, L.; Lv, X.; Wang, Q.; Ke, H.; Deng, Y.; Yang, H.; Yang, X.; Liu, G.; Zhao, Y.; Chen, H. Size-Dependent Ag2S Nanodots for Second Near-Infrared Fluorescence/Photoacoustics Imaging and Simultaneous Photothermal Therapy. ACS Nano. 2017, 11, 1848-1857. 10. Li, L.; Chen, C.; Liu, H.; Fu, C.; Tan, L.; Wang, S.; Fu, S.; Liu, X.; Meng, X.; Liu, H. Multifunctional Carbon-Silica Nanocapsules with Gold Core for Synergistic Photothermal and Chemo-Cancer Therapy under the Guidance of Bimodal Imaging. Adv. Funct. Mater. 2016, 26, 4252-4261. 11. Zheng, T.; Li, G. G.; Zhou, F.; Wu, R.; Zhu, J.-J.; Wang, H. Gold-Nanosponge-Based Multistimuli-Responsive Drug Vehicles for Targeted Chemo-Photothermal Therapy. Adv. Mater. 2016, 28, 8218-8226. 12. Riedinger, A.; Avellini, T.; Curcio, A.; Asti, M.; Xie, Y.; Tu, R.; Marras, S.; Lorenzoni, A.; Rubagotti, S.; Iori, M.; Capponi, P. C.; Versari, A.; Manna, L.; Seregni, E.; Pellegrino, T. Post-Synthesis Incorporation of 64Cu in CuS Nanocrystals to Radiolabel Photothermal Probes: A Feasible Approach for Clinics. J. Am. Chem. Soc. 2015, 137, 15145-15151. 13. Mao, F.; Wen, L.; Sun, C.; Zhang, S.; Wang, G.; Zeng, J.; Wang, Y.; Ma, J.; Gao, M.; Li, Z. Ultrasmall Biocompatible Bi2Se3 Nanodots for Multimodal Imaging-Guided Synergistic Radiophotothermal Therapy against Cancer. ACS Nano. 2016, 10, 11145-11155. 14. Wang, Y.; Xie, Y.; Li, J.; Peng, Z. H.; Sheinin, Y.; Zhou, J.; Oupicky, D. Tumor-Penetrating Nanoparticles for Enhanced Anticancer Activity of Combined Photodynamic and Hypoxia-Activated Therapy. ACS Nano. 2017, 11, 2227-2238. 15. Tian, J.; Ding, L.; Xu, H. J.; Shen, Z.; Ju, H.; Jia, L.; Bao, L.; Yu, J. S. Cell-specific and pH-activatable rubyrin-loaded nanoparticles for highly selective near-infrared photodynamic therapy against cancer. J. Am. Chem. Soc. 2013, 135, 18850-18858. 16. Yang, W.; Guo, W.; Le, W.; Lv, G.; Zhang, F.; Shi, L.; Wang, X.; Wang, J.; Wang, S.; Chang, J.; Zhang, B. Albumin-Bioinspired Gd:CuS Nanotheranostic Agent for In Vivo Photoacoustic/Magnetic Resonance Imaging-Guided Tumor-Targeted Photothermal Therapy. ACS Nano. 2016, 10, 10245-10257. 17. Li, Z.; Liu, J.; Hu, Y.; Howard, K. A.; Li, Z.; Fan, X.; Chang, M.; Sun, Y.; Besenbacher, F.; Chen, C.; Yu, M. Multimodal Imaging-Guided Antitumor Photothermal Therapy and Drug Delivery Using Bismuth Selenide Spherical Sponge. ACS Nano. 2016, 10, 9646-9658. 18. Chen, Z.; Zhao, P.; Luo, Z.; Zheng, M.; Tian, H.; Gong, P.; Gao, G.; Pan, H.; Liu, L.; Ma, A.; Cui, H.; Ma, Y.; Cai, L. Cancer Cell Membrane-Biomimetic Nanoparticles for Homologous-Targeting Dual-Modal Imaging and Photothermal Therapy. ACS Nano. 2016, 10, 10049-10057. 19. Chen, W.; Ouyang, J.; Liu, H.; Chen, M.; Zeng, K.; Sheng, J.; Liu, Z.; Han, Y.; Wang, L.; Li, J.; Deng, L.; Liu, Y. N.; Guo, S. Black Phosphorus Nanosheet-Based Drug Delivery System for Synergistic Photodynamic/Photothermal/Chemotherapy of Cancer. Adv. Mater. 2017, 29,1603864. 20. Chen, Y.; Wang, L.; Shi, J. Two-dimensional non-carbonaceous materials-enabled efficient photothermal cancer therapy. Nano Today. 2016, 11, 292-308.



21. Qin, Z.; Bischof, J. C. Thermophysical and biological responses of gold nanoparticle laser heating. Chem. Soc. Rev. 2012, 41, 1191-1217. 22. Chen, Q.; Wen, J.; Li, H.; Xu, Y.; Liu, F.; Sun, S. Recent advances in different modal imaging-guided photothermal therapy. Biomaterials. 2016, 106, 144-166. 23. Wang, B. K.; Yu, X. F.; Wang, J. H.; Li, Z. B.; Li, P. H.; Wang, H.; Song, L.; Chu, P. K.; Li, C. Gold-nanorods-siRNA nanoplex for improved photothermal therapy by gene silencing. Biomaterials. 2016, 78, 27-39. 24. Chen, W. H.; Luo, G. F.; Lei, Q.; Hong, S.; Qiu, W. X.; Liu, L. H.; Cheng, S. X.; Zhang, X. Z. Overcoming the Heat Endurance of Tumor Cells by Interfering with the Anaerobic Glycolysis Metabolism for Improved Photothermal Therapy. ACS Nano. 2017, 11, 1419-1431. 25. Fisher, J. W.; Sarkar, S.; Buchanan, C. F.; Szot, C. S.; Whitney, J.; Hatcher, H. C.; Torti, S. V.; Rylander, C. G.; Rylander, M. N. Photothermal response of human and murine cancer cells to multiwalled carbon nanotubes after laser irradiation. Cancer Res. 2010, 70, 9855-9864. 26. Zhou, Z.; Song, J.; Nie, L.; Chen, X. Reactive oxygen species generating systems meeting challenges of photodynamic cancer therapy. Chem. Soc. Rev. 2016, 45, 6597-6626. 27. Quail, D. F.; Joyce, J. A. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423-1437. 28. Feng, L.; Cheng, L.; Dong, Z.; Tao, D.; Barnhart, T. E.; Cai, W.; Chen, M.; Liu, Z. Theranostic Liposomes with Hypoxia-Activated Prodrug to Effectively Destruct Hypoxic Tumors Post-Photodynamic Therapy. ACS Nano. 2017, 11, 927-937. 29. Kim, J.; Cho, H. R.; Jeon, H.; Kim, D.; Song, C.; Lee, N.; Choi, S. H.; Hyeon, T. Continuous O2-Evolving MnFe2O4 Nanoparticle-Anchored Mesoporous Silica Nanoparticles for Efficient Photodynamic Therapy in Hypoxic Cancer. J. Am. Chem. Soc. 2017, 139, 10992-10995. 30. Feng, G.; Fang, Y.; Liu, J.; Geng, J.; Ding, D.; Liu, B. Multifunctional Conjugated Polymer Nanoparticles for Image-Guided Photodynamic and Photothermal Therapy. Small. 2017, 13, 1602807. 31. Guo, W.; Guo, C.; Zheng, N.; Sun, T.; Liu, S. Csx WO3 Nanorods Coated with Polyelectrolyte Multilayers as a Multifunctional Nanomaterial for Bimodal Imaging-Guided Photothermal/Photodynamic Cancer Treatment. Adv. Mater. 2017, 29, 1604157. 32. Xing, R.; Liu, K.; Jiao, T.; Zhang, N.; Ma, K.; Zhang, R.; Zou, Q.; Ma, G.; Yan, X. An Injectable Self-Assembling Collagen-Gold Hybrid Hydrogel for Combinatorial Antitumor Photothermal/Photodynamic Therapy. Adv. Mater. 2016, 28, 3669-3676. 33. Wang, S.; Riedinger, A.; Li, H.; Fu, C.; Liu, H.; Li, L.; Liu, T.; Tan, L.; Barthel, M. J.; Pugliese, G.; De Donato, F.; Scotto D'Abbusco, M.; Meng, X.; Manna, L.; Meng, H.; Pellegrino, T. Plasmonic copper sulfide nanocrystals exhibiting near-infrared photothermal and photodynamic therapeutic effects. ACS Nano. 2015, 9, 1788-1800. 34. Wang, Z.; Huang, P.; Jacobson, O.; Wang, Z.; Liu, Y.; Lin, L.; Lin, J.; Lu, N.; Zhang, H.; Tian, R.; Niu, G.; Liu, G.; Chen, X. Biomineralization-Inspired Synthesis of Copper Sulfide-Ferritin Nanocages as Cancer Theranostics. ACS Nano. 2016, 10, 3453-3460. 35. Tian, Q.; Tang, M.; Sun, Y.; Zou, R.; Chen, Z.; Zhu, M.; Yang, S.; Wang, J.; Wang, J.; Hu, J. Hydrophilic flower-like CuS superstructures as an efficient 980 nm laser-driven photothermal agent for ablation of cancer cells. Adv. Mater. 2011, 23, 3542-3547. 36. Fan, H.; Zhao, Z.; Yan, G.; Zhang, X.; Yang, C.; Meng, H.; Chen, Z.; Liu, H.; Tan, W. A smart DNAzyme-MnO2 nanosystem for efficient gene silencing. Angew. Chem. Int. Ed. 2015, 54,


Page 28 of 30

Page 29 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4801-4805. 37. Zhao, Z.; Fan, H.; Zhou, G.; Bai, H.; Liang, H.; Wang, R.; Zhang, X.; Tan, W. Activatable fluorescence/MRI bimodal platform for tumor cell imaging via MnO2 nanosheet-aptamer nanoprobe. J. Am. Chem. Soc. 2014, 136, 11220-11223. 38. Cao, Y.; Li, S.; Chen, C.; Wang, D.; Wu, T.; Dong, H.; Zhang, X. Rattle-type Au@Cu2-xS hollow mesoporous nanocrystals with enhanced photothermal efficiency for intracellular oncogenic microRNA detection and chemo-photothermal therapy. Biomaterials. 2018, 158, 23-33. 39. Peng, L.; Peng, X.; Liu, B.; Wu, C.; Xie, Y.; Yu, G. Ultrathin two-dimensional MnO2/graphene hybrid nanostructures for high-performance, flexible planar supercapacitors. Nano Lett. 2013, 13, 2151-2157. 40. Bai, J.; Liu, Y.; Jiang, X. Multifunctional PEG-GO/CuS nanocomposites for near-infrared chemo-photothermal therapy. Biomaterials. 2014, 35, 5805-5813. 41. Meng, X.; Liu, Z.; Cao, Y.; Dai, W.; Zhang, K.; Dong, H.; Feng, X.; Zhang, X. Fabricating Aptamer-Conjugated PEGylated-MoS2/Cu1.8S Theranostic Nanoplatform for Multiplexed Imaging Diagnosis and Chemo-Photothermal Therapy of Cancer. Adv. Funct. Mater. 2017, 27, 1605592. 42. Zhang, S.; Sun, C.; Zeng, J.; Sun, Q.; Wang, G.; Wang, Y.; Wu, Y.; Dou, S.; Gao, M.; Li, Z. Ambient Aqueous Synthesis of Ultrasmall PEGylated Cu2−x Se Nanoparticles as a Multifunctional Theranostic Agent for Multimodal Imaging Guided Photothermal Therapy of Cancer. Adv. Mater. 2016, 28, 8927-8936. 43. Lin, H.; Gao, S.; Dai, C.; Chen, Y.; Shi, J. A Two-Dimensional Biodegradable Niobium Carbide (MXene) for Photothermal Tumor Eradication in NIR-I and NIR-II Biowindows. J. Am. Chem. Soc. 2017, 139, 16235-16247. 44. Zeng, J.; Goldfeld, D.; Xia, Y. A plasmon-assisted optofluidic (PAOF) system for measuring the photothermal conversion efficiencies of gold nanostructures and controlling an electrical switch. Angew. Chem. Int. Ed. 2013, 52, 4169-4173. 45. Hessel, C. M.; Pattani, V. P.; Rasch, M.; Panthani, M. G.; Koo, B.; Tunnell, J. W.; Korgel, B. A. Copper selenide nanocrystals for photothermal therapy. Nano Lett. 2011, 11, 2560-2566. 46. Cao, Y.; Dong, H.; Yang, Z.; Zhong, X.; Chen, Y.; Dai, W.; Zhang, X. Aptamer-Conjugated Graphene Quantum Dots/Porphyrin Derivative Theranostic Agent for Intracellular Cancer-Related MicroRNA Detection and Fluorescence-Guided Photothermal/Photodynamic Synergetic Therapy. ACS Appl. Mater. Interfaces. 2017, 9, 159-166. 47. Ma, Z.; Jia, X.; Bai, J.; Ruan, Y.; Wang, C.; Li, J.; Zhang, M.; Jiang, X. MnO2 Gatekeeper: An Intelligent and O2-Evolving Shell for Preventing Premature Release of High Cargo Payload Core, Overcoming Tumor Hypoxia, and Acidic H2O2-Sensitive MRI. Adv. Funct. Mater. 2017, 27, 1604258. 48. Szatrowski TP, N. C. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res. 1991, 51, 794-798.




Page 30 of 30

Cu2-xS for Multimode Imaging Diagnostic and

Recommend Documents