Defect-Related Luminescent Hydroxyapatite-Enhanced Osteogenic

Subscriber access provided by Loyola University Libraries

Article

Defect-related Luminescent Hydroxyapatite Enhanced Osteogenic Differentiation of Bone Mesenchymal Stem Cells via ATP-induced cAMP/PKA Pathway Chao Wang, Dandan Liu, Cuimiao Zhang, Jiadong Sun, Weipei Feng, Xing-Jie Liang, Shuxiang Wang, and Jinchao Zhang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b01103 • Publication Date (Web): 18 Apr 2016 Downloaded from http://pubs.acs.org on April 25, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Defect-related

Luminescent

Hydroxyapatite

Enhanced

Osteogenic

Differentiation of Bone Mesenchymal Stem Cells via ATP-induced cAMP/PKA Pathway Chao Wang †, §, #, Dandan Liu †, §, #, Cuimiao Zhang †, §, Jiadong Sun §, Weipei Feng †, §, Xing-Jie Liang ‡, Shuxiang Wang †, § *, Jinchao Zhang †, § * †

College of Chemistry and Environmental Science, Chemical Biology Key Laboratory of Hebei

Province, Hebei University, Baoding 071002, PR China §

Key Laboratory of Medicinal Chemistry and Molecular Diagnosis of the Ministry of Education,

Hebei University, Baoding 071002, PR China ‡

CAS Key Laboratory for Biological Effects of Nanomaterials and Nanosafety, National Center

for Nanoscience and Technology, Beijing 100190, P. R. China

Corresponding Author * E-mail: [email protected], [email protected] #

These authors contribute equally to this work.

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

ABSTRACT Novel defect-related hydroxyapatite (DHAP), which combines the advantages of HAP and defect-related luminescence, has the potential application in tissue engineering and biomedical area due to their excellent capability of monitoring the osteogenic differentiation and material biodegradation. Although the extracellular mechanism of DHAP minerals and PO43- functioning in osteogenic differentiation has been widely studied, the intracellular molecular mechanism through which PO43- mediates osteogenesis of BMSCs is not clear. We examined a previously unknown molecular mechanism through which PO43- promoted osteogenesis of BMSCs with an emphasis on ATP-induced cAMP/PKA pathway. Our studies showed that DHAP could be uptaken into lysosome, in which PO43- was released from DHAP due to the acid environment of lysosome. The released PO43- interacted with ADP to form ATP, and then degraded into adenosine, an ATP metabolite, which interacted with A2b adenosine receptor to activate the cAMP/PKA pathway, resulting in the high expression of osteogenesis related-genes, such as Runx2, BMP-2, and OCN. These findings firstly revealed the function of ATP-metabolism in bone physiological homeostasis, which may be developed to cure bone metabolic diseases. KEYWORDS:

defect-related

hydroxyapatite,

osteogenic

mesenchymal stem cell, ATP metabolism, cAMP/PKA pathway


differentiation,

Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Recently, luminescent hydroxyapatite (HAP) has been widely used to be bone substitute and implant in biomedical applications not only due to the biocompatibility and biodegradation, high function of enhancing osteogenic differentiation, but also the excellent ability of luminescence, which renders it be capable of monitoring the osteogenic differentiation and material biodegradation both in vitro and in vivo.1-6 For example, Liu7 et al. reported a fluorescent nanostructured HAP scaffold for convenient tracking of the scaffold biodegradability and cell internalization using confocal laser scanning microscopy. Chung8 et al. synthesized the AuNP-conjugated fluorescent HAP, which was used as a smart nanoprobe for testing phosphatase activity during the osteogenic differentiation of MC3T3-E1 cells (pre-osteoblast). However, these luminescent HAPs introduced organic molecules or semiconductor nanoparticles, which have seriously limited in biomedical applications, such as toxicity, photobleaching, and quenching of fluorescence. Recently, a series of environmentally friendly and efficient defect-related materials have been reported.9 These novel defect-related inorganic materials may be applied as scaffold in tissue engineering due to their stable fluorescent functions, non-cytotoxicity, and biocompatibility. Therefore, in combing the advantages of HAP and defect-related luminescence, we designed and synthesized the HAP nanorods with defect-related luminescent property to monitor the PO43- release and study the intracellular molecular mechanism of osteogenesis of bone mesenchymal stem cells (BMSCs) induced by DHAP. Bone mesenchymal stem cells (BMSCs) are multipotent cells, which possess the capability to differentiate into osteocytes, adipocyte, and chondrocytes, have generated abundant potential clinical application in regenerative medicine and bone tissue engineering in recent years.10, 11 HAP as a main inorganic component of bone can influence BMSCs differentiation directly. It has reported that nanoﬁbrous hydroxyapatite/chitosan scaffold which possesses a similar composition and construction with natural bone, promoted the adherence, proliferation, and osteogenesis of BMSCs via integrin and BMP/Smad signaling pathway.12 Xia 13 et al.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

demonstrated that macroprorous HAP could promote cell attachment and osteogenesis of MSCs through p38/MAPK and ERK signaling pathways in vitro, and repair the deficient skull in vivo. The hydroxyapatite plays a key role in tissue engineering, and the extracellular mechanism of HAP minerals and PO43- functioning in osteogenic differentiation has been widely studied 6, however, the intracellular molecular mechanism through which PO43- mediates osteogenesis of BMSCs is not clear. Adenosine-triphosphate (ATP) as the source of energy influences the radical cellular activities of cells, such as adhesion, proliferation and differentiation.14-16 ATP can degrade into cyclic adenosine monophosphate (cAMP) through the binding of adenosine (an ATP dephosphorylation product) and A2b adenosine receptor, and the increased-cAMP activates cAMP/PKA pathway which has been proved to enhance the bone formation of BMSCs.17-22 In this study, the defect-related HAP could enter into lysosome and released PO43- into cytoplasm through the fluorescent imaging in cell. Therefore, a hypothesis was proposed that the PO43- was released from DHAP could interact with adenosine diphosphate (ADP) to form ATP, resulting in the activation of cAPM/PKA pathway through increased adenosine. In this study, we revealed a previously uncharted mechanism, highlights on the phosphate metabolism, by which DHAP promotes osteogenesis of BMSCs. The results indicated that the released-PO43- from DHAP plays a pivotal role in facilitating BMSCs osteogenesis by mediating phosphate content and ATP synthesis in mitochondria. The secreted-ATP will be metabolized into adenosine, which binds to A2b adenosine receptors to activate the cAMP/PKA pathway, which induces the BMSCs differentiate toward osteoblast. This finding elaborated the impact of ATP metabolism in bone physiological homeostasis, which may be developed to cure bone metabolic diseases. 2. EXPERIMENTAL SECTION 2.1 Materials In this work, chemicals were obtained from Beijing Chemical Corporation. Cetyltrimethylammonium bromide was purchased from Beijing Yili Fine Chemicals Co., Ltd. All the initial chemicals were used without further processing. For cell culture, trypsin and phosphate buffered saline (PBS) were obtained from Wisent


Page 4 of 30

Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Canada), Dulbecco’s modified Eagle’s medium (DMEM) and Fetal bovine serum (FBS) were obtained from Life Technologies (USA), Dimethyl sulfoxide (DMSO) was obtain from Sigma (USA). 2.2 Defect-related HAP Nanorods Preparation Defect-related HAP nanorods were synthesized via a hydrothermal method.23 Typically, 0.2 g of hexadecyltrimethylammonium bromide (CTAB) and 2 mmol of Ca(NO3)2·4H2O were dissolved in 20 ml purified water. Subsequently, ammonia solution was introduced dropwise to adjust the pH value at 4.0-6.0 to prepare solution A. Then 1.2 mmol of (NH4)2HPO4 and 2 mmol of trisodium citrate were dissolved in 15 ml deionized water to prepare solution B. After stirring for 30 min, solution B was added to solution A with stirring for 20 min. Then the mixture was poured into to a stainless steel autoclave and placed at 180 oC for 24 h. After the precipitate was cooled to room tempurature, it was washed with water and ethanol respectively, and dried at 80 oC for 12 h. 2.3 Characterizations of DHAP Scanning electron microscopy (SEM, JSM-7500F, Japan) was performed to inspect the morphology of the materials. Transmission electron microscopy (TEM) images were obtained from a FEI Tecnai G2 S-Twin transmission electron microscope with a field-emission gun operating at 200 kV. The photoluminescence (PL) spectra were performed with a Hitachi F-7000 spectrophotometer. Powder X-ray diffraction (XRD) patterns were obtained on a Rigaku D8 Advance diffractometer using Cu Ka radiation (λ = 0.15405 nm). 2.4 Inorganic Phosphate Assay Intracellular phosphate and DHAP-released phosphate were measured using a phosphmolybdenum blue assay.24 Briefly, 1ml supernatant of cells was collected into a 50 ml tube, and then 2 ml ammonium molybdate solution and 1 ml ascorbic acid were added as a deoxidizer and chromogenic agent, respectively. The phosphate contents were detected using a spectrophotometer at 710 nm. All the measurements were quantified using a phosphate standard curve with a concentration rang from 1µg/ml to 6 µg/ml. The degradation rate of DHAP was expressed by phosphate



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

concentration. 2.5 BMSCs Isolation and Culture BMSCs were isolated from ICR mouse (4-week-old) as our previous report.25 BMSCs were cultured in DMEM medium contained with 100 units/ml penicillin, 100 mg/ml streptomycin and 10% fetal bovine serum (FBS) in a humidified atmosphere of 5% CO2 in air at 37 oC. The fresh medium was replaced every 3 days. 2.6 Cellular Biocompatibility The biocompatibility of DHAP was tested by MTT assay and hemolytic assay, respectively.26 Briefly, BMSCs (5×105 cells/well) were seeded in 96 well plates for 5 days incubation, then DHAP (final concentrations of 20, 40, 60 and 100 µg/ml) was added, and cells without DHAP as control. After 1 d, 2 d, and 3 d incubation, 10 µl MTT was added into each well and maintained at 37 oC for 4 h. The supernatant was discarded, and the formazan crystals were dissolved by dimethyl sulfoxide (DMSO, Sigma-Aldrich). Then the absorbance was tested through a microplate reader (Molecular Devices, SpectraMax, USA) at 570 nm. To determine hemolysiscompatibility, blood from ICR mouse was collected and washed with PBS until the supernatant became colorless. Then 200 µl resuspended erythrocyte were commixed with 800 µl DHAP with the final concentration of 20, 60, 100, 200, 400 and 600 µg/ml. Erythrocyte incubated in 800 µl H2O and 800 µl PBS were used as positive and negative control, respectively. After 4 h incubation at 37 oC, the mixture was centrifuged at 10000 g for 5 min. The supernatant absorbance at 577 nm was determined by a microplate reader (Molecular Devices, SpectraMax, USA). 2.7 Confocal Laser Scanning Microscopy (CLSM) CLSM was employed to observe cellular uptake and internalization.27 Briefly, BMSCs cultured on glass bottom cell culture dish were treated with DHAP (100 µg/ml) for 4 h, then 100 µl lysotracker red (100 nM) was added into the plate for 30 min incubation. After 3 times PBS washing, the uptake of DHAP was observed by CLSM (Olympus, IX81, Japan). 2.8 Cellular Uptake Mechanism The uptake mechanism of DHAP in BMSCs was analyzed by a flow cytometry.28, 29


Page 6 of 30

Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Briefly, BMSCs were seeded in 6 well plates at the density of 2×107 cells/well and cultured

with

macropinocytosis

inhibitor

(wortmannin),

clathrin

inhibitor

(chlorpromazine) and caveolae inhibitor (nystatin) for 30 min at 37 oC. Subsequently, DHAP was involved for 6 h to allow the cells uptake. The cells cultured with DHAP at 4 oC and 37 oC acted as negative and positive control, respectively. Then cells were collected and analyzed by a FACScalibur flow cytometer (Becton Dickinson, FACScalibur™, USA). 2.9 Alkaline Phosphatase (ALP) Activity ALP activity of BMSCs treated with DHAP was measured according to our previous work.30, 31 Briefly, after 7 days and 10 days treatment with osteogenic supplementary (OS) containing 60 µg/ml and 100 µg/ml DHAP, BMSCs were repeated freezing and thawing to isolate the total protein. Then ALP activity was tested by an ALP assay kit and microprotein assay kit. 2.10 Mineralized Matrix Assay BMSCs (2×106 cells/well) were cultured with OS and DHAP with concentrations of 60 µg/ml and 100 µg/ml. After 18 days culture, the cells were fixed with 4% paraformaldehyde for 40 min at room temperature, followed washing with PBS, and then strained with 0.1% alizarin red for 30 min at 37 oC. The mineralized nodules of DHAP-treated BMSCs were quantified through dissolving in 10% cetylpyridinium chloride. The absorbance was detected by using a microplate reader at 570 nm (Molecular Devices, SpectraMax, USA). 2.11 Quantitative Real Time Polymerase Chain Reaction (RT-qPCR) The levels of mRNA for osteogenesis-related genes (BMP-2, Runx2, OCN, and Co l-1) in 100 µg/ml DHAP-treated BMSCs were analysized using RT-qPCR. The total RNA was isolated using TRLzol reagent (Life technologies, USA) according to manufacturer’s introductions. The concentration of total RNA was measured using a spectrophotometer. Then 2.5 µg RNA was performed to reverse transcriptase reaction in a 20 µl mixture according to manufacturer’s introductions (TaKaRa, Japan). RT-qPCR was conducted using StepOnePlus™ Real-Time PCR System (StepOnePlus, ABI, USA), and performed in a total volume of 25 µl containing l µl primer pair stock



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(7.5 µM), 4 µl cDNA, 12.5 µl ΜltraSYBR mixture and 7.5 µl H2O. The amplification cycles included denaturation for 30 s at 95 oC; annealing for 30 s at 61 oC (ALP, BMP-2), 60 oC (Runx2, OCN, Col-1) and 57 oC (GAPDH), respectively; and extension for 10 min at 72 oC for 40 cycles. The GAPDH as house keeping gene was used to normalize all the values by the 2-∆∆Ct method

33

. The primer sequences are

summarized in Table 1. 2.12 Intracellular ATP Analysis Intracellular ATP was measured using an ATP assay kit (Nanjing Jiancheng Bioengineering Institute, China).17 Generally, BMSCs (2×107 cells/well) were cultured with OS medium containing 100 µg/ml DHAP for 3 days. Then cells were harvested and the ATP levels were measured according to the manufacturer’s introductions. 2.13 High Performance Liquid Chromatography (HPLC) Adenosine contents in BMSCs extracellular matrix after 100 µg/ml DHAP treatment was measured by HPLC (Agilent 1260, USA).32 In short, after 5 days culture, the medium was collected and freeze-dried, and then the powder was dissolved in deionized water and detected on an Agilent Zorbax SB-C18 column (5 µm, 4.6 × 250 mm, USA) at 260 nm. The mobile phase was 0.1 mol/L phosphate buffer (pH 7.4)-methonal (9:1). The result was calculated by comparing the retention time and peak area of the adenosine standard. 2.14 Cyclic Adenosine Monophosphate (cAMP) Analysis DHAP-treated BMSCs were cultured at 37 oC for 5 days, and then cells were collected and multigelated to destruct the membrane. The suspension was centrifuged at 10000 rpm for 5 min, and the supernatant were used to detected cAMP concentration by using a cAMP activity assay kit (Roche, USA). 2.15 Statistical Analysis All data were expressed as mean ± SD through at least three times experimental repeat. The statistical differences were measured by a one-way ANOVA, followed by Newman-Keuls analysis. Results were considered statistically significant at P＜0.05. 3. RESULTS AND DISCUSSION


Page 8 of 30

Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.1 Characterizations of DHAP The particle size and typical shape of DHAP were investigated by SEM and TEM images. As shown in Fig.1A and B, the DHAP sample is composed of uniform nanorods with the lengths of about 100 nm and diameters of about 30 nm. The particle size and typical shape of DHAP sample are similar to phosphorites which exist in natural bone, which can be easily uptaken by BMSCs. Fig. 1C shows the XRD pattern of DHAP sample. The diffraction peaks can be well indexed to the hexagonal phase hydroxylapatite (JCPDS No. 09-0432). The pure tetragonal phase of HAP was formed without impurity phase detecting. The luminescence property was investigated by photoluminescence excitation and emission spectra (Fig. 1D). The excitation spectrum consists of a broadband from 200 to 450 nm (centered at 337 nm). Under 337 nm excitation, the emission spectrum is composed of an intense broadband from 400 to 600 nm (centered at 441 nm), which exhibits a white-blue emission. 3.2 Phosphate Release and Fluorescence Decrease of DHAP The degradation property of DHAP was evaluated through immersing DHAP into acetic acid buffer (pH 5.0), as the time prolonged, the crystal configuration of DHAP was broken, and the fluorescence intensity of DHAP also decreased because the fluorescence of DHAP was caused by lattice defects.33 It can be seen from Fig. 2A and B, the fluorescence intensity was optimal at 0 h immersing, and decreased gradually as the time prolonged, after 24 h immersing, the intensity of defect-related HAP was lowest. And as shown in Fig. 2C, the phosphate release rate after 3, 6, 12, and 24 h immersing were about 23, 27, 29, and 32%, respectively. 3.3 Effect of DHAP on the Cell Viability The cell viability and biocompatibility were measured by MTT assay and hemolytic test, respectively. As shown in Fig. 3A, the DHAP performed high cell viability at the concentration of 40, 60, and 100 µg/ml for 24, 48, and 72 h incubation with dose dependent manner. And the cell viability achieved the highest values at 48 h to about 143% after 100 µg/ml DHAP treatment. Hemolytic rate of DHAP at the concentration of 20, 60, 100, 200, 400, and 600 µg/ml showed in Fig. 3B. The DHAP appeared to be anhemolytic at all concentration compared to positive group.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.4 Uptake and Internalization of DHAP in BMSCs The uptake and internalization of DHAPs in BMSCs were evaluated by a confocal microscopy imaging. As shown in Fig. 4A, the fluorescence of DHAP (bule) overlapped with lyso-tracker (red) completely, but almost no overlap with mito-tracker (green). These results demonstrated that the DHAP specific targeted to lysosome, little located in mitochondrion. It has reported that endocytosis is an energy dependent uptake way that will be hindered at low temperature (4 oC), by which various extracellular materials could entry into cells. The endocytosis includes several subcategories, such as clathrin-independent endocytosis, macropinocytosis, and caveolae-independent endocytosis.34,

35

To understand the uptake mechanism,

inhibitors of endocytosis (wortmannin, chlorpromazine, and nystatin) were co-culture with BMSCs, respectively. The results (Fig. 4B) showed that the scatter intensity of positive group increased obviously, indicating the uptake of DHAP by BMSCs. However, after the treatment of wortannin, the scatter intensity of cells decreased remarkably in comparison to positive group, indicating the uptake of DAHP by BMSCs through macropinocytosis pathway. Previous studies also showed that nanoparticles which were uptaken by cells through macropinocytosis pathway were wrapped up by endocytic vesicles at early stage, and finally coalesced with lysosome.36-38 3.5 DHAP Promoted the ALP Activity and Mineralization ALP activity an osteogenic-related early maker in BMSCs.39 In the presence of osteogenic induction supplement (OS), the impact of DHAPs on ALP activity was tested by normalizing to total protein content to monitor the osteogenesis of BMSCs. It can be seen in Fig. 5A that the ALP activity of BMSCs was increased markedly after 7 days treatment of DHAP (100 µg/ml). With the time increasing, the ALP activity increased significantly at all concentration compared to control group after 10 days incubation (Fig. 5B). Mineralized nodules are marked phenotypic of osteogenic differentiation, and represent a final stage of osteogenic differentiation.40 In comparison of control group, a significant increase of mineralized nodules was observed in OS, 60 µg /ml DHAP,


Page 10 of 30

Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and 100 µg /ml DHAP treatment (Fig. 5C). The amounts of mineralized nodules were quantified by 10% cetylpyridinium. Compared with control group, the results showed that the mineralized nodules were increased about 400% after the 60 µg/ml and 100 µg/ml DHAP treatments for 18 days (Fig. 5D). Based on the results of Fig. 5, the osteogenic differentiation was enhanced by DHAP when compared with only OS-treated group. 3.6 High Expression of Osteogenesis-related Genes in DHAP-treated BMSCs To confirm the osteogenesis of BMSCs induced by DHAP, the mRNA level of osteogenic genes was examined by RT-qPCR, including Col-1, OCN, BMP-2, and Runx2. It has been reported that BMP-2 (a factor of TGF-β family ), plays a key modulatory role in bone formation41, and Runx2 also plays an important role on osteogenic linage from the pluripotent MSCs.42 In addition, Col-1 and OCN are regarded as the markers of osteogenesis of MSCs.43 It can be seen in Fig. 5E, the mRNA level of BMP-2, Col-1, and Runx2 was significantly increased compared with control group and OS group after 5 days treatment of 100 µg/ml DHAP, as well as the mRNA level of OCN. Besides that, the expression of osteogenic-related genes with NaN3 (an inhibitor of ATP) treatment was also tested. The blocked-ATP energy supply results in the down-regulated expression level of osteogenesis-related genes, such as ALP, Runx2, and OCN. This result indicated that the suppression of ATP inhibited osteogenic differentiation of BMSCs. Generally, the results demonstrated that DHAP promoted osteogenic differentiation of BMSCs both on cellular level and molecular level. 3.7 DHAP-released PO43- Increased the Intracellular ATP Intracellularly, ATP as the source of energy influences the cell fates, such as adhesion, proliferation and differentiation.14-16 Phosphate is a primary substrate for the phosphorylation of ADP by the F1F0-ATPase, and regulates the intracellular ATP production through the mitochondrial NADH activation.44 As shown in Fig. 2C, the DHAP can be degraded in acetic acid buffer (pH 5.0), and after uptake by cells capsules are located in the lysosome (Fig. 4B). Based on these results, a hypothesis was proposed that the DHAPs can be degraded in lysosome and release PO43- into



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

cytoplasm. The abundant PO43- could react with ADP to synthesis ATP, which providing sufficient energy for osteogenic differentiation of BMSCs. Fig. 6A showed that the intracellular phosphate was vastly increased when the cells were treated with 100

µg/ml

DHAP

for

3

days.

This

finding

was

confirmed

by

the

decreased-fluorescence intensity of DHAP in lysosome upon the release of PO43- from DHAP (Fig. 6B and Fig. 6C). Because an obvious function of PO43- is to serve as a substratum for ATP synthesis in the mitochondria, therefore, the ATP production in cells was evaluated. It can be seen in Fig. 6D, an extremely increase of ATP was detected in cells after the treatment of 100 µg/ml DHAP and PO43- (the concentration is equal to PO43- released from DHAP) for 3 days. These results confirmed that the increase of intracellular phosphate proved a source of ATP synthesis and promoted the product of ATP. 3.8 DHAP Promotes Osteogenesis of BMSCs through ATP-induced cAMP/PKA Pathway It has demonstrated that ATP as a signaling molecule plays vital role in modulation of cells functions.14,

15, 17

To study the role of ATP on osteogenic differentiation of

BMSCs, we used NaN3 (an ATP inhibitor) 45 to eliminate intracellular ATP and then a dramatic decrease of ALP activity was observed in Fig. 7A, indicating that inhibition of ATP suppressed the osteogenic differentiation of BMSCs. Adenosine, an ATP degration product, has been reported to contribute to osteogenic differentiation and bone formation.46 Adenosine exerts the effects when coupling with A2b receptor, and farther activates the cAMP/PKA signaling pathway.20-22 As shown in Fig. 7B, in comparison to control and OS groups, a tremendous amount of adenosine was observed in culture medium after 5 days DHAP treatment. This result indicated that the adequate ATP in intracellular contributes to increase of adenosine. It has reported that the adenosine could couple with A2b receptor easily and furtherly activates adenylate cyclase, which stimulates ATP to degrade into cAMP. Fig. 7C indicated that the activity of cAMP was extremely increased after 5 days DHAP treatment at a concentration of 100 µg/ml when comparing to control group and OS group. To future confirm whether DHAP enhanced BMSCs osteogenic differentiation via cAMP/PKA


Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


pathway,

we

used

H89

(N-[2-(p-Bromocinnamylamino)

ethyl]-5-isoquinolinesulfonamide·2HCl hydrate), a PKA inhibitor, to co-culture with BMSCs for 7 days. The results showed that after treated with H89, the ALP activity significantly decreased compared to DHAP treatment group (Fig. 7D). This finding suggested that attenuation of cAMP/PKA signaling pathway inhibited the expression of ALP activity and further negatively affected the osteogenic differentiation of BMSCs. Together, this work proposed a molecular mechanism (described in Fig. 8) that PO43- promoted osteogenesis of BMSCs with an emphasis on ATP-induced cAMP/PKA pathway. The released-PO43- from DHAP acts as a substratum for ATP synthesis in mitochondria, and then ATP was secreted and metabolized into adenosine, followed the activation of cAMP /PKA pathway through the binding with A2b adenosine receptor. The activated-cAMP /PKA pathway promoted the mRNA level of osteogenic differentiation-related genes, such as BMP-2, Runx2, OCN, and Col-1, indicating the differentiation of BMSCs towards to osteoblasts. 4. CONCLUSION In summary, we revealed a molecular mechanism by which defect-related HAP-released PO43- promoted osteogenesis of BMSCs with an emphasis on ATP-induced cAMP/PKA pathway. In this study, DHAP nanorods were taken up by BMSCs through macropinocytosis pathway and localized in lysosome, in which the crystal lattice of DHAP was broken and released PO43- due to the low pH value. The released-PO43- interacted with ADP to form ATP, and then degraded into adenosine, an ATP metabolite, which interacted with A2b adenosine receptor to activate the cAMP/PKA pathway,

resulting

in

the

high

mRNA level

of

osteogenic

differentiation-related genes, such as Runx2, BMP-2, and OCN. This finding elaborated the impact of ATP metabolism in bone physiological homeostasis, which may be developed to cure bone metabolic diseases. AUTHOR INFORMATION Corresponding Author *

E-mail: [email protected], [email protected]



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Author Contributions #

These authors contribute equally to this work.

Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS This work was supported by Natural Science Foundation project (31470961, 21271059, 21471044, 51302062，21301046), Key Basic Research Special Foundation of Science Technology Ministry of Hebei Province (14961302D), Hebei Province “Hundred Talents Program” (BR2-202), Hebei Province “Three Three Three Talents Program” (A201401002), Science and Technology Research Project of Higher Education Institutions in Hebei Province (QN2015230), Distinguished Young Scholars Fund of Hebei University (2015JQ04), and Natural Science Foundation of Hebei Province (B2015201097).


Page 14 of 30

Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Huang, Y.; Zhou, G.; Zheng, L. S.; Liu, H. F.; Niu, X. F.; Fan, Y. B. Micro-/Nano-sized Hydroxyapatite Directs Differentiation of Rat Bone Marrow Derived Mesenchymal Stem Cells Towards an Osteoblast Lineage. Nanoscale 2012, 4, 2484-2490. (2) Yang, H.; Zeng, H. J.; Hao, L. J.; Zhao, N. R.; Du, C.; Liao, H.; Wang, Y. J. Effects of Hydroxyapatite Microparticle Morphology on Bone Mesenchymal Stem Cell Behavior. J. Mater. Chem. B 2014, 2, 4703-4710. (3) Hutmacher, D. W.; Schantz, J. T.; Lam, C. X. F.; Tan, K. C.; Lim, T. C. State of the Art and Future Directions of Scaffold-based Bone Engineering from a Biomaterials Perspective. J. Tissue. Eng. Regen. Med. 2007, 1, 245-260. (4) Escudero, A.; Calvo, M. E.; Fernández, S. R.; Fuente, J. M. D. L.; Ocaña, M. Microwave-assisted Synthesis of Biocompatible Europium-doped Calcium Hydroxyapatite and Fluoroapatite Luminescent Nanospindles Functionalized with Poly (Acrylic Acid). Langmuir 2015, 29, 1985-1994. (5) Kwon, B. J.; Kim, J. S.; Kim, Y. H.; Lee, M. H.; Baek, H. S.; Lee, D. H.; Kim, H. L.; Seo, H. J.; Lee, M. H.; Kwon, S. Y.; Koo M. A.; Park, J. C. Biological Advantages of Porous Hydroxyapatite Scaffold Made by Solid Freeform Fabrication for Bone Tissue Regeneration. Artif. Organs 2013, 37, 663-670. (6) Zhou, H.; Lee, J. Nanoscale Hydroxyapatite Particles for Bone Tissue Engineering. Acta Biomater. 2011, 7, 2769-2781. (7) Wang, G.; Zheng, L.; Zhao, H.; Miao, J. Y.; Sun, C. H.; Liu, H.; Huang, Z.; Yu, X. Q.; Wang, J. Y.; Tao, X. T. Construction of a Fluorescent Nanostructured Chitosan-Hydroxyapatite Scaffold by Nanocrystallon Induced Biomimetic Mineralization and Its Cell Biocompatibility. ACS Appl. Mater. Interfaces 2011, 3, 1692-1701. (8) Eun-Kyung, L.; Joo Oak, K.; Hui-Suk, Y.; Jinyoung, J.; Chung, B. H. Smart Nanoprobes for the Detection of Alkaline Phosphatase Activity during Osteoblast Differentiation. Chem. Commun. 2015, 51, 3270-3272. (9) Zhang C. M.; Lin J. Defect-related Luminescent Materials: Synthesis, Emission Properties and Applications. Chem. Soc. Rev. 2012, 41, 7938-7961. (10) Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; Jaiswal, R. K.; Douglas, R.; Mosca, J. D.;



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Moorman, M. A.; Simonetti, D. W.; Craig, S.; Marshak, D. R. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 1999, 284, 143-147. (11) Liu, D. D.; Yi, C. Q.; Fong, C. C.; Jin, Q. H.; Wang, Z. K.; Yu, W. K.; Sun, D.; Zhao, J. L.; Yang, M. S. Activation of Multiple Signaling Pathways during the Differentiation of Mesenchymal Stem Cells Cultured in a Silicon Nanowire Microenvironment. Nanomedicine:NBM 2014, 10, 1153-1163. (12) Liu, H. H.; Peng, H. J.; Wu, Y.; Zhang, C.; Cai, Y. Z.; Xu, G. W.; Li, Q.; Chen, X.; Ji, J. F.; Zhang, Y. Z.; OuYang, H. W. The Promotion of Bone Regeneration by Nanofibrous Hydroxyapatite/Chitosan Scaffolds by Effects on Integrin-BMP/Smad Signaling Pathway in BMSCs. Biomaterials 2013, 34, 4404-4417. (13) Xia, L. G.; Lin, K. L.; Jiang, X. Q.; Xu, Y. J.; Zhang, M. L.; Chang J.; Zhang, Z. Y. Enhanced Osteogenesis through Nano-structured Surface Design of Macroporous Hydroxyapatite Bioceramic Scaffolds via Activation of ERK and P38 MAPK Signaling Pathways. J. Mater. Chem. B 2013, 1, 5403-5416. (14) Abbracchio, M. P.; Saffrey, M. J.; Ho, V.; Burnstock, G. Modulation of Astroglial Cell Proliferation by Analogues of Adenosine and ATP in Primary Cultures of Rat Striatum. Neuroscience 1994, 59, 67-76. (15) Wilden, P. A.; Agazie, Y. M.; Kaufman, R.; Halenda, S. P. ATP-stimulated Smooth Muscle Cell Proliferation Requires Independent ERK and PI3K Signaling Pathways. Am. J. Physiol. 1998, 275, H1209-H1215. (16) Buravkova, L.; Rylova, Y.; Andreeva, E.; Kulikov, A.; Pogodina, M.; Zhivotovsky, B.; Gogvadze, V. Low ATP Level is Sufficient to Maintain the Uncommitted State of Multipotent Mesenchymal Stem Cells. Biochim. Biophys. Acta. 2013, 1830, 4418-4425. (17) Shih, Y. R. V.; Hwang, Y.; Phadke, A.; Kang, H.; Hwang, N. S.; Caro, E. J.; Nguyen, S.; Siu, M.; Theodorakis, E. A.; Gianneschi, N. C. Calcium Phosphate-bearing Matrices Induce Osteogenic Differentiation of Stem Cells through Adenosine Signaling. Proc. Natl. Acad. Sci. U.S.A. 2014, 111, 990-995. (18) Kang, H.; Shih, Y. R. V.; Varghese, S. Biomineralized Matrices Dominate Soluble Cues to Direct Osteogenic Differentiation of Human Mesenchymal Stem Cells through Adenosine Signaling. Biomacromolecules 2015, 16, 1050-1061.


Page 16 of 30

Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(19) Kang, H.; Shih, Y. R. V.; Hwang, Y.; Wen, C.; Rao, V.; Seo, T.; Varghese, S. Mineralized Gelatin Methacrylate-based Matrices Induce Osteogenic Differentiation of Human Induced Pluripotent Stem Cells. Acta Biomater. 2014, 10, 4961-4970. (20) Mediero, A.; Cronstein, B. N. Adenosine and Bone Metabolism. Trends Endocrinol. Metab. 2013, 24, 290-300. (21) Calker, D. V.; Müller, M.; Hamprecht, B. Adenosine Regulates via Two Different Types of Receptors, the Accumulation of Cyclic AMP in Cultured Brain Cells. J. Neurochem. 1979, 33, 999-1005. (22) Verzijl, D.; IJzerman, A. P. Functional Selectivity of Adenosine Receptor Ligands. Purinerg. Signal. 2011, 7, 171-192. (23) Zhang, C.; Yang, J.; Quan, Z.; Yang, P.; Li, C.; Hou, Z.; Lin, J. Hydroxyapatite Nano-and Microcrystals with Multiform Morphologies: Controllable Synthesis and Luminescence Properties. Cryst. Growth Des. 2009, 9, 2725-2733. (24) Aspila, K.; Agemian, H.; Chau, A. A Semi-automated Method for the Determination of Inorganic, Organic and Total Phosphate in Sediments. Analyst 1976, 101, 187-197. (25) Zhang, J. C.; Jing, S.; Gu, G. Q.; Hao, X. H.; Liu D. D.; Li. Y. P.; Qin, X. Y.; Wang, S. X. Effects of La3+ on Osteogenic and Adipogenic Differentiation of Primary Mouse Bone Marrow Stromal Cells. J. Rare Earth. 2012, 30, 90-93. (26) Liu, D. D.; Yi, C. Q.; Zhang, D. W.; Zhang, J. C.; Yang, M. S. Inhibition of Proliferation and Differentiation of Mesenchymal Stem Cells by Carboxylated Carbon Nanotubes. ACS nano 2010, 4, 2185-2195. (27) Ge, K.; Zhang, C.; Jia, G.; Ren, H.; Wang, J.; Tan, A.; Liang, X. J.; Zang, A.; Zhang, J. Defect-related Luminescent Mesoporous Silica Nanoparticles Employed for Novel Detectable Nanocarrier. ACS Appl. Mater. Interfaces 2015, 7, 10905-10914. (28) Khalil, I. A.; Kogure, K.; Akita, H.; Harashima, H. Uptake Pathways and Subsequent Intracellular Trafficking in Nonviral Gene Delivery. Pharmacol. Rev. 2006, 58, 32-45. (29) Zhang, Q.; Ge, K.; Duan, J. L.; Chen, S. Z.; Zhang, R.; Zhang, C. M.; Wang, S. X.; Zhang, J. C. Cerium Oxide Nanoparticles Protect Primary Mouse Bone Marrow Stromal Cells from Apoptosis Induced by Oxidative Stress. J. Nanopart. Res. 2014, 16, 1-12. (30) Zhang, J. C.; Li, Y. P.; Sun, J.; Liu, C. L.; Zhang, D. W. Synergistic or Antagonistic Effect of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

MTE plus TF or Icariin from Epimedium Koreanum on the Proliferation and Differentiation of Primary Osteoblasts In Vitro. Biol. Trace. Elem. Res. 2011, 143, 1746-1757. (31) Yang, K. N.; Cao, W.; Hao, X. H.; Xue, X.; Zhao, J.; Liu, J.; Zhao, Y.; Meng, J.; Sun, B.; Zhang, J. C.; Liang, X. J. Metallofullerene Nanoparticles Promote Osteogenic Differentiation of Bone Marrow Stromal Cells through BMP Signaling Pathway. Nanoscale 2013, 5, 1205-1212. (32) Saldanha-Araujo, F.; Ferreira, F. I.; Palma, P. V.; Araujo, A. G.; Queiroz, R. H.; Covas, D. T.; Zago, M. A.; Panepucci, R. A. Mesenchymal Stromal Cells Up-regulate CD39 and Increase Adenosine Production to Suppress Activated T-lymphocytes. Stem. Cell Res. 2011, 7, 66-74. (33) Pifferi, A.; Taroni, P.; Torricelli, A.; Valentini, G.; Mutti, P.; Ghislotti, G.; Zanghieri, L. Nanosecond Time-resolved Emission Spectroscopy from Silicon Implanted and Annealed SiO2 Layers. Appl. Phys. Lett. 1997, 70, 348-350. (34) Marsh, M.; McMahon, H. The Structural Era of Endocytosis. Science 1999, 285, 215-220. (35) Mukherjee, S.; Ghosh, R. N.; Maxfield, F. R. Endocytosis. Physiol. Rev. 1997, 77, 759-803. (36) Suzuki, H.; Toyooka, T.; Ibuki, Y. Simple and Easy Method to Evaluate Uptake Potential of Nanoparticles in Mammalian Cells Using a Flow Cytometric Light Scatter Analysis. Environ. Sci. Technol. 2007, 41, 3018-3024. (37) Meier, O.; Greber, U. F. Adenovirus Endocytosis. J. Gene Med. 2004, 6, S152-S163. (38) Kam, N. W. S.; Dai, H. Carbon Nanotubes as Intracellular Protein Transporters: Generality and Biological Functionality. J. Am. Chem. Soc. 2005, 127, 6021-6026. (39) Zhang, D.; Yi, C.; Zhang, J.; Chen, Y.; Yao, X.; Yang, M. The Effects of Carbon Nanotubes on the Proliferation and Differentiation of Primary Osteoblasts. Nanotechnology 2007, 18, 162-193. (40) Gori, F.; Divieti, P.; Demay, M. B. Cloning and Characterization of a Novel WD-40 Repeat Protein that Dramatically Accelerates Osteoblastic Differentiation. J. Biol. Chem. 2001, 276, 46515-46522. (41) Liu, D. D.; Zhang, J. C.; Zhang, Q.; Wang, S. X.; Yang, M. S. TGF-β/BMP Signaling Pathway is Involved in Cerium-promoted Osteogenic Differentiation of Mesenchymal Stem Cells. J. Cell. Biochem. 2013, 114, 1105-1114. (42) Komori, T. Requisite Roles of Runx2 and Cbfb in Skeletal Development. J. Bone Miner. Metab. 2003, 21, 193-197.


Page 18 of 30

Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(43) Lee, J. H.; Yong, C. S.; Jin, O. S.; Kang, S. H.; Hwang, Y. S.; Park, J. C.; Hong, S.; Han, D. W. Reduced Graphene Oxide-coated Hydroxyapatite Composites Stimulate Spontaneous Osteogenic Differentiation of Human Mesenchymal Stem Cells. Nanoscale 2015, 7, 11642-11651. (44) Salil, B.; Stephanie, F.; Evans, F. J.; Fredric, J.; Balaban, R. S. Metabolic Network Control of Oxidative Phosphorylation: Multiple Roles of Inorganic Phosphate. J. Biol. Chem. 2003, 278, 39155-39165. (45) Kam, N. W. S.; Liu, Z.; Dai, H. Carbon Nanotubes as Intracellular Transporters for Proteins and DNA: an Investigation of the Uptake Mechanism and Pathway. Angew. Chem. Int. Ed. 2006, 118, 591-595. (46) Carroll, S. H.; Wigner, N. A.; Nitin, K.; Hillary, J. C.; Gerstenfeld, L. C.; Katya, R. A2B Adenosine Receptor Promotes Mesenchymal Stem Cell Differentiation to Osteoblasts and Bone Formation in Vivo. J. Biol. Chem. 2012, 287, 15718-15727.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table and Figure Legends Table1. RT-qPCR primers Fig. 1 (A) SEM image of DHAP at 100000×; (B) TEM image of DHAP at 100000×; (C) XRD patterns of DHAP nanoparticle (black) and standard DHAP (red); (D) photoluminescence excitation (purple) and emission (blue) spectra of DHAP. Fig. 2 Photoluminescence spectra (A) and fluorescent photographs (B) of DHAP at 377 nm excitation after immersing in acetic acid 0 h, 3 h, 12 h, and 24 h respectively; (C) phosphate release rate after immersing in acetic acid 3 h, 6 h,12 h, and 24 h. Fig. 3 (A) Cell viability of BMSCs after DHAP treatment for 24 h, 48 h, and 72 h; (B) Relative hemolysis of BMSCs after incubation of H2O (positive), PBS (negative) and DHAP. (***p < 0.001 vs. control). Fig. 4 (A) Confocal laser scanning microscopy images of uptake and localization of DHAPs in; (B) The uptake mechanism was investigated using the inhibitors of endocytosis subcategories.(*p < 0.05, **p < 0.01, ***p < 0.001 vs. positive). Fig. 5 (A and B) ALP activity of BMSCs incubated with DHAP for 7 days and 10 days with the concentrations of 60 µg/ml and 100 µg/ml; (C) Alizarin red straining of BMSCs cultured with DHAP in normal and osteogenic media for 18 days; (D) Quantitative analysis of alizarin red straining results; (E) The mRNA expression of BMP-2, Runx2, Col-1, and OCN in BMSCs treated with DHAP for 5 days, analysis by RT-qPCR; (F) The mRNA expression of Runx2, ALP, and OCN in BMSCs treated with DHAP for 5 days in the present of NaN3, analysis by RT-qPCR. (**, $$, ##, ^^p < 0.01, ***, $$$, ###, ^^^p < 0.001 vs. control). Fig. 6 (A-B) Intracellular PO43− of BMSCs after cultured with DHAP for 3days in control and osteogenic media; (B-C) Confocal laser scanning microscopy images of DHAP in BMSCs for 3h, 6h, 12h, 24h, and 48h and quantitative analysis of fluorescence intensity; (D) ATP of BMSCs after cultured with DHAP and PO43- for 3 days in control and osteogenic media. Fig. 7 (A) ALP activity of BMSCs treated with DHAP and NaN3 for 7days; (B) HPLC measurement of adenosine in culture medium after 3 days; (C) cAMP activity of BMSCs after treated with DHAP in control and osteogenic media; (D) ALP activity of


Page 20 of 30

Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


BMSCs treated with DHAP and H-89 (10µM). (*p < 0.05, **p < 0.01,

***

p < 0.001 vs.

control). Fig. 8 Schematic model of DHAP contributed to osteogenic differentiation of BMSCs.

Table1 Gene

Forward primer

Reverse primer

BMP-2

TGGCCCATTTAGAGGAGAACC

AGGCATGATAGCCCGGAGG

Runx2

TTCTCCAACCCACGAATGCAC

CAGGTACGTGTGGTAGTGAGT

OCN

AACATGACCAAAAACCAAAAGTG

CATTGTTTCCTGTGTCTTCTGG

Col-1

GAACAGACTCCGGCGCTA

AGGGAGGATCAAGTCCCG

ALP

GTTGCCAAGCTGGGAAGAACAC

CCCACCCCGCTATTCCAAAC

GAPDH

GACTTCAACAGCAACTCCCAC

TCCACCACCCTGTTGCTGTA



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figures Fig. 1


Page 22 of 30

Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 2



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 3


Page 24 of 30

Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 4



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 5


Page 26 of 30

Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 6



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig. 7


Page 28 of 30

Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 8



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table Of Contents (TOC)


Page 30 of 30

Defect-Related Luminescent Hydroxyapatite-Enhanced Osteogenic

Recommend Documents