Delivery of Flightless I siRNA from Porous Silicon ... - ACS Publications

Subscriber access provided by TUFTS UNIV

Article

Delivery of Flightless I siRNA from porous silicon nanoparticles improves wound healing in mice Christopher T. Turner, Morteza Hasanzadeh Kafshgari, Elizabeth Melville, Bahman Delalat, Frances J. Harding, Ermei Mäkilä, Jarno J. Salonen, Allison J. Cowin, and Nicolas H. Voelcker ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.6b00550 • Publication Date (Web): 22 Oct 2016 Downloaded from http://pubs.acs.org on October 24, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Biomaterials Science & Engineering is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Delivery of Flightless I siRNA from porous silicon nanoparticles improves wound healing in mice

Christopher T. Turner,1 Morteza Hasanzadeh Kafshgari,2 Elizabeth Melville,1 Bahman Delalat,2 Francis Harding,2 Ermei Mäkilä,3 Jarno J. Salonen,3 Allison J. Cowin1*, Nicolas H. Voelcker2*

1

Regenerative Medicine, Future Industries Institute, University of South Australia, Adelaide,

South Australia 5001, Australia. 2

ARC Centre of Excellence in Convergent Bio-Nano Science and Technology, Future

Industries Institute, University of South Australia, Adelaide, South Australia 5001, Australia. 3

Department of Physics and Astronomy, University of Turku, FI-20014 Turku, Finland.

*Authors contributed equally to the direction of the study. Address correspondence to: [email protected] or [email protected]

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Flightless I (Flii), a cytoskeletal actin remodelling protein, is elevated in wounds and is a negative regulator of wound healing. Gene silencing using small interfering RNA (siRNA) is an attractive approach to antagonize Flii, and therefore holds significant promise as a therapeutic intervention. The development of siRNA therapeutics has been limited by an inability of the siRNA to cross the cell surface plasma membrane of target cells and also by their degradation due to endogenous nuclease action. To overcome these limitations, suitable delivery vehicles are required. Porous silicon (pSi) is a biodegradable high surface area material commonly used for drug delivery applications. Here we investigated the use of pSi nanoparticles (pSiNPs) for the controlled release of Flii siRNA to wounds. Thermally hydrocarbonized pSiNPs (THCpSiNPs) were loaded with Flii siRNA and then coated with a biocompatible chitosan layer. Loading regimens in the order of 50µg of Flii siRNA per mg of pSi were achieved. The release rate of Flii siRNA was sustained over 35 h. When added to keratinocytes in vitro, reduced Flii gene expression in conjunction with lowered Flii protein were observed in concert with increased cell migration and proliferation. A significant improvement in the healing of acute excisional wounds compared to controls was observed from day 5 onwards when Flii siRNA-THCpSiNPs were intradermally injected. THCpSiNPs therefore are an effective vehicle for delivering siRNA and this represents a promising therapeutic approach to improve wound healing.

Keywords: porous silicon, therapeutic siRNA, wound healing, drug delivery, nanomedicine


Page 2 of 33

Page 3 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Wound healing is a complex and dynamic process aimed at restoring both the cellular structure and tissue layers of dermis and other soft tissues following injury. Numerous therapeutic options have been investigated to improve the treatment of wounds, but these have mostly been unsuccessful, necessitating alternative therapeutic approaches. Various proteins have been identified that are negative regulators of wound healing,1,2 and antagonists of these proteins have been developed, that are showing promise as therapeutic agents.1,3

Flightless I (Flii), a cytoskeletal actin remodelling protein, is elevated in cutaneous wounds and has been identified as a negative regulator of wound repair.1 Transgenic mice overexpressing Flii demonstrate impaired cutaneous wound healing compared to wild-type mice, whilst mice with reduced expression show improved wound healing outcomes. Flii influences wound healing by contributing to cell adhesion, proliferation, migration and contraction.1,4,5 Flii neutralizing antibodies (FnAb) improve cellular proliferation and migration of keratinocytes and fibroblasts in vitro1 and have resulted in significant improvements in wound healing when administered in both murine and porcine models of wound repair.1,6

Gene silencing by small interfering RNA (siRNA) is an alternative approach to antagonize target proteins and has the potential to be clinically useful in wounds.7,8,9 SiRNA functions to interfere with the expression of specific genes using complementary nucleotide sequences, causing degradation of mRNA after transcription, and leads to an absence of protein translation. In cultured keratinocytes and fibroblasts, Flii siRNA has been demonstrated to reduce Flii gene expression, leading to improved cell proliferation and migration8 suggesting it may be a suitable candidate compound to improve wound healing.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Technical limitations have thus far prevented the widespread adoption of siRNA therapeutics, with major difficulties being the extracellular degradation of siRNA by endogenous nucleases and an inability to traffic siRNA across the cell surface plasma membranes of target cells.10,11,12 Nanoparticles provide an efficient delivery vehicle for siRNA, protecting the payload whilst also facilitating its entry to the cell by endocytosis and escape from endosomal compartments.13,14 In addition, utilizing pH-responsive polymers (i.e., chitosan and polyethylenimine (PEI)) as a coating layer on the surface of nanocarriers to deactivate the lysosomal nuclease and change the osmolarity of the acidic vesicles accelerates endosomal escape of siRNA and release into the cytosolic space.10,15,16

Porous silicon (pSi) nanomaterials have been identified as promising drug delivery vehicles.17,18 pSi is produced by anodization in hydrofluoric acid (HF) solution to produce high surface area pSi. The porous structure can be manipulated by altering the HF concentration, wafer resistivity applied, and current densities, generating pores ranging from nanometres to microns in diameter and surface areas of up to 800 m2/g.19 The rate of pSi degradation can also be controlled by tuning either pore size or chemistry20,21,22 allowing pSi degradation to be tuned over time frames ranging from days to months.23,24,25 In vivo studies show pSi is biocompatible26,27 with non-toxic silicic acid produced as the pSi degrades.28,29 Thermal carbonization (THC) can be used to stabilize pSi thereby improving the properties for sustained drug release.30 THCpSi nanoparticles (THCpSiNPs) show excellent in vivo stability whilst not inducing either inflammation or toxicity.30 Importantly, various small molecular weight payloads, including proteins and oligonucleotides, are able to be loaded with high efficiency, with these payloads being released as the nanoparticles degrade.31,32,33


Page 4 of 33

Page 5 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The use of pSi nanomaterials for siRNA delivery in vivo has thus far been limited to the treatment of tumors, with systemic administration using this approach encountering a multitude

of

limitations,

including

poor

targeting,

renal

clearance

and

poor

permeability.17,18,34 As an example, Huang et al., 2011 showed mesoporous silica NPs being mostly retained in liver, lung and spleen (> 80%), rather than trafficked to the target tumor.35 This has been partly overcome by altering the shape of the NPs, with evidence of improved cellular uptake, retention and targeting.35,36 A more effective approach has been to use multistage vector systems, where NP carriers (typically liposome based) of siRNA are loaded into the pores of microparticles.17,18,34 Here, these microparticles, which are unable to be endocytosed into the target cells, are administered systemically, before releasing a payload of siRNA-loaded nanoparticles (which can be endocytosed) at the site of the tumor.

The development of pSi vehicles able to effectively deliver siRNA therapeutics to wounds has yet to be reported. Critically, wound treatment (and other diseases where the drug is administered to the site of pathology) have very different requirements to those vehicles designed to treat tumors, including the need for protection from the wound environment, altered release kinetics and avoidance of pore blocking. pSi has been previously reported to effectively deliver therapeutic antibody payloads to wounds,37,38 and pSi nanoparticles are hypothesised to be effective siRNA delivery vehicles. In one study, pSi microparticles loaded with a therapeutic antibody, Infliximab, were incubated with human wound fluid and showed neutralization of the target protein, TNF-α.37 More recently, FnAb was loaded into pSiNPs and administered to both acute and diabetic wounds in mice, leading to improved wound closure.38 Kafshgari et al, showed endocytosis and cytosolic delivery of siRNA to cancer cells in vitro using THCpSiNPs with this leading to reduced expression of the target gene.15 Together, these studies support the use of pSi as a siRNA delivery vehicle for wounds.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

In our previous studies, the effects of chitosan coating of oligonucleotide-loaded THCpSiNPs showed outstanding control over siRNA release kinetics, with no cytotoxicity observed in mammalian cells and efficient cellular uptake.29 In addition, no toxicity was observed for intravenous and subcutaneous delivery to mice. The ability of chitosan- and PEI- coated siRNA-loaded THCpSiNPs to successfully down-regulate gene expression in vivo has yet to be reported. The current study therefore aims to demonstrate the versatility of chitosan-coated THCpSiNPs as a reservoir for Flii siRNA delivery to cutaneous wounds, providing a strategy to improve healing outcomes.

Experimental Section Materials Silicon wafers (boron doped, p+ type, 0.01 to 0.02 Ω cm) were purchased from Siegert Wafer GmbH (Aachen, Germany), hydrofluoric acid (HF, 38%) from Merck GmbH (Darmstadt, Germany). A low molecular weight chitosan (190-310 kDa, 75-85% deacetylated), ethanol (EtOH), glacial acetic acid, hydrogen chloride (HCl), sodium hydroxide (NaOH), 1-decene and phosphate buffered saline, pH 7.2 (PBS) were obtained from Sigma-Aldrich (St. Louis, USA). Dulbecco’s Modified Eagle’s Medium (DMEM) and HyCloneFetal Bovine Serum (FBS) were purchased from Thermo Fisher Scientific (Victoria, Australia). Tissue culture polystyrene 24-well plates were from Greiner Bio-One (Frickenhausen, Germany). Histological stains were from DAKO Corporation (Botany, Australia). Flii and scrambled siRNA was from Invitrogen (Carlsbad, CA, USA). Block-iT™, Lipofectamine 2000 and Opti-MEM I were purchased from Invitrogen and penicillin/streptomycin were both from Sigma-Aldrich. WST-1 was from Roche Applied Science (Munich, Germany).


Page 6 of 33

Page 7 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


siRNA knockdown of Flii Human keratinocytes (HaCaTs) were seeded into 6-well plates at 3, 6, 9 × 104 or 1.2 × 105 cells/well, and cultured for 24 h. To measure transfection efficiency at each level of cell confluence, cells were treated with Block-iT™ fluorescent oligo in the presence of Lipofectamine 2000. Images of the cultured keratinocytes were captured at 24, 48 and 72 h, with transfection efficiency evaluated as the percentage of Block-iT positive cells compared to total cell number. Next, keratinocytes were seeded into 6 well plates at 3 × 104 cells/well and incubated for 24 h. Flii and scrambled siRNA were transfected into these cells using Lipofectamine 2000. Briefly, siRNA was diluted in Opti-MEM I reduced serum medium to a final concentration of 60 nM and then incubated for 20 min at room temperature with Lipofectamine 2000 to form an siRNA:Lipofectamine complex. A total of 500 µL was added to each culture well and the keratinocytes incubated for 6 h prior to replacing transfection media with 10% FBS-supplemented DMEM. Cells were incubated for 48 to 72 h for gene knockdown assessment (72 h data shown in Figure S1). The oligonucleotides used in this study are shown in Table 1.

Table 1: Sequence of oligonucleotides used in this study Oligonucleotide Flii siRNA

Scrambled siRNA

Block-iT™

Sequence

Company

Sense

5'→GCUGGAACACUUGUCUGUGTT→3'

GenePharma

Antisense

5'→CACAGACAAGUGUUCCAGCTT→3'

GenePharma

Sense

5'→UUCUCCGAACGUGUCACGUTT→3'

GenePharma

Antisense

5'→ACGUGACACGUUCGGAGAATT→3'

GenePharma

̶

Invitrogen

Fabrication of THCpSiNPs 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

THCpSiNPs were prepared based on the reported electrochemical etching process.16 Briefly, p+ Type (0.01 to 0.02 Ω cm) silicon wafers were utilized to fabricate pSi films by periodically etching at 50 mA/cm2 (2.2 s period) and 200 mA/cm2 (0. 35 s period) in the aqueous electrolyte (1: 1 HF (38%):EtOH) for 20 min. Subsequently, the detached pSi membranes were prepared by applying the electropolishing conditions (1:1 HF (38%):EtOH, 250 mA/cm2, 3 s period). Next, the pSi membranes were thermally hydrocarbonized under nitrogen/acetylene (1:1) flow at 500°C for 15 min, and then cooled to room temperature under a nitrogen flow. The THC membranes were then converted to THCpSiNPs by means of wet ball-milling with a ZrO2 grinding jar (Pulverisette 7, Fritsch GmbH, Idar-Oberstein, Germany) in 1-decene medium. THCpSiNPs (≤ 200 nm) were collected by centrifugation (1500g, 5 min).

Flii siRNA loading Block-iT™ (67 µL of 322 µg/mL in water) and Flii siRNA (285 µL of 74.88 µg/mL in water) were loaded into the THCpSiNPs (0.35 mg) for the reverse transcription polymerase chain reaction (RT-PCR) experiments and animal studies. The THCpSiNPs were dispersed into the siRNA solution by sonication (5 min) and then incubated at 4 °C overnight. Next, loaded Flii siRNA (Flii siRNA-THCpSiNPs) or loaded Block-iT™ (Block-iT™-THCpSiNPs) were collected by centrifugation (8000 rpm, 5 min). The amount of loaded siRNA was measured by UV-Vis spectrophotometry (HP8453, Agilent Technologies, Santa Clara, CA, USA) at 260 nm from three replicates. All siRNA loading processes were carried out in a biosafety cabinet (Aura 2000, Microprocessor Automatic Control, Firenze, Italy) in order to provide a sterile condition.

Chitosan coating of siRNA/THCpSiNPs


Page 8 of 33

Page 9 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The prepared siRNA-THCpSiNPs (0.1 mg/mL) were dispersed by 1 min sonication into the chitosan (0.1% w/v, pH 5.7, 0.5 mL), and then incubated at 5 °C for 20 min. Subsequently, the chitosan-coated siRNA-THCpSiNPs were harvested by centrifugation (5000 rpm, 5 °C and 5 min). To determine the final loading capacity of the chitosan-coated siRNA loaded THCpSiNPs, the amount of released siRNA during the chitosan coating was assessed by means of UV-Vis spectrophotometry at 260 nm. All coating processes were performed in the biosafety cabinet to maintain the sterile condition, and all prepared particles were kept at 5 °C until use for in vitro and in vivo studies.

Dynamic light scattering and zeta potential Mean hydrodynamic diameter, size distribution, polydispersity index (PDI) and zeta (ζ)potential of THCpSiNPs and chitosan-coated siRNA-THCpSiNPs were measured by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern, Worcestershire, UK). A scattering angle of 90° and a temperature of 25 °C was applied with the nanoparticles dispersed in EtOH and Milli-Q water.

Scanning electron microscopy (SEM) The morphology of THCpSiNPs and chitosan-coated siRNA-THCpSiNPs was determined by SEM (Crossbeam 540, Carl Zeiss AG, Oberkochen, Germany) by collecting the backscattered electrons (0.7 kV beam energy under high vacuum 2 × 10−4 Pa). The samples were prepared by dropping the nanoparticles suspension (50 µL) and allowing it to be dried overnight at room temperature on a graphite layer fixed to a standard SEM holder by doublesided carbon tape.

siRNA release experiments



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The siRNA-THCpSiNPs and chitosan-coated siRNA-THCpSiNPs (0.2 mg/mL) were suspended in PBS (100 µL). The solution containing the nanoparticles was poured into a cellulose membrane dialysis bag and then fitted inside of a quartz cuvette (3 mL) filled with PBS and kept at 37 °C. The amount of siRNA released was determined by means of the UV/Vis spectrophotometry every 5 min for 35 h.

Cell culture Human keratinocytes (HaCaTs) were seeded at 2 x 104 cells/mL into 24-well plates (for RNA and protein purification) and 96-well plates (for the proliferation assay) containing DMEM, 10% (v/v) fetal bovine serum (FBS) and 0.5% (v/v) penicillin/streptomycin. Cells were maintained in culture until approximately 30% confluence. Fifty µg of chitosan coated or uncoated THCpSiNPs (28 µg Flii siRNA per mg) were resuspended in 500 µL (24-well plate) of FBS-free DMEM (final concentration 100 µg/mL) and resuspended by sonication for 5 minutes. Cells were rinsed with PBS, pH 7.2, to remove residual FBS before nanoparticles were added to each well and incubated at 37ºC, 5% CO2 and 95% humidity. After 24 h, media was aspirated and fresh FBS-free DMEM containing nanoparticles was added. Cells were incubated for a further 48 h before cells were harvested (RNA and protein isolation) or treated with WST-1 reagent (proliferation assay).

Cell viability The viability of cultured HaCaTs was evaluated by 0.4% (v/v) trypan blue (Thermo Fisher Scientific, Waltham, USA) uptake as described previously.39

Real-time qPCR


Page 10 of 33

Page 11 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Total RNA was extracted from cultured cells using a Qiagen AllPrep RNA/Protein kit (Hilden, Germany) as per the kit instructions. Contaminating genomic DNA was removed using a DNA-free-kit. cDNA was synthesized from 1 µg RNA using reverse transcriptase. cDNA together with specific primers (Table 2) were set up to a final concentration of 1 × SYBR Green, 1 × Amplitaq PCR buffer, 3 mM MgCl2, dNTPs (200 µM each), 0.9 µM of primers (forward and reverse) and 1.25 units AmpliTaq Gold DNA polymerase in 25 µl H2O. Real-time qPCR reactions were run with an initial 95℃ step for 15 min to activate the Taq buffer, then 35 cycles of: denaturation (95℃ for 30 s), annealing (60℃ for 30 s) and elongation (72℃ for 30 s). Cycle threshold values for Flii were normalized first to cyclophilin A (CypA) to obtain values for fold change.

Table 2: Primer sequences used in real-time qPCR Gene

Forward primer

Reverse primer

Flii

5'→CCTCCTACAGCTAGCAGGTTATCAAC→3'

5'→GCATGTGCTGGATATATACCTGGCAG→3

CypA

5→GGTTGGATGGCAAGCATGTG→3'

5'→TGCTGGTCTTGCCATTCCTG→3'

Western blotting Protein was extracted from keratinocyte pellets using a Qiagen AllPrep RNA/Protein kit as per the kit instructions. Sample protein (10 µg) was run on a 10% SDS-PAGE gels at 100V for 1hr, transferred to nitrocellulose by wet transfer and membranes blocked in 5% milk blocking buffer for 1hr and primary antibodies (mouse anti-flightless I and mouse and βtubulin) at 10 µg/mL added in PBS containing 5% skimmed milk, 0.3% Tween. Speciesspecific secondary horse radish peroxidase-conjugated antibodies were added (1/1000 dilution) for a further 1 h at room temperature. Stringent washes for 1 h were performed before detection of horse radish peroxidase and exposure using GeneSnap analysis program (SynGene, Maryland, USA). Membranes were stripped and re-probed for β-tubulin (Sigma11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Aldrich, Sydney, Australia) for normalization of protein levels. Semi-quantitative protein estimates were performed by the measure of band intensity, using ImageJ 1.50i (NIH, USA) as previously reported.40

Cell proliferation assay Cell proliferation assays were performed using the metabolic substrate WST-1 according to manufacturer’s protocols (Roche Applied Science, Penzberg, Germany). Briefly, 10 µL of WST-1 reagent was added to the cells and left at 37℃ for 90 min. The presence of the formazan product was quantified using a dual absorbance of 450 nm and 600 nm using a SunriseTM plate reader (Tecan Group Ltd, Australia).

Animal studies All experiments were approved by the Women and Children’s Health Network Animal Care and Ethics Committee following the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes (AE 1009/07/18). Six mice were included per treatment group, which included Flii siRNA-THCpSiNPs, scrambled siRNA-THCpSiNPs, Flii siRNA plus unloaded-THCpSiNPs and vehicle-treated (PBS only) controls (all nanoparticles used in vivo were chitosan-coated).

Murine surgical techniques Mice were anaesthetized with inhaled isofluorane, and the dorsum shaved and cleaned with 10% (w/v) povidine iodine solution. Excisional wounds were performed on wild-type Balb/c mice. Two equidistant 6 mm full-thickness excisions were made through the skin and panniculus carnosus using punch biopsy on the flanks of the animals extending 3.5 - 4.5 cm from the base of the skull, 1 cm on either side of the spinal column. THCpSiNPs were diluted


Page 12 of 33

Page 13 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in 100 µL PBS, sonicated for 5 mins, and then injected intradermally with a 21G needle at 4 equidistant locations around the wound margin (25 µL per injection). A total of 9.8 µg siRNA was delivered to each wound, with the amount of administered THCpSiNP being 0.35 mg. Wounds were left to heal by secondary intention (i.e. the wound edges were not closed by sutures). Digital photographs were taken of the wounds daily. A ruler was aligned next to the wound to allow direct wound area and wound gape measurements to be made. Wounds were harvested at 7 d and then bisected with one half fixed in 10% (v/v) buffered formalin and processed so that the midpoint of the wound was sectioned and compared between groups. The other half was micro-dissected to remove any contaminating normal, unwounded skin and snap-frozen in liquid nitrogen for protein/RNA extraction.

Results and Discussion THCpSiNPs were generated with a diameter of 161 ± 70 nm, a ζ-potential at pH 7.1 of −42.3 ± 4.4 mV and an average pore diameter of 9 nm, with an asymmetric morphology as seen by SEM (Figure 1a). THCpSiNPs loaded with Flii siRNA showed an adsorption capacity of 46.4 µg/mg. Similar absorption capacities were determined when particles were loaded separately with either Block-iT™ or scrambled Flii siRNA. This loading was similar to an earlier study with uncoated THCpSiNPs with the same pore size15 and higher than another study using unfunctionalized mesoporous silica nanoparticles with 3.7 nm pores, where there was 27 µg siRNA loaded per mg NP.41 pH and ionic strength are known to impact on the zeta potential measurement and loading capacity.42 Thermal hydrocarbonization produces a surface terminated by hydrocarbon groups, which provide a differential difference in ζpotential (mV) to adsorb siRNA.43,13,29 As an example, the surface original potential of graphene oxide was measured as -26.8 mV in pure water and the ζ-potential of graphene oxide was increased to -9.87 mV after oligonucleotide adsorption (negatively charged DNA)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

on the surface of graphene oxide.44 In addition, ζ-potential measurements are dependent on the solution in which the measurement is undertaken.

Figure 1: Characterization of THCpSiNPs. Panel (a) shows SEM images of THCpSiNPs and (b) shows chitosan-coated siRNA-THCpSiNPs. Images of the particles were representative of the average diameter. (c) Particle size distribution of the THCpSiNPs (blue) and chitosan-coated siRNATHCpSiNPs (red) obtained by DLS. (d) Flii siRNA release from chitosan-coated (red) and uncoated (black) Flii siRNA-THCpSiNPs. Flii siRNA-THCpSiNPs were incubated in PBS, pH 7.4 for 35 h at 37 °C (representative data). Released siRNA was quantified in the PBS buffer at 260 nm.

Coating the siRNA loaded THCpSiNPs with chitosan (0.1% w/v) increased the average nanoparticle diameter to 245 ± 81 nm (Figure 1b, c), showed a positive ζ-potential (21.8 ± 5.14 mV) and led to a 40% reduction in siRNA loading compared to unloaded nanoparticles (28 µg Flii siRNA loaded per mg pSi). This reduction likely occurred in response to loaded siRNA being released from the pores and surfaces into the surrounding aqueous chitosan 14 ACS Paragon Plus Environment

Page 14 of 33

Page 15 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


solution, which has an attractive positive charge. In both the Kafshgari et al and Möller et al studies, in vitro experiments showed the nanoparticles were loaded sufficiently to provide a physiological response,15,41 with the THCpSiNPs generated in this study therefore expected to have sufficient siRNA loading to be effective in vitro.

siRNA release is dependent on the disintegration and dissolution of the chitosan cap as well as the hydrophobicity of the THCpSiNPs.15 In uncoated THCpSiNPs, close to 100% Flii siRNA was released after 35 h, showing a sustained first-order kinetics. siRNA release from chitosan-coated Flii siRNA-THCpSiNPs was slower when compared to the uncoated nanoparticles, accounting for approximately 10% less siRNA release, with a constant release rate from 5 to 30 h (Figure 1d). Treatment of cultured keratinocytes with Flii siRNA chitosan-coated THCpSiNPs led to 60% decrease in Flii RNA expression at 72 h compared to controls (Figure 2a), which although not as effective as Flii siRNA with Lipofectamine (80% reduction; Figure S1), was similar to the reduction in MRP1 expression observed in T98G cancer cells treated with MRP1 siRNA-loaded THCpSiNPs capped with polyethylenimine.15 The success of gene silencing led to a corresponding 60% decrease in Flii protein expression (P < 0.005; Figure 2b, c), providing confirmatory evidence that the chitosan-coated nanoparticles effectively delivered functionally active siRNA to the cytosol of target cells.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2: Flii RNA and protein expression in keratinocytes treated with Flii-siRNA-THCpSiNPs (chitosan-coated). Keratinocytes were cultured to 40% confluence prior to treatment. Cells were treated at 0 and 24 h, with cells then harvested at 72 h. (a) Flii RNA expression was determined in keratinocytes and expressed as fold change compared to media only-treated cells. Quantitative analysis was presented as mean ± SD (n = 3). (b) Flii protein levels was determined in keratinocytes by Western blot, using β-tubulin as a loading control. Bands shown were representative of staining intensity of samples in each treatment group. (c) Semi-quantitative analysis of Flii protein concentration in each treatment group as determined by band intensity normalized to β-tubulin, with data presented as mean ± SD (n = 3). ** P < 0.005.


Page 16 of 33

Page 17 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cultured cells treated with lipofectamine-Flii siRNA are reported to increase migration and proliferation, key mechanistic events that contribute to enhanced wound closure.8 Here, keratinocytes were incubated with chitosan-coated Flii siRNA-THCpSiNPs to determine whether the reduction in Flii mRNA expression corresponded to altered cellular proliferation and migration. A significant and reproducible increase in the proliferation of keratinocytes treated with chitosan-coated Flii siRNA THCpSiNPs (1.6-fold, P < 0.005) was observed compared to untreated cells, and cells treated with chitosan-coated unloaded or chitosancoated scrambled siRNA-loaded nanoparticles (Figure 3a). Scratch assays showed a significant increase in scratch wound closure from 3 h post-scratching (P < 0.05) compared to controls (P < 0.005 from 4 h; Figure 3b). These particles therefore facilitated the delivery of siRNA to target cells, retaining the functionality of the payload and releasing it with sufficient levels to produce a physiological response.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3: Proliferation and migration of keratinocytes treated with chitosan-coated Flii-siRNATHCpSiNPs. The proliferation of cultured keratinocytes was determined by the WST-1 assay (a). Cells were treated with nanoparticles at 0 and 24 h, with proliferation evaluated at 72 h. Scratch assays were performed using keratinocytes cultured to confluence (b). Cells were treated 24 h prior and at the time of scratch wounding. Cells were treated with Flii-siRNA-THCpSiNPs (red) and scrambled-siRNATHCpSiNPs (black). Quantitative analysis was presented as mean ± SD (n = 6). ** P < 0.005, * P < 0.05.


Page 18 of 33

Page 19 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Toxicity within biological systems has been identified as a potential limitation for nanoparticles as therapeutic drug delivery vehicles,45 thus it became important to evaluate cytotoxicity in keratinocytes, the key cell type involved in the epithelialization of cutaneous wounds. Cultured cells treated with 100 µg/mL of uncoated THCpSiNPs showed evidence of cytotoxicity at 24 h (66.4 ± 5.9% viable cells) and complete cell death at 48 h. This result is in contrast with previous study, where no cytotoxicity was observed in mammalian cells treated with an equivalent concentration of uncoated THCpSiNPs.29 This discrepancy may be explained by the susceptibility of different cell types to these particles.46 In contrast, the same concentration of THCpSiNPs coated with chitosan, a biodegradable, biocompatible polysaccharide compound previously shown to improve the overall intracellular delivery of the payload compared to uncoated particles,29 showed no reduction in cell number or viability up to 72 h compared to untreated control cells (> 90%). Since chitosan-coating of the nanoparticles prevented cytotoxicity in keratinocytes, these nanoparticles were deemed safe for more detailed studies in animal models of wound repair. Uncoated nanoparticles were not included in in vivo studies for comparative purposes as these may have caused negative sideeffects in the mice.

Chitosan-coated Flii-siRNA-THCpSiNPs were administered to excisional wounds in mice by intradermal injection around the wound margin, a reproducible method to deliver pSi with high accuracy to the wound. The in vivo degradation behaviour of these nanoparticles has been previously reported, showing the particles to be biocompatible, degraded in skin within 24 hrs, and with no evidence of inflammation and no morphological changes in skin.29 Treatment led to a 20% reduction in wound area at days 6 and 7 compared to the control



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

treatment groups (P < 0.05; Figure 4), suggesting successful intracellular delivery of Flii siRNA and improved wound healing. Dermal wounds were microscopically evaluated in tissue sections, showing complete epithelialization of the Flii-siRNA-THCpSiNP treated wounds, and with morphology closer to unwounded skin than observed for the control treatment groups (Figure 5a). Residual pSi material could not be visualized in these tissue sections, indicating that the particles effectively dispersed and degraded within the wound environment, rather than forming non-degraded aggregates. Additionally, the measure of wound dermal gape in sectioned wound tissue showed a 30% reduction at day 7, thereby providing confirmatory evidence of improved healing in response to treatment (P < 0.05; Figure 5b). Importantly, there was no difference in wound healing between mice treated with Flii siRNA not loaded into nanoparticles (i.e. treatment with siRNA + unloaded nanoparticles) and those treated with unloaded THCpSiNPs, indicating that siRNA needed to be loaded into the particles to provide a therapeutic effect. Chitosan-coated THCpSiNPs can therefore effectively deliver siRNA to target cells within the wound and deliver a sufficient dose of the therapeutic drug to affect wound closure and healing outcomes.


Page 20 of 33

Page 21 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4: Macroscopic analysis of chitosan-coated Flii siRNA-THCpSiNP treated excisional wounds. Wounds were treated at the time of injury. Representative images of the wounds over the course of the 7 day trial (a). Analysis of macroscopic wound images, with data presented as % wound area compared to day 0 (b). Treatment with chitosan-coated Flii siRNA-THCpSiNPs (red line), chitosan-coated scrambled siRNA loaded THCpSiNPs (black dashed line), chitosan-coated unloaded THCpSiNPs plus Flii siRNA (black dotted line) and vehicle-only treated (black line). Quantitative analysis was presented as mean ± SEM (day 0-3, n = 12; day 4-7, n = 6). * P < 0.05, Flii siRNA- compared to the scrambled siRNA-loaded THCpSiNP treated wounds.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5: Microscopic analysis of chitosan-coated Flii siRNA-THCpSiNP treated excisional wounds. SiRNA and vehicle were administered to the wound margin at the time of injury. Tissue sections were prepared from excised wounds at day 7 and stained with H&E (panel a shows representative images), and graphically presented in panel b. Size bars equal 100 µm. The dashed lines in panel a shows the width of the wounded dermis in each tissue section. Data is presented as wound gape as a percentage of chitosan-coated scrambled siRNA THCpSiNP treated wounds. Quantitative analysis was presented as mean ± SEM (n = 6). * P < 0.05, compared to the wounds treated with chitosan-coated scrambled siRNA loaded THCpSiNPs.


Page 22 of 33

Page 23 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conclusions The treatment of wounds is an area of unmet clinical need, with the development of effective therapies expected to drastically improve the lives of patients and reduce the burden on healthcare providers. pSi has various properties that make it especially suitable as a drug delivery vehicle for wound treatment, with benefits including biocompatibility, slow release, amenability to high payload loadings and degradation rates that are tunable.37 Previous studies have used pSi microparticles to systemically deliver siRNA to tumours in mice, showing both safety and effective gene silencing.18,34,47 The functional characteristics of these delivery vehicles are specifically tailored for optimal tumour retention and avoidance of renal clearance. Consequently, microparticles were used, with these delivery vehicles requiring siRNA to be further packaged into liposomes18,34 or conjugated to other carriers,47 enabling siRNA internalization into target cells (microparticles are not endocytosed). Optimal delivery of siRNA to cutaneous wounds, in contrast, requires the vehicle to have wholly different characteristics, including its release profile (timed to coincide with dressing changes) and an increased need for payload protection from the wound environment, where pH, protease concentration and temperature can vary substantially. In addition, since the vehicle was not administered systemically, it can be designed for retention at the delivery site. In the current study, chitosan-coated THCpSiNPs were simply and reproducibly loaded with siRNA at high concentrations. Using nanoparticles, which are endocytosable, rather than the microparticles used in other studies, obviated the need for further siRNA packaging or modification, and thereby is expected to reduce manufacturing costs. Critically, this delivery system effectively down-regulated Flii expression in target cells, leading to improved cutaneous wound healing. This outcome marks the first report of using pSi nanoparticles as a siRNA delivery vehicle to demonstrate a therapeutic benefit in animal models of wound repair.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Supporting Information Transfection efficiency of cultured keratinocytes treated with Flii-siRNA and lipofectamine (Figure S1).

Acknowledgements The authors would like to acknowledge the support of the Australian Government's Cooperative Research Centre Programme. These studies were supported by the Wound Management Innovation Cooperative Research Centre.


Page 24 of 33

Page 25 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


References 1. Cowin, A.J.; Adams, D.H.; Strudwick, X.L.; Chan, H.; Hooper, J.A.; Sander, G.R.; Rayner, T.E.; Matthaei, K.I.; Powell, B.C.; Campbell, H.D. Flightless I deficiency enhances wound repair by increasing cell migration and proliferation. J Pathol 2007,

211(5):572-81. DOI: 10.1002/path.2143 2. Hiebert, P.R.; Granville D.J. Granzyme B in injury, inflammation, and repair. Trends

Mol Med 2012. 18(12):732-41. DOI: 10.1016/j.molmed.2012.09.009. 3. Hsu, I.; Parkinson, L.G.; Shen, Y.; Toro, A.; Brown, T.; Zhao, H.; Bleackley, R.C.; Granville, D.J. Serpina3n accelerates tissue repair in a diabetic mouse model of delayed wound healing. Cell Death Dis 2014. 5:e1458. DOI: 10.1038/cddis.2014.423. 4. Kopecki, Z.; Arkell, R.; Powell, B.C.; Cowin, A.J. Flightless I regulates hemidesmosome formation and integrin-mediated cellular adhesion and migration during

wound

repair.

J

Invest

Dermatol

2009.

129:2031–2045.

DOI:

10.1038/jid.2008.461. 5. Kopecki, Z.; O'Neill, G.M.; Arkell, R.M.; Cowin, A.J. Regulation of focal adhesions by flightless i involves inhibition of paxillin phosphorylation via a Rac1-dependent pathway. J Invest Dermatol 2011. 131(7):1450-9. DOI: 10.1038/jid.2011.69. 6. Jackson, J.E.; Kopecki, Z.; Adams, D.H.; Cowin, A.J. Flii neutralizing antibodies improve wound healing in porcine preclinical studies. Wound Repair Regen 2012.

20(4):523-36. DOI: 10.1111/j.1524-475X.2012.00802.x. 7. Castleberry, S.A.; Almquist, B.D.; Li, W.; Reis, T.; Chow, J.; Mayner, S.; Hammond, P.T. Self-Assembled Wound Dressings Silence MMP-9 and Improve Diabetic Wound Healing In Vivo. Adv Mater 2016. 28(9):1809-17. DOI: 10.1002/adma.201503565. 8. Martens, P.J.; Ly, M.; Adams, D.H.; Penzkover, K.R.; Strudwick, X.; Cowin, A.J.; Poole-Warren, L.A. In vivo delivery of functional Flightless I siRNA using layer-by-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

layer polymer surface modification. J Biomater Appl 2015. 30(3):257-68. DOI: 10.1177/0885328215579422. 9. Charafeddine, R.A.; Makdisi, J.; Schairer, D.; O'Rourke, B.P.; Diaz-Valencia, J.D.; Chouake, J.; Kutner, A.; Krausz, A.; Adler, B.; Nacharaju, P.; Liang, H.; Mukherjee, S.; Friedman, J.M.; Friedman, A.; Nosanchuk, J.D.; Sharp, D.J. Fidgetin-Like 2: A Microtubule-Based Regulator of Wound Healing. J Invest Dermatol 2015.

135(9):2309-18. DOI: 10.1038/jid.2015.94. 10. Juliano, R.L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res 2016. Apr 15. DOI: 10.1093/nar/gkw236. 11. Akhtar, S.; Benter, I.F. Nonviral delivery of synthetic siRNAs in vivo. J Clin Invest 2007. 117(12):3623-32. DOI: 10.1172/JCI33494 12. Alexis, F.; Pridgen, E.; Molnar, L.K.; Farokhzad, O.C. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Mol Pharm 2008. 5(4):505-15. DOI: 10.1021/mp800051m. 13. Hasanzadeh Kafshgari, M.; Alnakhlib, M.; Delalat, B.; Apostolou, S.; Harding, F.J.; Mäkilä, E.; Salonen, J.J.; Kuss, B.J. and Voelcker, N.H. Small interfering RNA delivery by polyethylenimine-functionalized porous silicon nanoparticles. Biomater.

Sci 2015. 3, 1555. DOI: 10.1039/c5bm00204d. 14. Shete, H.K.; Prabhu, R.H.; Patravale, V.B. Endosomal escape: a bottleneck in intracellular delivery. J Nanosci Nanotechnol 2014. 14(1):460-74. 15. Kafshgari, M.H.; Voelcker, N.H.; Harding, F.J. Applications of zero-valent silicon nanostructures in biomedicine. Nanomedicine (Lond) 2015. 10(16):2553-71. DOI: 10.2217/nnm.15.91.


Page 26 of 33

Page 27 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


16. Nel, A.E.; Mädler, L.; Velegol, D.; Xia, T.; Hoek, E.M.; Somasundaran, P.; Klaessig, F.; Castranova, V.; Thompson, M. Understanding biophysicochemical interactions at the nano-bio interface. Nat Mater 2009. 8(7):543-57. DOI: 10.1038/nmat2442. 17. Shen, J.; Xu, R.; Mai, J.; Kim, H.C.; Guo, X.; Qin, G.; Yang, Y.; Wolfram, J.; Mu, C.; Xia, X.; Gu, J.; Liu, X.; Mao, Z.W.; Ferrari, M.; Shen, H. High capacity nanoporous silicon carrier for systemic delivery of gene silencing therapeutics. ACS Nano 2013.

26;7(11):9867-80. DOI: 10.1021/nn4035316. 18. Mi, Y.; Mu, C.; Wolfram, J.; Deng, Z.; Hu, T.Y.; Liu, X.; Blanco, E.; Shen, H.; Ferrari, M. A Micro/Nano Composite for Combination Treatment of Melanoma Lung Metastasis. AdvHealthc Mater 2016. 5(8):936-46. DOI: 10.1002/adhm.201500910. 19. Vasani, R.B.; McInnes, S.J.; Cole, M.A.; Jani, A.M.; Ellis, A.V.; Voelcker, N.H. Stimulus-responsiveness and drug release from porous silicon films ATRP-grafted with

Langmuir

poly(N-isopropylacrylamide).

2011.

27(12):7843-53.

DOI:

10.1021/la200551g. 20. Alvarez, S.D.; Derfus, A.M.; Schwartz, M.P.; Bhatia, S.N.; Sailor, M.J. The compatibility of hepatocytes with chemically modified porous silicon with reference to

in

vitro

biosensors.

Biomaterials

2009.

30:26-34.

DOI:

10.1016/j.biomaterials.2008.09.005. 21. Canham, L.; Aston, R. Will a chip everyday keep the doctor away? Phys World 2001. 27-31. DOI: 10.1186/1556-276X-7-385 22. Canham, L.T. Bioactive silicon structure fabrication through nanoetching techniques.

Adv Mater 1995. 7:1033-7. DOI: 10.1002/adma.19950071215 23. Tessmar, J.K.; Göpferich, A.M. Matrices and scaffolds for protein delivery intissue engineering.

Advanced

Drug

Delivery

Reviews

10.1016/j.addr.2007.03.020


2007.

59:274-91.

DOI:


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 33

24. McInnes, S.; Szili, E.J.; Al-Bataineh, S.A.; Xu, J.; Alf, M.E.; Gleason, K.K.; Short, R.D.; Voelcker, N.H. Combination of iCVD and Porous Silicon for the Development of a Controlled Drug Delivery System. ACS Appl Mater Interfaces 2012. 4:3566-74. DOI: 10.1021/am300621k. 25. McInnes, S.; Thissen, H.; Choudhury, N.R.; Voelcker, N.H. New biodegradable materials produced by ring opening polymerization of poly(L-lactide) on porous silicon

substrates.

J

Colloid

Interface

Sci

2009.

332:336-44.

DOI:

10.1016/j.jcis.2008.12.073. 26. Low, S.P.; Voelcker, N.H.; Canham, L.T.; Williams, K.A. The biocompatibility of porous silicon in tissues of the eye. Biomaterials 2009. 30:2873-80. DOI: 10.1016/j.biomaterials.2009.02.008. 27. Cheng, L.; Anglin, E.; Cunin, F.; Kim, D.; Sailor, M.J.; Falkenstein, I.; Tammewar, A.; Freeman, W.R. Intravitreal properties of porous silicon photonic crystals: a potential self-reporting intraocular drug-delivery vehicle. British Journal of

Ophthalmology 2008. 92:705-11. DOI: 10.1136/bjo.2007.133587. 28. Anglin, E.J.; Cheng, L.; Freeman, W.R.; Sailor, M.J. Porous silicon in drug delivery devices

and

materials.

Adv

Drug

Deliv

Rev

2008.

60:1266-77.

DOI:

10.1016/j.addr.2008.03.017. 29. Kafshgari, M.H.; Delalat, B.; Tong, W.Y.; Harding, F.J.; Kaasalainen, M.; Salonen J.; Voelcker, N.H. Oligonucleotide delivery by chitosan-functionalized porous silicon nanoparticles. Nano Research 2015. 8,6:2033-2046. DOI: 10.1007/s12274-015-07150. 30. Bimbo, L.M.; Sarparanta, M.; Santos, H.A.; Airaksinen, A.J.; Mäkilä, E.; Laaksonen, T.; Peltonen. L.; Lehto, V.P.; Hirvonen, J.; Salonen, J. Biocompatibility of Thermally


Page 29 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Hydrocarbonized Porous Silicon Nanoparticles and their Biodistribution in Rats. ACS

Nano 2010. 4:3023-32. DOI: 10.1021/nn901657w. 31. Salonen, J.; Laitinen, L.; Kaukonen, A.M.; Tuura, J.; Björkqvist, M.; Heikkilä, T.; Vähä-Heikkilä, K.; Hirvonen, J.; Lehto, V.P. Mesoporous silicon microparticles for oral drug delivery: loading and release of five model drugs. J Control Release 2005.

108(2-3):362-74. DOI: 10.1016/j.jconrel.2005.08.017. 32. Andrew, J.S.; Anglin, E.J.; Wu, E.C.; Chen, M.Y.; Cheng, L.; Freeman, W.R.; Sailor, M.J. Sustained release of a monoclonal antibody from electrochemically prepared mesoporous

silicon

oxide.

AdvFunct

Mater

2010.

20:4168-74.

DOI:

10.1002/adfm.201000907. 33. Rytkönen, J.; Arukuusk, P.; Xu, W.; Kurrikoff, K.; Langel, Ü.; Lehto, V-P.; Närvänen, A. Porous Silicon–Cell Penetrating Peptide Hybrid Nanocarrier for Intracellular Delivery of Oligonucleotides. Mol Pharmaceutics 2014. 11:382-90. DOI: 10.1021/mp4002624. 34. Xu, R.; Huang, Y.; Mai, J.; Zhang, G.; Guo, X.; Xia, X.; Koay, E.J.; Qin, G.; Erm, D.R.; Li, Q.; Liu, X.; Ferrari, M.; Shen, H. Multistage vectored siRNA targeting ataxia-telangiectasia mutated for breast cancer therapy. Small 2013. 27;9(9-10):1799808. DOI: 10.1002/smll.201201510. 35. Huang, X.; Li, L.; Liu, T.; Hao, N.; Liu, H.; Chen, D.; Tang, F. The shape effect of mesoporous silica nanoparticles on biodistribution, clearance, and biocompatibility in vivo. ACS Nano 2011. 26;5(7):5390-9. DOI: 10.1021/nn200365a. 36. Hao, N.; Li, L.; Tang, F. Shape-mediated biological effects of mesoporous silica nanoparticles. J Biomed Nanotechnol 2014. 10(10):2508-38. 37. McInnes, S.; Turner, C.; Al-Bataineh, S.; Airaghi Leccardi, M.; Irani, Y.; Williams, K.; Cowin, A.; Voelcker, N. Surface engineering of porous silicon to optimise



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 33

therapeutic antibody loading and release. Journal of Materials Chemistry B 2015.

3;4123-4133. DOI: 10.1039/C5TB00397K. 38. Turner, C.T.; McInnes, S.J.P.; Voelcker, N.; Cowin, A.J. Porous Silicon Nanoparticles Loaded with Flightless I Neutralizing Antibodies Improve Healing of Wounds in Diabetic Mice. Australian New Zealand Bone and Mineral Society Annual

Scientific Meeting, 2015. 39. Turner, C.T.; Fuller, M.; Hopwood, J.J.; Meikle, P.J.; Brooks, D.A. Glycogen Exocytosis from Pompe Skin Fibroblasts. Trans Biomed 2015. 6(2):17. DOI: 10.21767/2172-0479.100017. 40. Gassmann, M.; Grenacher, B.; Rohde, B.; Vogel, J. Quantifying Western blots: pitfalls

of

densitometry.

Electrophoresis

2009.

30(11):1845-55.

DOI:

10.1002/elps.200800720. 41. Turner, C.T.; McInnes, S.J.P.; Voelcker, N.H.; and Cowin, A.J. Therapeutic potential of inorganic nanoparticles for the delivery of monoclonal antibodies. J Nanomaterials 2015. 309602. DOI: 10.1155/2015/309602. 42. Kaasalainen, M.; Mäkilä, E.; Riikonen, J.; Kovalainen, M.; Järvinen, K.; Herzig, K.H.; Lehto, V.-P.; Salonen, J. Effect of isotonic solutions and peptide adsorption on zeta potential of porous silicon nanoparticle drug delivery formulations. Int. J. Pharm. 2012, 431, 230–236. 43. Salonen, J.; Björkqvist, M.; Paski, J. Temperature-dependent electrical conductivity in thermally carbonized porous silicon. Sens. Actuators, A 2004, 116, 438-441. 44. Gang, J. Graphene oxide-based direct measurement of dnase i activity with single stranded DNA. Bull. Korean Chem. Soc. 2014, 35, 2749-2752. 45. Möller, K.; Müller, K.; Engelke, H.; Bräuchle, C.; Wagner, E.; Bein, T. Highly efficient siRNA delivery from core-shell mesoporous silica nanoparticles with


Page 31 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


multifunctional

polymer

caps.

Nanoscale

2016.

11;8(7):4007-19.

DOI:

10.1039/C5NR06246B. 46. Zhang, L.W.; Monteiro-Riviere, N.A. Mechanisms of quantum dot nanoparticle cellular uptake. Toxicol Sci 2009. 110(1):138-55. DOI: 10.1093/toxsci/kfp087. 47. Xia, T.; Kovochich, M.; Liong, M.; Zink, J.I.; Nel, A.E. Cationic polystyrene nanosphere toxicity depends on cell-specific endocytic and mitochondrial injury pathways. ACS Nano 2008. 2(1):85-96. DOI: 10.1021/nn700256c.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Delivery of Flightless I siRNA from porous silicon nanoparticles improves wound healing in mice

Christopher T. Turner,1 Morteza Hasanzadeh Kafshgari,2 Elizabeth Melville,1 Bahman Delalat,2 Francis Harding,2 Ermei Mäkilä,3 Jarno J. Salonen,3 Allison J. Cowin1*, Nicolas H. Voelcker2*

1

Regenerative Medicine, Future Industries Institute, University of South Australia, Adelaide,

South Australia 5001, Australia. 2

ARC Centre of Excellence in Convergent Bio-Nano Science and Technology, Future

Industries Institute, University of South Australia, Adelaide, South Australia 5001, Australia. 3

Department of Physics and Astronomy, University of Turku, FI-20014 Turku, Finland.

*Authors contributed equally to the direction of the study.

Table of Contents graphic


Page 32 of 33

Page 33 of 33

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


504x157mm (150 x 150 DPI)

ACS Paragon Plus Environment

Delivery of Flightless I siRNA from Porous Silicon ... - ACS Publications

Recommend Documents