Demonstration by Real-Time Polymerase Chain Reaction that Cellular

Demonstration by Real-Time Polymerase Chain Reaction that Cellular DNA ... In addition, real-time reverse transcriptase (RT) PCR is used to examine th...
0 downloads 0 Views 754KB Size
Download PDF
Chem. Res. Toxicol. 2005, 18, 239-248

239

Demonstration by Real-Time Polymerase Chain Reaction that Cellular DNA Alkylation by Novel Aminoindoline Compounds Affects Expression of the Protooncogene c-myc Stephanie M. Nelson,* Lynnette R. Ferguson, and William A. Denny Auckland Cancer Society Research Centre, School of Medical Sciences, The University of Auckland, Private Bag 92019, Auckland 10000, New Zealand Received June 1, 2004

Aminoindolines, analogues of the potent DNA alkylating agent seco-CBI-TMI, bind to and alkylate in the minor groove of AT-rich DNA in vitro. Here we extend the in vitro mechanism of action studies by treating cells in culture and examining the DNA binding patterns within AT-rich regions of the protooncogene locus c-myc, using a real-time polymerase chain reaction (PCR) stop assay. In addition, real-time reverse transcriptase (RT) PCR is used to examine the immediate effects of drug treatment on c-myc expression. These analyses demonstrate a concentration and time dependence for DNA alkylation at the chosen sites within the c-myc locus, as well as a prompt and significant downregulation of c-myc expression. While downregulation of this important growth regulator is likely not the only consequence of aminoindoline treatment, these studies begin to address the cellular pathways that are involved in the potent cytotoxic effects observed and provide insights for the future development of anticancer drugs of this class.

Introduction The class of compounds known generically as the cyclopropyldienones, exemplified by the antitumor antibiotic CC-1065 (1) isolated from Streptomyces zelensis (1), have received much attention as potential anticancer drugs because of their extreme potency (2). The full complexities of the natural products are not required for high potency, with synthetic variants such as CBI-TMI (2) showing similar cytotoxicity (2). The phenolic seco precursors (hydroxyindolines) (e.g., 3) also retain essentially the full cytotoxicity of the corresponding cyclopropyldienones, since they readily ring-close to them under physiological conditions (3). Four compounds of this general class, including the cyclopropyldienone adozelesin (4) (4) and the bis seco analogue bizelesin (5) (5), have received clinical trials, but none showed significant anticancer activity. Nevertheless, the class remains of interest in various prodrug approaches, including armed antibodies (6) and gene-directed enzyme-prodrug therapy. The latter uses both sugar analogues as prodrugs of hydroxyindolines (e.g., 5) (7), and nitro analogues as prodrugs of aminoindolines (e.g., 6) (8, 9). Despite considerable work, the detailed molecular mechanism of action that confers such high potency on these drugs is not clear. They are known to initially bind in the minor groove of DNA in AT-rich sequences, with the consensus length and sequence varying somewhat from one compound to the next (10). This reversible “binding” is followed by opening of the strained cyclopropyl ring, suggested to be due to loss of “vinologous amide” stabilization of the dienone because of conforma* To whom correspondence should be addressed. Tel: 64-09-373-7599. Fax: 64-09-373-7502. E-mail: [email protected].

tional changes (11). This results in alkylation by the least hindered carbon of the cyclopropyl group at the N-3 position of adenine, with the remainder of the molecule remaining in the minor groove, where it can make stabilizing van der Waal and H-bond contacts. One explanation for the extreme potency of the indolines is that their DNA binding sequence specificity targets them to critical genomic locations, leading to disruption in metabolic processes occurring there (12). For instance, bizelesin and a close analogue, U-78779, show a regional binding effect, reacting preferentially at sites clustered in “AT islands”, containing between 85% and 100% AT (12-16). Such AT islands have recently been shown to function as matrix attachment regions (MARs)1 that organize DNA loops on the nuclear matrix and coordinate nuclear activities such as DNA replication and transcription (12). Adozelesin binding sites, being smaller, are also present in AT islands but in addition are distributed at low frequency throughout the genome so that targeting of adozelesin is less specific than with the bifunctional compounds. This difference in drug binding site distribution may be one of the reasons for the higher potency of bizelesin and other bifunctional compounds compared to adozelesin. In addition, the drug potency may be enhanced due to expansion of these satellite regions resulting from genomic instability and/ or because of deletions in these critical regions following drug treatment (17). The inability of the cell to ad1 Abbreviations: PCR, polymerase chain reaction; MAR, matrix attachment region; EMSA, electromobility shift assay; TBP, TATA box binding protein; SP1, specificity factor 1; KLF, Kruppel-like factor; SV40, simian virus 40; DMSO, dimethyl sulfoxide; RT, reverse transcriptase; DMA, dimethylamine; ORI, origin of replication; GI50, drug concentration inhibiting growth by 50%; CPT, camptothecin.

10.1021/tx049852t CCC: $30.25 © 2005 American Chemical Society Published on Web 01/14/2005

240

Chem. Res. Toxicol., Vol. 18, No. 2, 2005

equately recognize and repair imposed damage may also trigger a death signal. Selective damage to AT-rich DNA in promoter/enhancer regions will likely affect specific gene expression. This may arise by preventing transcription factor binding, increasing the affinity of a transcription factor for its sequence, or creating unnatural binding sites (18). For example, 1 has been shown by electromobility shift assays (EMSA) to inhibit TATA box binding protein (TBP) from binding to a DNA oligonucleotide containing the adenovirus major late promoter TATA box sequence (19). In this case, drug binding was thought to directly hinder minor-groove binding of TBP to the TATA box. Binding of specificity factor 1 (SP1), a member of the SP/ Kruppel-like factor (KLF) family of transcription factors (20), to six GC boxes present in the simian virus 40 (SV40) early promoter is also inhibited by 1 binding to AGTTA between the SP1 sites (21). These authors propose that the inhibition in SP1 binding resulted from distortions in the DNA caused by adduct formation. ATrich sequences found in regulatory regions in other genes associated with cancer, such as c-myc, have also been identified as sites specifically alkylated in cells treated with related compounds (15). However, whether alkylation in these regions affects transcription has not been determined. The corresponding aminoindoline seco-CBI-TMI compounds (e.g., 6 and 7) are less well studied but are of interest as the cytotoxic species for both nitro- (9) and nitrobenzyl carbamate-based prodrugs (22). The limited mechanism studies to date show that the aminoindolines 6 and 7 also alkylate only at adenine bases in a target gpt gene, with a similar consensus sequence (NAA/TAN). The amino compounds were somewhat more selective than the corresponding hydroxy analogues, and in both series, the “natural” S enantiomers were more cytotoxic and more efficient alkylators than the corresponding R enantiomers (23). The amino R enantiomer (6) was approximately 5-6 times more potent than the hydroxy R enantiomer in cytotoxicity assays in three different cell lines. In this study, we use a specifically designed real-time PCR stop assay to study the site-specific DNA alkylation of aminoindolines in mammalian cells and the immediate effects on gene expression near these sites. We chose to conduct these studies using the CEM T cell acute lymphoblastic leukemia line for comparison with other published studies and the Raji Burkitt’s lymphoma cell line because the c-myc locus on one allele is involved in a translocation that results in overexpression of this important oncogene (24, 25).

Experimental Procedures Cell Culture. CEM, Raji, and U937 cell lines were maintained in R-minimal essential medium supplemented with 10% fetal calf serum and 1% penicillin-streptomycin at 37 °C. For DNA and RNA extractions of treated cells, 1 mL of cells (at a concentration between 5 × 105 and 2 × 106 cells/mL, the same within each experiment) were aliquoted into 5-mL snap-cap tubes. Treatments were performed in duplicate from the start of each experiment unless noted otherwise. The appropriate volume of medium, diluted dimethyl sulfoxide (DMSO) or dimethylacetamide (DMA), or diluted aminoindoline was added to each sample and gently vortexed. Cells were immediately placed in a 37 °C incubator at a 10-15° angle. During the experiment cells were gently agitated every hour. Most treat-

Nelson et al. ments were continuous for 4 h with time points taken at 3045 min, 2 h, and 4 h, unless noted otherwise. DNA and RNA Preparation and Real-Time PCR. Genomic DNA was extracted from cell pellets according to the Puregene DNA extraction protocol for cultured cells (Gentra Systems). DNA samples were quantitated by use of the BioRad fluorescent DNA quantitation kit and a Bio-Rad VerasFluor fluorometer system. RNA extractions were performed with the Purescript RNA extraction kit for cultured cells (Gentra Systems). RNA samples were quantitated by use of the Ribogreen RNA quantitation reagent and kit (Molecular Probes). For the real-time PCR stop assay, 50 ng of genomic DNA was amplified with 200 nM of each primer in 1× Syber green PCR master mix (Applied Biosystems) and 0.01 unit/µL AmpErase uracil N-glycosylase (UNG) in a total volume of 20 µL under universal cycling conditions (2 min at 50 °C, 10 min at 95 °C, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min). MicroAmp optical 96-well plates and ABI Prism optical adhesive covers were used (Applied Biosystems). Samples were run in duplicate on the ABI Prism 7700 sequence detection system. Primer sequences were designed with Primer Express software: MARF, AGCAGTTACACAGAATTTCAATCCTAGT; MAR-R, GGTGGTGGTTGGGAGGG; ORI-F, GCCGTTTTAGGGTTTGTTGGA; ORI-R, GCTGCAGAAGGTCCGAAGAA; β-G-F, TGGGCAGGTTGGTATCAAGG; β-G-R, AGGAGTGGACAGATCCCCAAA; RTMYC-F, ACTCCAGCGCCTTCTCTCC; RTMYC-R, GCCTGCCTCTTTTCCACAGA; RTHPRT-F, GTGATGATGAACCAGGTTATGACC; RTHPRT-R, TCAGCAAAGAATTTATAGCCCCC. Plasmid standards were made by cloning PCR products with the Topo TA cloning kit (Invitrogen), followed by purification via Qiagen mini preps. Each plasmid was serially diluted into a solution of λ DNA (5 ng/µL) prior to PCR. Plasmid inserts were sequenced by use of M13 primers by the DNA Sequencing Facility, Faculty of Medicine and Health Science, University of Auckland, to confirm PCR product identity. The melting temperature of each PCR product was determined by use of Disassociation Curve Software and cycling recommendations, and was used to confirm presence of intended product following PCR (Applied Biosystems). Primers were designed that amplify 200 bp sequences of DNA within the c-myc origin of replication (ORI), the c-myc MAR, and the β-globin locus. The sites contain sequences used in previous end-point PCR experiments (15), but the size of the amplicons is considerably smaller, allowing easier and more accurate quantitation. The amplified regions have overall AT content of approximately 61%, 76%, and 52%, respectively, and the corresponding potential drug binding sites are c-myc ORI, 19 overlapping 5′-AT/AA-3′ and four AT stretches of 6 bp; c-myc MAR, 47 overlapping 5′-AT/AA-3′ and 10 AT 6-bp stretches; and β-globin, 10 overlapping 5′-AT/AA-3′ and two AT 6-bp stretches. Dilution series of plasmid DNA containing cloned PCR amplicons were used to generate a standard curve for each PCR experiment. The relative amounts of amplification based on comparison with the standard curves at the two c-myc sites were normalized to the β-globin site for each treatment regime. Real-time reverse transcriptase (RT) PCR was performed in two steps. Reverse transcription was performed with 100-500 ng of RNA, 1× TaqMan RT buffer, 5.5 mM MgCl2, 0.5 mM each dNTP, 2.5 µM random hexamer or oligo-d(T)16 primer, 0.4 unit/ µL RNase inhibitor, and 1.25 unit/µL Multiscribe RT (TaqMan reverse transcription reagents, Applied Biosystems). Reactions (30 µL) were incubated at 25 °C for 10 min, 48 °C for 30 min, and 95 °C for 5 min. Aliquots (3-5 µL) of the RT reaction were used as a template for the real-time PCR step. Samples were amplified in duplicate with 100 nM each primer, 1× SYBER green PCR master mix, and 0.01 unit/µL AmpErase UNG (20 µL total volume reactions). The cycling parameters were 2 min at 50 °C, 10 min at 95 °C, 45 cycles of 15 s at 95 °C, and 1 min at 64 °C. RNA obtained from untreated cells was used to generate a standard curve for each assay by serially diluting the cDNA prior to the PCR step.

Cellular DNA Alkylation Affects Expression of c-myc

Chem. Res. Toxicol., Vol. 18, No. 2, 2005 241

Figure 1. Chemical structures of compounds. Cell Lysate Preparation and Immunoblotting. Cell pellets were collected and lysed in SDS lysis buffer (10 mM TrisHCl, pH 7.4, and 1% SDS) containing the protease inhibitors 3 µg/mL pepstatin, 10 µg/mL aprotinin, and 1 mM phenylmethanesulfonyl fluoride (PMSF). Lysates were cleared by passage through a 25-gauge needle and centrifuged at 13 000 rpm for 5 min, and supernatants were transferred to new tubes. Protein estimations were carried out by use of the Bradford reagent. Total cell lysate (30 µg) was loaded onto SDS-10% polyacrylamide gels, run for 1 h at 120 V, transferred to nitrocellulose, and blotted overnight in 5% milk powder/PBS/ 0.5% Tween. Primary antibody (anti-c-Myc and anti-GAPDH; Abcam) was added at 1:1000-1:5000 dilution for 2 h at room temperature, washed, and incubated with an appropriate secondary horseradish peroxidase- (HRP-) conjugated antibody. Blots were developed by use of the Pierce SuperSignal West pico chemiluminescent substrate and exposed to autoradiographic film.

Results Real-Time PCR Stop Assay To Assess DNA Alkylation by Bizelesin in Cells. To validate the real-time PCR assay, we examined the DNA alkylation preference of bizelesin (5) (Figure 1). Treatment of CEM cells with 5 has been previously shown to inhibit PCR amplification of AT-rich regions of genomic DNA, by conventional endpoint PCR analysis, and thus it has been termed a regionspecific DNA alkylating reagent (15). Cells were treated for 4 h with 5 or with solvent alone (DMA), and samples were collected for DNA extraction at 0.5, 1.5, and 4 h. The schematic diagram in Figure 2A shows the c-myc locus and PCR primers used in this study as compared

to ref 15. Figure 2B shows an approximately 95% inhibition of PCR at the AT-rich c-myc MAR sequence between 0.5 and 1.5 h of exposure of CEM cells to 0.2 µM 5 and a 42-45% decrease at the c-myc ORI locus, with complete recovery by 4 h. At the higher concentration of 1 µM 5 (continuous exposure), there is a nearly constant 32-42% inhibition at the c-myc ORI site throughout the experiment (Figure 2C). Aminoindolines 6-8 Demonstrate DNA Alkylation Preference within AT-Rich Regions, Similar to 5, Measured by the Real-Time PCR Stop Assay. The real-time PCR stop assay was also used to examine the DNA alkylation preferences of the hydroxyindoline compound (3), and the aminoindolines (6-8) in CEM (Tcell acute lymphoblastic leukemia) and Raji (Burkitt’s lymphoma) cells. Figure 3A,B shows the PCR inhibition patterns at the c-myc MAR and ORI sites for representative experiments with 6 and 7 continuous treatment of CEM cells. The experimental PCR is normalized to the control PCR (β-globin), and samples are calibrated to the normalized values for untreated cells. By 30-45 min, there is a dramatic inhibition of PCR (>95%) at both the c-myc MAR and ORI sites at the highest concentration of compound 6 tested (10 µM). At lower concentrations of 6 (2.5, 1.0, and 0.625 µM), the degree of inhibition at both sites is reduced, and the time to reach maximum inhibition increases. The same pattern is true with the less potent enantiomer 7, although even at the highest concentration (10 µM) a reduction in PCR amplification is not observed until the 2 h time point.

242

Chem. Res. Toxicol., Vol. 18, No. 2, 2005

Nelson et al.

Figure 2. PCR amplification is differentially inhibited at AT-rich c-myc sites following continuous treatment of CEM cells with bizelesin, 5. (A) A real-time PCR assay was developed to examine amplification at two different AT-rich regions within the c-myc locus (MAR and ORI) compared to a control region within the β-globin locus (approximately 50% AT). The primer binding sites (arrows) within c-myc are shown under the locus. The top primers correspond to the end-point PCR primers developed by Woynarowski et al. (15). The bottom primers (*) correspond to the primers used in this study. (B) Relative amplification (y-axis) is measured as the ratio of cells treated with 0.2 µM compound 5 to cells treated with DMA at the c-myc and control sites indicated [(5-treated MAR/5treated control)/(DMA-treated MAR/DMA-treated control)]. Samples were taken at the time points indicated (hours). PCR reactions were performed in duplicate. Standard deviations based on the normalized PCR are shown with error bars. Inhibition of PCR amplification at the c-myc ORI is time-dependent at this concentration of 5. Black bar, MAR site; gray bar, ORI site. (C) The higher concentration of 5 (1.0 µM) shows that recovery of PCR amplification at the c-myc ORI is time- and concentration-dependent. PCR inhibition is detected earlier (by 0.5 h) and is sustained throughout the experiment.

Figure 3C-F shows the results of representative experiments with these compounds using Raji cells, together with the hydroxyindoline 3 and the bifunctional aminoindoline 8. Broadly similar results were seen, particularly at the c-myc MAR site with 6 and 7, but the degree of inhibition at the ORI site was reduced. This was most obvious at the 10 µM concentration, with only 55-60% inhibition with 6 and even less (80%). Whereas treatment with 10 µM CPT resulted in 50% inhibition in all three cell lines, 1 µM CPT, a concentration that induces DNA fragmentation in all three cell lines at this time point (not shown), only showed a 30% inhibition in PCR in Raji cells(Figure 6B). Thus, induction of DNA fragmentation at this time point in this panel of cells does not correlate with inhibition of PCR at the chosen MAR sites. In addition, the indoline compounds at low concentrations showed evidence of recovery of PCR inhibition by 4 h. If these sites were targets for apoptosis-induced DNA breaks, recovery of amplification (suggesting DNA integrity at the site) would not be expected. Whether or not the alkylation of DNA at the site is the first step in the apoptosis-driven DNA breaks is not possible to elucidate without testing in a system where apoptosis itself is inhibited. Exposure of cells to a variety of anticancer agents is known to alter gene expression, and in some cases these changes are suggested to be critical for the anticancer effect (18). Whether these changes are due to direct effects of the drug interaction with regulatory sequences within the gene of interest is much harder to determine. It is difficult to decide if observed changes in gene expression are the reason for induction of cell death, versus some other effect on cellular metabolism. This is particularly true for DNA binding compounds, which might alter gene expression but could also cause substantial DNA damage. Very highly sequence-specific compounds such as the hairpin polyamides have been shown to selectively alter the transcription of genes containing polyamide consensus binding sites that overlap with important transcription factors (18, 27, 28). A variety of compounds have been used to alter c-myc expression, including the cationic porphyrin TMPyP4, which stabilizes the G-tetraplex in the c-myc promoter (29, 30), and a synthetic guanine-rich oligonucleotide that hybridizes to the cytosine-rich strand within the c-myc

hypersensitive site and potentially sequesters transcription factors, such as hnRNP K, when administered in the tetraplex versus single-strand DNA conformation (31). Antisense RNA and RNA interference approaches have also been successfully used to downregulate c-myc expression and lead to induction of apoptosis in cancer cell lines (32-34). In the case of TMPyP4, decreases in c-Myc and telomerase activity are likely responsible for the in vivo antitumor effects observed (29). In this study we found that c-myc expression (RNA and protein) decreases rapidly (within a few hours) following drug exposure. Such decreases in c-myc expression may not be the main reason for the potent cytotoxicity of the aminoindolines, but such loss of expression so soon after treatment likely contributes to loss of cell viability. In comparison, in many of the studies cited above with other inhibitors, the levels of c-myc expression (RNA and protein) are not examined until 12 h or even longer (48 h) following exposure. In addition to disruption in the expression of genes such as c-myc that contain AT island DNA, other processes that occur at these sites are also likely to be disrupted following DNA alkylation by these drugs. A number of AT islands have been experimentally shown to serve as DNA interaction sites with the nuclear matrix. MARs are critical DNA elements that ensure accurate replication, cell-type-specific transcription, mitosis, and other processes (17, 35-37). By alkylating MAR sites, the normal protein/DNA interactions are likely to be perturbed due to the direct DNA adduct that is formed as well as the repair intermediates and lesions that occur after DNA damage. In addition, AT islands are sites of genomic instability in cancer cells and therefore could result in increased tumor cell sensitivity. Jackson et al. (17) have suggested that the hypersensitivity to 5 in the CEM leukemic cell line versus the WI-38 normal fibroblast line [GI50 2 and 80 pM, respectively (12, 17)] is because many of the AT islands in the CEM cell line are expanded and some show differential nuclear matrix organization and thus potential MAR function. They

Cellular DNA Alkylation Affects Expression of c-myc

Chem. Res. Toxicol., Vol. 18, No. 2, 2005 247

reflects numerous attributes of the cell including the degree of genomic instability, particularly AT island expansion, capacity for DNA repair, survival dependence on genes containing AT islands whose expression is potentially altered, as well as other qualities that have conferred the cancerous phenotype. Future studies are planned that will expand on the biological impact of these compounds. In designing the next generation of compounds, it is important to understand the basic biological consequences of the parental compounds so that more specific agents can be developed that more readily lead to specific cancer cell death. These studies are a contribution to that end.

Acknowledgment. We thank the Auckland Cancer Society for funding support of the Auckland Cancer Society Research Centre. We also thank Dr. Moana Tercel for helpful discussions and critically reading the manuscript, Pamela Murray for technical assistance, and the article reviewers for the helpful comments and critique. S.M.N. is funded by the Foundation for Research Science and Technology, NZST Fellowship UOAX0247.

References

Figure 7. Expression of c-myc RNA is decreased in aminoindoline-treated cells. Real-time RT PCR of c-myc gene expression normalized to expression of HPRT. Relative expression of c-myc is calibrated to expression in untreated cells [(drug-treated c-myc/drug-treated HPRT)/(untreated c-myc/untreated HPRT)]. PCR reactions were performed in duplicate for each sample; the average is shown. Black shading, early time point; light gray, middle time point; dark gray, late time point. (A) Raji cells at 0.5, 2, and 4 h of continuous treatment. (B) CEM cells at 1, 3, and 4.5 h of continuous treatment.

Figure 8. c-Myc protein expression decreases rapidly following aminoindoline treatment (6). Western blot analysis of CEM and Raji cells following continuous treatment with shown concentrations of 6 is displayed. Primary antibodies used are anti-c-Myc and anti-GAPDH.

suggest not only that the expansion results in more potential drug binding sites in the genome but also that the reorganization of these sites onto the nuclear matrix (if they were not already associated) would more readily impede processes such as replication. The overall sensitivity of a given cell line to these ATbinding hydroxy- and aminoindoline compounds likely

(1) Reynolds, V. L., McGovren, J. P., and Hurley, L. H. (1986) The chemistry, mechanism of action and biological properties of CC1065, a potent antitumor antibiotic, J. Antibiot. (Tokyo) 39, 319334. (2) Boger, D. L., and Yun, W. (1994) CBI-TMI: synthesis and evolution of a key analogue of the duocarmycins. Validation of a direct relationship between solvolytic stability and cytotoxic potency and confirmation of the structural features responsible for distinguishing behavior of the enantiomeric pairs of agents, J. Am. Chem. Soc. 116, 7996-8006. (3) Boger, D. L., and Johnson, D. S. (1996) CC-1065 and the duocarmycins: understanding their biological function through mechanistic studies, Angew. Chem., Int. Ed. Engl. 35, 1438-1474. (4) Cristofanilli, M., Bryan, W. J., Miller, L. L., Chang, A. Y., Gradishar, W. J., Kufe, D. W., and Hortobagyi, G. N. (1998) Phase II study of adozelesin in untreated metastatic breast cancer, Anticancer Drugs 9, 779-782. (5) Pitot, H. C., Reid, J. M., Sloan, J. A., Ames, M. M., Adjei, A. A., Rubin, J., Bagniewski, P. G., Atherton, P., Rayson, D., Goldberg, R. M., and Erlichman, C. (2002) A Phase I study of bizelesin (NSC 615291) in patients with advanced solid tumors, Clin. Cancer Res. 8, 712-717. (6) Suzawa, T., Nagamura, S., Saito, H., Ohta, S., Hanai, N., and Yamasaki, M. (2000) Synthesis of a novel duocarmycin derivative DU-257 and its application to immunoconjugate using poly(ethylene glycol)-dipeptidyl linker capable of tumor specific activation, Bioorg. Med. Chem. 8, 2175-2184. (7) Tietze, L. F., Feuerstein, T., Fecher, A., Haunert, F., Panknin, O., Borchers, U., Schuberth, I., and Alves, F. (2002) Proof of principle in the selective treatment of cancer by antibody-directed enzyme prodrug therapy: the development of a highly potent prodrug, Angew. Chem., Int. Ed. 41, 759-761. (8) Tercel, M., Denny, W. A., and Wilson, W. R. (1996) A novel nitrosubstituted seco-CI: apllication as a reductively activated ADEPT prodrug, Bioorg. Med. Chem. Lett. 6, 2741-2744. (9) Atwell, G. J., Tercel, M., Boyd, M., Wilson, W. R. and Denny, W. A. (1998) Synthesis and cytotoxicity of 5-amino-1-(chloromethyl)3-[(5,6,7-trimethoxyindol-2-yl)carbomyl]-1,2-dihydro-3H-bene[e]indole (amino-seco-CBI-TMI) and related 5-alkylamino analogues: new DNA minor groove alkylating agents, J. Org. Chem. 63, 9414-9420. (10) Yoon, J. H. and Lee, C. S. (1998) Sequence selectivity of DNA alkylation by adozelesin and carzelesin, Arch. Pharm. Res. 21, 385-390. (11) Boger, D. L. B., Hertzog, D. L., Johnson, D. S., Cai, H., Mesini, P., Garbaccio, R. M., Jin, Q., and Kitos, P. A. (1997) Reversed and sandwiched analogues of duocarmycin SAsestablishment of the origin of the sequence-selective alkylation of DNA and new insights into the source of catalysis, J. Am. Chem. Soc. 119, 49874998. (12) Woynarowski, J. M. (2002) Targeting critical regions in genomic DNA with AT-specific anticancer drugs, Biochim. Biophys. Acta 1587, 300-308.

248

Chem. Res. Toxicol., Vol. 18, No. 2, 2005

(13) Herzig, M. C., Trevino, A. V., Arnett, B., and Woynarowski, J. M. (1999) Tallimustine lesions in cellular DNA are AT sequencespecific but not region-specific, Biochemistry 38, 14045-14055. (14) Herzig, M. C., Rodriguez, K. A., Trevino, A. V., Dziegielewski, J., Arnett, B., Hurley, L., and Woynarowski, J. M. (2002) The genome factor in region-specific DNA damage: the DNA-reactive drug U-78779 prefers mixed A/T-G/C sequences at the nucleotide level but is region-specific for long pure AT islands at the genomic level, Biochemistry 41, 1545-1555. (15) Woynarowski, J. M., Napier, C., Trevino, A. V., and Arnett, B. (2000) Region-specific DNA damage by AT-specific DNA-reactive drugs is predicted by drug binding specificity, Biochemistry 39, 9917-9927. (16) Woynarowski, J. M., Trevino, A. V., Rodriguez, K. A., Hardies, S. C., and Benham, C. J. (2001) AT-rich islands in genomic DNA as a novel target for AT-specific DNA-reactive antitumor drugs, J. Biol. Chem. 276, 40555-40566. (17) Jackson, J. A., Trevino, A. V., Herzig, M. C., Herman, T. S., and Woynarowski, J. M. (2003) Matrix attachment region (MAR) properties and abnormal expansion of AT island minisatellites in FRA16B fragile sites in leukemic CEM cells, Nucleic Acids Res. 31, 6354-6364. (18) Gniazdowski, M., Denny, W. A., Nelson, S. M., and Czyz, M. (2003) Transcription factors as targets for DNA-interacting drugs, Curr. Med. Chem. 10, 909-924. (19) Chiang, S. Y., Welch, J., Rauscher, F. J., 3rd, and Beerman, T. A. (1994) Effects of minor groove binding drugs on the interaction of TATA box binding protein and TFIIA with DNA, Biochemistry 33, 7033-7040. (20) Black, A. R., Black, J. D., and Azizkhan-Clifford, J. (2001) Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer, J. Cell. Physiol. 188, 143-160. (21) Sun, D., and Hurley, L. H. (1994) Binding of Sp1 to the 21-bp repeat region of SV40 DNA: effect of intrinsic and drug-induced DNA bending between GC boxes, Gene 149, 165-172. (22) Hay, M. P., Atwell, G. J., Wilson, W. R., Pullen, S. M., and Denny, W. A. (2003) Structure-activity relationships for 4-nitrobenzyl carbamates of 5-aminobenz[e]indoline minor groove alkylating agents as prodrugs for GDEPT in conjunction with E. coli nitroreductase, J. Med. Chem. 46, 2456-2466. (23) Gieseg, M. A., Matejovic, J., and Denny, W. A. (1999) Comparison of the patterns of DNA alkylation by phenol and amino seco-CBITMI compounds: use of a PCR method for the facile preparation of single end-labeled double-stranded DNA, Anticancer Drug Des. 14, 77-84. (24) Hamlyn, P. H., and Rabbitts, T. H. (1983) Translocation joins c-myc and immunoglobulin gamma 1 genes in a Burkitt lymphoma revealing a third exon in the c-myc oncogene, Nature 304, 135-139. (25) Nishikura, K., Erikson, J., ar-Rushdi, A., Huebner, K., and Croce, C. M. (1985) The translocated c-myc oncogene of Raji Burkitt

Nelson et al.

(26)

(27)

(28)

(29)

(30)

(31)

(32)

(33)

(34)

(35)

(36)

(37)

lymphoma cells is not expressed in human lymphoblastoid cells, Proc. Natl. Acad. Sci. U.S.A. 82, 2900-2904. Liu, Q. Y., Ribecco-Lutkiewicz, M., Carson, C., Testolin, L., Bergeron, D., Kohwi-Shigematsu, T., Walker, P. R., and Sikorska, M. (2003) Mapping the initial DNA breaks in apoptotic Jurkat cells using ligation-mediated PCR, Cell Death Differ. 10, 278289. Gottesfeld, J. M., Belitsky, J. M., Melander, C., Dervan, P. B., and Luger, K. (2002) Blocking transcription through a nucleosome with synthetic DNA ligands, J. Mol. Biol. 321, 249-263. Ehley, J. A., Melander, C., Herman, D., Baird, E. E., Ferguson, H. A., Goodrich, J. A., Dervan, P. B., and Gottesfeld, J. M. (2002) Promoter scanning for transcription inhibition with DNA-binding polyamides, Mol. Cell. Biol. 22, 1723-1733. Grand, C. L., Han, H., Munoz, R. M., Weitman, S., Von Hoff, D. D., Hurley, L. H., and Bearss, D. J. (2002) The cationic porphyrin TMPyP4 down-regulates c-MYC and human telomerase reverse transcriptase expression and inhibits tumor growth in vivo, Mol. Cancer Ther. 1, 565-573. Siddiqui-Jain, A., Grand, C. L., Bearss, D. J., and Hurley, L. H. (2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription, Proc. Natl. Acad. Sci. U.S.A. 99, 11593-11598. Simonsson, T., and Henriksson, M. (2002) c-myc Suppression in Burkitt’s lymphoma cells, Biochem. Biophys. Res. Commun. 290, 11-15. D’Agnano, I., Valentini, A., Fornari, C., Bucci, B., Starace, G., Felsani, A., and Citro, G. (2001) Myc down-regulation induces apoptosis in M14 melanoma cells by increasing p27(kip1) levels, Oncogene 20, 2814-2825. Hung, L., and Kumar, V. (2004) Specific inhibition of gene expression and transactivation functions of hepatitis B virus X protein and c-myc by small interfering RNAs, FEBS Lett. 560, 210-214. Kaul, D., and Sikand, K. (2004) Defective RNA-mediated c-myc gene silencing pathway in Burkitt’s lymphoma, Biochem. Biophys. Res. Commun. 313, 552-554. Bode, J., Goetze, S., Heng, H., Krawetz, S. A., and Benham, C. (2003) From DNA structure to gene expression: mediators of nuclear compartmentalization and dynamics, Chromosome Res. 11, 435-445. Bode, J., Benham, C., Ernst, E., Knopp, A., Marschalek, R., Strick, R., and Strissel, P. (2000) Fatal connections: when DNA ends meet on the nuclear matrix, J. Cell. Biochem. Suppl. 35, 3-22. Berezney, R., Mortillaro, M. J., Ma, H., Wei, X., and Samarabandu, J. (1995) The nuclear matrix: a structural milieu for genomic function, Int. Rev. Cytol. 162A, 1-65.

TX049852T