Design and Application of Rolling Circle ... - ACS Publications

Subscriber access provided by UNIV OF CAMBRIDGE

Article

Design and Application of Rolling Circle Amplification for a Tumor-Specific Drug Carrier Jong Hwan Kim, Mihue Jang, Young-Je Kim, and Hyung Jun Ahn J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.5b01126 • Publication Date (Web): 11 Sep 2015 Downloaded from http://pubs.acs.org on September 16, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Manuscript for Journal of Medicinal Chemistry as an article

Design and Application of Rolling Circle Amplification for a Tumor-Specific Drug Carrier

Jong Hwan Kim,† Mihue Jang,† Young-Je Kim, and Hyung Jun Ahn*

Center for Theragnosis, Biomedical Research Institute, Korea Institute of Science and Technology, Seongbuk-Gu, Seoul 136-791, South Korea

† Both authors contributed equally to this manuscript * The author to whom correspondence: Hyung Jun Ahn, PhD Korea Institute of Science and Technology 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136791, Korea Tel: +82-2-958-5938; fax: +82-2-958-5909 e-mail: [email protected]

-1-

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT It is challenging to design rolling circle amplification (RCA) for a tumor-selective delivery of drugs. Here, we devise a doxorubicin nanocarrier composed of RCA products, cholesterol-DNA, and folate-DNA conjugates. RCA products, designed to contain tandem repeats of short hairpin DNA, employ the repeated sequences complementary to both DNA conjugates, and thus RCA products/cholesterol-DNA/folate-DNA complexes, generated via sequential base pairing processes, acquire the amphiphilic properties that facilitate self-assembly into the highly condensed nanoparticles (RCA nanoparticles). Doxorubicin-loaded RCA nanoparticles, especially with high cargo capacity, release drugs to the environment by the aid of acidity, and show the selective cytotoxicity on the cancer cells. Particularly, the condensed structures enable RCA nanoparticles to be resistant to nucleases in the blood. These results show that RCA nanoparticles have great potential as a doxorubicin carrier for the targeted cancer therapy and furthermore our strategy provides an alternative tool to exploit RCA technique on drug delivery systems.

-2-


Page 2 of 57

Page 3 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




INTRODUCTION Rolling circle amplification (RCA) is a simple enzyme-mediated reaction where a

circular DNA template can be amplified to multiple tandem repeats of ssDNA or ssRNA using DNA or RNA polymerases.1 Compared to polymerase chain reaction (PCR), which needs the thermostable DNA polymerase as well as the thermal cycler, RCA is a much simpler process in respect that it can amplify DNA template at a constant temperature around room temperature. In addition, when DNA template for RCA is rationally tailordesigned to contain functional sequences such as DNA aptamers,2 spacer regions,3 and DNAzymes,4,5 the simple and versatile RCA technique is able to provide the powerful tools for biomedical applications, including diagnostics, biodetection, bioanalysis, and imaging.6-9 Doxorubicin has been extensively treated to a variety of cancers, including breast cancer, ovarian cancer, Hodgkin’s lymphoma, leukemia, and other solid tumors.10 But, like most other chemotherapeutics, doxorubicin lacks specificity and induces cytotoxicity in both cancer and normal cells, resulting in severe side effects, toxicities, and limited maximum tolerated dose (MTD) in patients.11-14 Particularly, its cumulative dosedependent cardiotoxicity considerably limits drug usefulness. Therefore, it is still of particular importance to selectively deliver doxorubicin to cancer cells, not to normal

-3-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cells, to prevent or minimize the unwanted toxicity and side effects, although drug carriers can be functionalized with “specific” molecules to aid in their delivery to specific organs and tissues including antibodies, peptides, aptamers, sugars, and proteins.15,16 Notably, doxorubicin is easily loaded into DNA duplexes by intercalating between DNA base pairs.11 It was also reported that the acidic environments such as endosomal or lysosomal compartments allowed the intercalated doxorubicin to be dissociated from DNA complexes, facilitating the cytosolic release of doxorubicin after cellular uptake.17 Therefore, the RCA products, which contain multiple repeats of short hairpin DNA (shDNA) structures as a result of RCA reaction, can be considered a promising pharmaceutical agent for tumor suppression, when compared with other nanomedicine pharmaceutical agents, such as gold, silica, polymers, and liposomes.18-21 However, it is still challenging to rationally design the RCA products to function as a targeted drug carrier, which requires the precisely controlled targeting ligands on their surface. Also, too large size of RCA products limits their usefulness in the therapeutic applications, because RCA products themselves formed the loosely packed micro-sized particles that cannot penetrate the cell membrane, as reported previously.22 Instability of DNA-based agents under a physiological environment including a variety of nuclease attacks is another hurdle to be addressed.23

-4-


Page 4 of 57

Page 5 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Recent progress in DNA nanotechnology has enabled the DNA-based nanomaterials to lead to a variety of targeted drug delivery systems, but these approaches have unique limitations that may hinder the clinical applications; laborious bulky preparation of a myriad of DNA as building blocks, highly complicated design, difficulties of large-scale production, limited drug loading capacity and production at high cost.24-27 To achieve the selective delivery of doxorubicin drugs to cancer cells while circumventing these limitations, we here designed a drug delivery carrier composed of RCA products and two types of DNA fragments that were functionalized with the hydrophobic cholesterols or folate ligands. Owing to the large particle size of RCA products as mentioned above, we employed an alternative condensing strategy in such a way that RCA products were complementarily annealed with short length of cholesterol-DNA (CH-DNA) conjugates. Consequently, the amphiphilic RCA products/CH-DNA complexes could form the condensed nanoparticles via self-assembly process in the aqueous solution. Furthermore, sequential base-pairing of RCA products/CH-DNA complexes with folate-DNA (FODNA) conjugates lead to RCA/CH-DNA/FO-DNA complexes, which also formed the highly packed nanoparticles (i.e. RCA nanoparticles) with the exposed folate ligands on their surface.

-5-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

In the current studies, our RCA nanoparticles had the intercalation properties for doxorubicin in the neutral pH condition, but could release the bound doxorubicin in the low pH condition, facilitating the release of drugs into the cytosol after cellular uptake. Notably, our condensation strategy provided a tool to readily boost the loading amount of doxorubicin, compared to the loosely packed DNA particles such as DNA origami structures.28 In the respect of stability in the bloodstream, RCA nanoparticles were significantly stable from nuclease attacks due to their highly condensed structures. Using the high level of folate receptor expression on the cancer cells and the features of folate, doxorubicin-loaded RCA nanoparticles elicited the selective cytotoxicity on the cancer cells, while minimizing their side effects on the normal cells. We carried out the preliminary proinflammatory cytokine studies using INF-α or TNF-α biomarkers of immunotoxicity. Here, we demonstrate that RCA nanoparticles can provide an efficient therapeutic agent to load doxorubicin drugs and selectively deliver them to cancer cells while lowering the unwanted cellular uptake to normal cells. Also, the current studies show that the condensation process by integrating DNA polymer with cholesterol-DNA conjugates endows RCA products with the amphiphilic properties that can facilitate self-assembly into highly condensed DNA nanoparticles, and therefore, the RCA technique can be

-6-


Page 6 of 57

Page 7 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


readily extended to therapeutic applications such as targeted drug delivery for cancer therapy.

-7-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



MATERIALS AND METHODS Synthesis of RCA Products via Rolling Circle Amplification. First, we added T7

promoter primers to ssDNA template solution (10 μM) at a molar ratio of 1:1, denatured the DNA mixture by using a heat block (95 °C, 10 min), and cooled it down to 22 °C. To the mixture, we added T4 DNA ligase (Promega, USA) and ligation buffer (30 mM TrisHCl (7.8), 5 mM ATP, 10 mM DTT, and 10 mM MgCl2), and subsequently incubated the resulting mixture at 16 °C for 4 h to convert the nicked circular ssDNA templates into the closed DNA templates. Next, we added Phi29 DNA polymerase (10 U/μL) to the closed DNA templates solution (0.3 μM) in the RCA buffer (50 mM Tris-HCl (7.5), 10 mM MgCl2, 4 mM DTT, 10 mM (NH4)2SO4, and 0.2 mM dNTP). The resulting mixture was subjected to incubation at 30 °C for 120 h, resulting in multiple tandem repeats of DNA templates. The RCA reaction was quenched by heating at 90 °C for 10 m. As a purification step, we purified the RCA products using Amicon ultra-centrifugal filter (3K molecular weight cut-off, Millipore) while repeatedly washing with distilled water. The concentration of RCA products was measured by a UV/Vis spectrophotometer (Biophotometer, Eppendorf, UK). To catalyze the conversion of pyrophosphates into phosphates during RCA reaction, pyrophosphate enzyme (2 U/μL) was added to the RCA reaction mixture.

-8-


Page 8 of 57

Page 9 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conjugation of Folate to DNA Fragment. After dissolving 5’-amine-modified DNA fragment (0.1 mM) in 100 mM MES buffer (6.0) containing 500 mM NaCl, we mixed it with Sulfo-NHS (10 mM) and EDC (4 mM) solution. Subsequently, the resulting mixture was reacted with 5 mM folates, leading to folate-DNA (FO-DNA) conjugates in a way that γ-glutamic acid of folate was connected to 5’-amine of DNA fragment. Using Amicon ultra-centrifugal filter (3K molecular weight cut-off), we removed the reagents while repeatedly washing with distilled water and then recovered FO-DNA conjugates. To determine a ratio of folate to DNA fragment on FO-DNA conjugates, we measured extinction coefficients of folate and DNA fragment at 260 nm and 363 nm wavelengths using the UV/Vis spectrophotometer; the standard curves were plotted at both wavelengths following the previous studies.29 The conjugation ratio of folate to DNA fragment was determined as 0.82 ± 0.6 (Figure S1). Preparation of RCA/CH-DNA/FO-DNA Complexes. We added CH-DNA conjugates (1.25 μg) to RCA products (5 μg), which were dissolved in PBS buffer containing 20 mM MgCl2, at a weight ratio of RCA products/CH-DNA (1:0.25). We heated the mixture to 95 °C for 10 min to denature RCA products, and then slowly cooled it to room temperature, generating RCA/CH-DNA complexes. To display folate ligands, we sequentially added FO-DNA conjugates (1 μg) with the RCA/CH-DNA complexes

-9-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(6.25 μg) at a weight ratio of RCA/CH-DNA/FO-DNA (1:0.25:0.2) in PBS buffer containing 20 mM MgCl2, generating RCA/CH-DNA/FO-DNA complexes. We removed the reagents using Amicon ultra-centrifugal filter as mentioned above, while repeatedly washing with PBS buffer, and finally recovered RCA/CH-DNA/FO-DNA complexes. Dynamic Light Scattering, TEM and Static Light Scattering. After samples were filtered by syringe filter (0.22 μm MWCO), the hydrodynamic size was measured by a Zetasizer Nano ZS (Malvern, UK). The autocorrelator collected the scattered light at an angle of 173°. An average of multiple independent measurements (more than five) was reported here. Measurement of zeta potential was carried out by the Zetasizer Nano ZS as well. The morphology and size of particles were measured by a CM30 electron microscope (Philips, CA), of which was carried out at 200 kV of acceleration voltage. A drop of sample (50 μg/mL), placed on a carbon-coated copper grid, was slowly air-dried at 22 °C. We could obtain the TEM images without the aid of staining. Using the Zetasizer Nano ZS, we measured the molecular weight of RCA products, while a Debye plot was calculated by Zetasizer Nano software. While serially diluting with distilled water, we measured the intensities of scattered light at a single angle. In the current studies, RCA products had 2.77E8 ± 8.2E6 Da of molecular weight, while correlation coefficient (R2) and 2nd virial coefficient (A2) was 0.995 and 1.03E-5 ± 2.99E-7, respectively. Based on the

- 10 -


Page 10 of 57

Page 11 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


weight ratio, the molecular weight of RCA/CH-DNA/FO-DNA complexes (1:0.25:0.2, w/w/w) could be estimated as 4.02E11 ± 1.19E7 Da. Doxorubicin Intercalation. To estimate the drug loading content (DLC), we individually added various amounts of RCA NPs to doxorubicin (1 μg/mL) and then kept at room temperature for 12 h, following the previous studies.30,31 In the range of 500 nm to 750 nm, the emission of each samples was measured using excitation at 480 nm (F7000 fluorescence spectrophotometer, Hitachi). When doxorubicin was intercalated to RCA NPs, its fluorescence intensity decreased due to the quenching effect. As the amounts of RCA NPs increased, the fluorescence intensities of doxorubicin spectra sequentially decreased. Eventually, we could not detect the decrease of spectra over the weight ratio of 1.2:1 (RCA NPs to doxorubicin), and therefore a weight ratio between RCA NPs and doxorubicin of 1:1 was chosen for the effective drug loading in the current studies. DLC was calculated as follows; drug loading content (wt %) = (weight of loaded Dox) / (weight of Dox loaded RCA NPs) × 100 = 50.0%. After complexing doxorubicin with RCA NPs, we removed the residual uncomplexed doxorubicin using Amicon ultracentrifugal filter as mentioned above, while repeatedly washing with PBS buffer, and could recover Dox/RCA NPs complexes. To prepare the neutral doxorubicin, we deprotonated the commercial doxorubicin that

- 11 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

was marketed as hydrochloride salt by incubating doxorubicin solution in DMSO overnight with 1 : 2 molar ratio of triethylene amine (TEA), which resulted in deprotonation of the sugar amino group. Doxorubicin Release under Acidic Conditions. First, we prepared the standard curve of free doxorubicin for its quantitative analysis, in a way that various amounts of free doxorubicin were plotted versus its fluorescence intensities. On excitation at 480 nm, the free doxorubicin content was measured by emission at 600 nm (F-7000 fluorescence spectrophotometer). The released doxorubicin in the acidic media had the different emission spectra, compared to those of the intercalated doxorubicin, and thus we could examine the dissociation of doxorubicin from Dox/RCA NPs complexes in the indicated pH conditions by measuring the increased fluorescence intensities. 30 μL of Dox/RCA NPs complexes were mixed with 970 μL of sample buffer corresponding to each pH, and then the fluorescence intensities were measured at the indicated time points: 50 mM Na acetate buffer for pH = 5.0, 50 mM Na phosphate buffer for pH = 6.5, and PBS buffer for pH = 7.4. Proinflammatory Cytokines Studies. Human PBMC cells were isolated from whole blood following a standard Ficoll-Paque density-gradient centrifugation,32 and then we seeded the isolated PBMC cells into 96-well plates in RPMI 1640 media containing 10%

- 12 -


Page 12 of 57

Page 13 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FBS and 2 mM glutamine, at 2 ⅹ 104 cells/well. After the cells were completely attached, we stimulated the cells as follows; PBS buffer, RCA NPs (10 μg/mL), anionic pegylated liposomes

(10 μg/mL), CpG oligodeoxynucleotides

(10 μM) or

lipopolysaccharides (50 ng/mL). At 24 h post-treatment, we collected the supernatants, and then measured the released INF-α or TNF-α using sandwich ELISA kit (Abcam, USA) and VeriKine™ human INF-α ELISA kit (PBL Biomedical, USA), according to manufacturer’s instruction. Stability Test of RCA NPs under FBS Condition In Vitro. We mixed 100 μL of RCA NPs (300 μg/mL) or RCA products (300 μg/mL) with fetal bovine serum solution (20% at the final concentration) and the mixtures were subjected to incubation for the indicated time (2 h – 48 h). We electrophoresed each sample by 30 μL on the agarose gels (1%) using TBE buffer, and stained the gels with SYBR gold. For the quantitative analysis of each band intensity, we used a Gel Doc image analysis system (Bio-Rad, USA). Investigation of Cellular Binding of RCA NPs by FACS. We assessed the folate receptor-selective cellular binding of RCA NPs by using FACS (EasyCyte System, Guava Technologies, USA) equipped with a red laser (640 nm). Using the fluorescence dye Cy5labeled FO-DNA (FO-DNA-Cy5) conjugates obtained from Bioneer Co. (Korea), we first prepared RCA/CH-DNA/FO-DNA-Cy5 complexes. Next, we treated the Cy5-labeled

- 13 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

RCA NPs (10 μg/mL) to the FR-positive SKOV3 cancer cells and then incubated the cells at 37 °C for 2 h. After washing the cells twice using PBS buffer, we detached them from well plates by trypsine-EDTA treatment. We washed the collected cells (1 ⅹ 105 cells) with DPBS containing CaCl2 and MgCl2, and carried out FACS analysis. In a similar way, the cellular binding of Cy5-labeled RCA NPs was investigated in the FR-negative A549 carcinoma cells and the FR-negative HepG2 carcinoma cells, respectively. For the competition studies of folate receptors, we treated an excess of folate to the SKOV3 cells until reaching a final concentration of 2 mM for 30 min, and sequentially treated RCA NPs. Cellular Uptake of Cy5-labeled RCA NPs and Dox/RCA NPs. First, FR-positive SKOV3 cells were seeded on a 35 mm petri dish, at 1 ⅹ 105 cells/well, and then grown up to about 70% confluency. Next, the cells were subjected to incubation in DMEM media for 30 min, and then treated with the Cy5-labeled RCA NPs (10 μg/mL). After 2 h, the cells were washed three times with DPBS, and subsequently fixed using 4% paraformaldehyde-containing solution. The cellular uptake of Cy5-labeled RCA NPs were measured by a fluorescence microscope (DeltaVision microscope, Olympus IX71, Japan), which was equipped with an IX-HLSH100 Olympus camera. In a similar way, we could measure the cellular uptakes of RCA NPs in A549 cells or those of doxorubicin-

- 14 -


Page 14 of 57

Page 15 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


loaded RCA NPs in SKOV3 cells. To measure the amounts of intracellular Cy5-RCA NPs, we quantified the relative Cy5 fluorescence intensities using Image J software (NIH). For the cellular uptake studies of doxorubicin-loaded RCA NPs, we treated Dox/RCA NPs (10 μg/mL) or free doxorubicin (5 μg/mL) to the SKOV3 cells at 37 °C at the indicated time period (30 m, 1 h or 2 h), and then washed the cells twice with DPBS. We followed the same procedure to measure the fluorescence microscopic images and quantify the fluorescence intensities of intracellular doxorubicin, as mentioned above. Cell Viability Studies. Cytotoxicities of free doxorubicin, RCA NPs alone and Dox/RCA NPs complexes were studied in FR-positive SKOV3 ovarian cancer cells, FRnegative A549 lung adenocarcinoma cells, and nonmalignant human foreskin fibroblast (HFF) normal cells, respectively. First, SKOV3 cells were seeded on a 96-well plate at 3 × 104 cells/well, and then grown for 1 day in RPMI 1640 containing 10% FBS. After the attached cells were incubated in DMEM media for 30 min, 200 μL of Dox/RCA NPs complexes were added to each well in a dose-dependent way. At 2 h post-treatment, the cells were washed twice with 10% FBS-containing media, and then the plates remained incubated for 1 day. Next, 200 μL of MTT solutions were respectively added to each well, and the cells remained incubated for 4 h in the dark. After collecting the solution, we added DMSO (200 μL) and Sorensen's glycine buffer (25 μL). We measured the

- 15 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

absorbance of samples at 570 nm using a microplate reader (SpectraMax 340, Molecular Devices, UK).

- 16 -


Page 16 of 57

Page 17 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




RESULTS AND DISCUSSION Synthesis of RCA/CH-DNA/FO-DNA Nanoparticles. First, we designed a linear

ssDNA template as a requisite for rolling circle amplification (Table 1 and Figure 1A). Since parts of sequences from both ends of ssDNA templates were designed to be complementary to the sequences of T7 promoter primers, T4 DNA ligase treatment could connect the nicked sequences, yielding a closed circular DNA template (Figure 2A). According to the closed DNA template, RCA reactions, which were mediated by Phi29 DNA polymerase, generated multiple tandem copies of DNA templates (Figure 2B and S2). Based on the mfold web server for DNA folding simulation,33 the RCA products were simulated to form multiple tandem repeats of DNA hairpin structures with stem and loop regions (Figure 1B). Next, RCA products, which were highly hydrophilic, were complexed with cholesterol-DNA (CH-DNA) conjugates in the presence of an excess of magnesium ion (50 mM), through the complementary sequences. The resulting RCA/CH-DNA complexes formed the structure that the RCA products were sparsely tethered with hydrophobic cholesterol molecules, and thus acquired the amphiphilic properties feasible for self-assembly in the aqueous solution (Figure 2C and S3). Notably, it is well known that Mg2+ ions play an important role in base-pairing between DNA strands, especially in

- 17 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

DNA-based assembly into highly symmetrical structures.34 Since base-pairing between DNA strands requires precisely optimized magnesium ion concentrations, formation of RCA/CH-DNA complexes, at a fixed weight ratio of 1:0.25, was examined in a wide range of magnesium ion concentrations (Figure 2D and S4). Taken together, these results showed that formation of RCA/CH-DNA complexes (1:0.25, w/w) needed at least 20 mM of Mg2+. When various amounts of FO-DNA conjugates were complementarily annealed with a fixed amount of RCA/CH-DNA complexes (1:0.25, w/w) to display folate ligands, FO-DNA conjugates completely complexed with RCA/CH-DNA complexes at a ratio of RCA/CH-DNA/FO-DNA (1:0.25:0.2, w/w/w) (Figure 2E and S5). These results showed that we could efficiently generate RCA/CH-DNA/FO-DNA complexes at the weight ratio of 1:0.25:0.2, in the presence of 20 mM of Mg2+. Characterization of RCA/CH-DNA/FO-DNA Complexes. The dynamic light scattering studies demonstrated that the hydrodynamic diameters of RCA products ranged from 1.02 μm to 2.02 μm, but condensation of RCA products through base-pairing with CH-DNA conjugates remarkably decreased their particle size down to 205.6 ± 9.44 nm (Figure 3A and B). However, RCA/DNA complexes, which were assembled via complimentarily annealing between RCA products and cholesterol-free DNA fragments, did not show a decrease in their diameter when compared with RCA products. These

- 18 -


Page 18 of 57

Page 19 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


results indicate that complexing of CH-DNA conjugates with RCA products leads to formation of the condensed nanoparticles, due to the tight packing driven by hydrophobic cholesterol molecules.35 Also, RCA/CH-DNA/FO-DNA complexes still formed the condensed nano-sized particles (RCA NPs) with 254.8 ± 9.46 nm in diameter. On the other hand, the zeta potential measurement showed that the particle surface charge of RCA products, RCA/CH-DNA and RCA/CH-DNA/FO-DNA complexes were -31.3 ± 0.6 mV, -26.1 ± 1.5 mV and -25.4 ± 1.5 mV respectively (Figure 3C). Based on static light scattering, the molecular weights of RCA products and RCA/CH-DNA/FO-DNA complexes were determined as 2.77 × 108 Da and 4.02 × 108 Da (Figure S6). Furthermore, transmission electron microscopy (TEM) images showed that RCA/CH-DNA/FO-DNA complexes formed the nano-sized particles with spherical shapes (Figure 3D). During RCA reactions, pyrophosphate ions, produced as by-product, generate precipitates of magnesium pyrophosphate in the reaction container.36 Notably, it was reported that these magnesium pyrophosphate nanostructures could package RNA polymers into composite microsponge structures composed of RNA adsorbed to their surfaces.37 To determine whether or not magnesium pyrophosphate is an integral component in the RCA NPs, we added an excess of EDTA to RCA/CH-DNA/FO-DNA complexes, because EDTA binds strongly to Mg2+ and dissolves magnesium

- 19 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

pyrophosphate in a few seconds. When the hydrodynamic diameter of RCA NPs was measured after addition of EDTA, there was no detectable difference between EDTAtreated RCA NPs and EDTA-untreated RCA NPs (Figure 3E and Figure S7). Also, addition of EDTA to RCA/CH-DNA complexes and RCA products respectively did not lead to significant variation in the hydrodynamic diameters, and we did not observe disassembling of particles when compared to the corresponding particles in the absence of EDTA. Particularly, when we added pyrophosphatase, which converts one pyrophosphate to two phosphate ions, to the RCA reaction and purified the mixture, the RCA products still formed the large-sized particles with 1.5 μm to 2.1 μm in diameter, on the dynamic light scattering analysis. These results indicate that the formation of magnesium pyrophosphate does not affect the assembled structures of RCA products. Although pyrophosphate ions are hydrolyzed into phosphate ions by a simple heating process,38 we could not observe any variation in the hydrodynamic diameters after heating the RCA particles (data not shown). Thus, these results show that a driving force for the self-assembled nanostructures of RCA NPs is the hydrophobic interactions in the aqueous solution, and magnesium pyrophosphate nanostructures, if any, is not an integral component in the RCA NPs. Intercalation of Doxorubicin into RCA Nanoparticles. It is well known that

- 20 -


Page 20 of 57

Page 21 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


doxorubicin can be readily intercalated into the stem regions of DNA hairpins, particularly GC sequences.39,40 Thus, we could easily load doxorubicin drugs into RCA NPs, because each of shDNAs within the RCA NPs contain the stem regions suitable for intercalation sites. To measure the drug payload capacity, we tried to intercalate a fixed amount of doxorubicin into various amounts of RCA NPs, at a weight ratio from 0.1 to 1.2 (RCA nanoparticles per doxorubicin) for 12 h (Figure 4A). When doxorubicin was bound to RCA NPs, its fluorescence was quenched due to the intercalation within DNA duplexes. As the amounts of RCA NPs increased at 500 – 750 nm, the fluorescence intensities of doxorubicin spectra sequentially decreased, but over the weight ratio of 1.2:1 (RCA NPs to doxorubicin), there was no detectable decrease of the spectra. Thus, a weight ratio between RCA NPs and doxorubicin of 1:1 was chosen in the current studies, and the drug loading content was calculated 50.0%. It is worth noting that such high loading capacity can substantially reduce the overall cost of DNA-based therapeutic agents. Dox/RCA NPs complexes, obtained at a weight ratio of 1:1, showed 198.2 ± 1.43 nm in hydrodynamic diameter on DLS measurement and -5.1 ± 2.6 mV in zeta potential on SLS measurement. The positively charged doxorubicin molecules were expected to shrink the negatively charged RCA NPs during their intercalation process, resulting in a

- 21 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

decrease in particle size as well as in negative surface charge. When considering the shrinkage of doxorubicin-loaded RCA NPs, it is worth noting that the attraction through the hydrophobic interactions within the interior of RCA NPs is compromised by the charge-charge repulsion between DNA strands, and thus the reduction of charge-charge repulsion, caused by intercalation of the positively charged doxorubicin into the strongly negatively charged RCA NPs, may be favorable to the condensation in DNA particles. Moreover, the anthraquinone part of doxorubicin is highly hydrophobic, and thus the intercalated doxorubicin molecules may considerably contribute to the strength of hydrophobic interaction within the interior of RCA NPs, resulting in the more condensed structures. When the deprotonated doxorubicin molecules were intercalated into the RCA NPs, the hydrodynamic diameter and zeta potential was determined 234.6 ± 8.02 nm and -26.9 ± 3.4 mV, respectively. These less shrunk and less negatively charged particles, when compared with the protonated Dox/RCA NPs complexes, indirectly suggest that the shrinkage of protonated Dox/RCA NPs complexes is, possibly, due to the reduction of charge-charge repulsion between DNA strands following the charge neutralization between cationic drugs and anionic DNA strands. pH Effect on Dox/RCA NPs Complexes. Many drug delivery systems use the acidic environment in endosome or lysosome to achieve the sustained release of cargo drugs

- 22 -


Page 22 of 57

Page 23 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


into cytosolic space.41 Therefore, dissociation properties of Dox/RCA NPs complexes into free doxorubicin were investigated in the neutral and acidic conditions, respectively. The dissociation of doxorubicin from Dox/RCA NPs complexes was not seen in the neutral condition over the extended time period, but both in the weak and strong acidic condition such as pH 6.5 and pH 5.0, the sustained release of doxorubicin from Dox/RCA NPs complexes occurred until 72 h, and consequently about 80% of doxorubicin were released into the environment (Figure 4B). Particularly, the negligible doxorubicin diffusion in the neutral pH indicates the high stability of Dox/RCA-NPs complexes as a drug carrier. In addition, the hydrodynamic diameter of Dox/RCA NPs complexes was hardly varied over the extended time period in the neutral pH (Figure 4C), and these results suggest the stable physicochemical properties of RCA NPs. Noticeably, Dox/RCA complexes at the acidic conditions showed the relatively much broad size distributions indicating the partially or completely disassembled structures of Dox/RCA NPs complexes (Figure S8). The base pairings between CH-DNA fragments and RCA NPs or between two strands in the stem regions of multiple DNA hairpins may be weakened in the acidic conditions when compared with those in the neutral condition, and thus the weakened base pairings are expected to explain the collapsed structures of Dox/RCA NPs, which in turn result in the acidity-dependent release of doxorubicin,

- 23 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

because doxorubicin molecules are preferentially intercalated into dsDNA, not into ssDNA. These results indicate that the increased acidity found within endosomal or lysosomal compartments may dissociate the intercalated doxorubicin in Dox/RCA NPs complexes into environment and thus facilitate the sustained release of doxorubicin into cytosol (Figure S9). Also, a variety of nucleases found within the lysosomes in the endocytic pathway can break down the nucleotides molecules such as Dox/RCA NPs complexes after endocytosis,42 and consequently, may be involved in increasing the release of doxorubicin. Immunotoxicity Studies of RCA Nanoparticles. When nanomaterials are engineered to deliver drug cargo for therapeutic applications, such as metal-, polymer-, lipid-, and graphite-based nanoparticles,43-46 the interactions of nanoparticles with components of the immune system elicit safety concerns. Because the potential immunotoxicity effects of nanoparticles may affect their therapeutic efficacy, we need to ensure that interactions with the immune system will not induce adverse immunomodulatory effects and complications. To predict the possibility of inflammation-mediated toxicity, we examined whether or not RCA NPs were capable of inducing proinflammatory cytokines, including INF-α and TNF-α. A positive inducer for INF-α, CpG oligodeoxynucleotides, activated INF-α release in the human peripheral blood mononuclear cells at 24 h post-treatment,

- 24 -


Page 24 of 57

Page 25 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


but RCA NPs did not induce any detectable elevation of INF-α level, as shown in anionic pegylated liposomes (Figure 4D). In addition, RCA NPs did not activate TNF-α release above basal level at 24 h post-treatment, while lipopolysaccharides resulted in release of large amounts of TNF-α cytokines. The fact that RCA NPs at least induce neither INF-α nor TNF-α release implies their potential safety concerning the inflammation-mediated toxicity. Serum Stability Test of RCA Nanoparticles against Nuclease Attacks. We next examined whether RCA NPs could deliver drugs under a physiological environment, where DNA-based drug carriers are prone to degradation by a variety of nuclease attacks before reaching target sites. After 2 h incubation under 20% FBS solution, most RCA products were completely degraded, and we only observed small DNA fragments less than 100 bp of molecular weights, as the degradation products (Figure 4E). In contrast, RCA NPs showed more resistance to nuclease attacks during a prolonged incubation time and consequently, about 63% of RCA NPs still remained even after 48 h incubation. These results indicate that the relatively more condensed RCA NPs, when compared to the loosely packed RCA products, would be stable from a variety of nuclease attacks in the bloodstream and could deliver drugs to the sites of interest in vivo. Cellular Binding of RCA NPs by Target SKOV3 Cancer Cells. Folate is a naturally

- 25 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

existing biomaterial with no immunogenicity and folate receptor (FR) is aberrantly overexpressed in most cancer cells of endothelial origin, especially ovarian cancer, while it is expressed much less in normal cells.47 Thus, a number of FR-targeted therapeutic agents including many imaging agents have shown promising results in preclinical evaluations.48-50 To assess the selective cellular binding of RCA NPs via folate-folate receptor interactions, we treated the fluorescence dye Cy5-labeled RCA NPs to FRpositive SKOV3 ovarian cancer cells, FR-negative A549 lung adenocarcinoma, or FRnegative HepG2 liver cancer cells. The flow cytometry analysis demonstrated that the fraction of Cy5-positive SKOV3 cells was approximately 88.8%, whereas the fraction of Cy5-positive A549 cells and Cy5-positive HepG2 cells was only 12.0% and 5.84%, respectively due to the lack of folate receptors (Figure 5). When the folate receptors were occupied by an excess of free folate ligands prior to RCA NPs treatment, the cellular binding significantly decreased down to 55.9%. On the other hand, RCA NPs still showed the extremely low level of cellular binding in both the A549 cells and HepG2 cells pretreated with an excess of free folates, and free folate pretreatment hardly ever affected cellular binding of RCA NPs either in the A549 cells or in the HepG2 cells. Taken together, these results indicate that RCA NPs can selectively bind to folate receptors present in the surface of SKOV3 cancer cells.

- 26 -


Page 26 of 57

Page 27 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cellular Uptake of RCA NPs by Target SKOV3 Cancer Cells. When we transfected the fluorescence dye Cy5-labeled RCA NPs to FR-positive SKOV3 cells or FR-negative A549, the fluorescence microscopic images showed that RCA NPs were distributed in the cytoplasm of SKOV3 cells without a co-localization of nucleus at 2 h post-treatment (Figure 6A). However, there was no RCA NPs observed in the A549 cells due to the lack of folate receptor. On the other hand, when folate receptors were saturated with free folate ligands prior to Cy5-RCA NPs treatment, the fluorescence signal from Cy5-RCA NPs was significantly weak in the SKOV3 cells. These results indicate that the exposed folate ligands on the surface of RCA NPs lead to the selective internalization into SKOV3 cells via folate-folate receptor interactions. On the fluorescence microscopic images to examine the cellular uptake of doxorubicin-loaded RCA NPs in the SKOV3 cells, we could find the weak fluorescence signals of doxorubicin only in the cytoplasm at the early time point, such as 30 m posttreatment (Figure 6B and C). As the incubation time increased, the fluorescence signals of doxorubicin were observed in both cytoplasm and nucleus, and eventually most doxorubicin were distributed in the nucleus over 2 h post-treatment. However, we could not observe any fluorescence signal of doxorubicin in the A549 cells at 2 h post-treatment alone, but also at more prolonged incubation time (data not shown). Thus, these results

- 27 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

indicate that doxorubicin-loaded RCA NPs successfully deliver the drug molecules into cancer cells in a folate receptor-specific manner. When SKOV3 cells were treated with free doxorubicin, most drugs were diffused into nucleus within a short period such as 30 m, whereas the Dox/RCA NPs-treated SKOV3 cells showed gradually enhanced fluorescence signals of doxorubicin in the nucleus. Because RCA NPs do not enter the nucleus as shown in the Figure 6A, the sustained accumulation of doxorubicin in the nucleus compartment implies the release of bound doxorubicin from the Dox/RCA NPs after cellular uptake. Selective Anti-cancer Effects of Dox/RCA NPs Complexes. To assess the anticancer effects of doxorubicin-loaded RCA NPs, we carried out cytotoxicity studies in the FR-(+) SKOV3 cells and FR-(-) A549 cells by using MTT assay (Figure 7). IC50 of doxorubicin delivered by RCA NPs was determined as 4.2 μg/mL in the SKOV3 cells, which was cytotoxic on a similar level to that of free doxorubicin alone (IC50 = 2.9 μg/mL). However, there was no significant cytotoxicity observed in the Dox/RCA NPs-treated A549 cells and thus we could not estimate their IC50 value, while IC50 of free doxorubicin alone was measured as 3.0 μg/mL in the A549 cells. In addition, we could not see any detectable cytotoxicity in the Dox/RCA NPs-treated HFF normal cells, although IC50 of free doxorubicin was 6.0 μg/mL in the HFF cells. Doxorubicin alone was non-selectively

- 28 -


Page 28 of 57

Page 29 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


internalized to SKOV3, A549 cells and HFF normal cells, respectively, and thus there always exists the possibility that the unwanted toxicity of free doxorubicin to normal cells may occur. In contrast, Dox/RCA NPs complexes selectively deliver doxorubicin drugs only to SKOV3 cells through folate-folate receptor interactions, lowering the possibility of unwanted side effects. Therefore, Dox/RCA NPs complexes have the great potential for tumor-targeted therapy in a folate receptor-dependent way.



CONCLUSIONS We synthesized the doxorubicin delivery carrier composed of RCA products,

cholesterol-DNA, and folate-DNA conjugates. Because the hydrophobic cholesterol molecules tend to avoid water and hydrophilic environment and thus become tightly packed in the limited space, the RCA products, after sparsely tethered with cholesterolDNA conjugates via DNA-DNA base pairing, acquired the amphiphilic properties, and thus self-assembled into the condensed nanocontainers for doxorubicin delivery. Considering the simplicity of enzymatic RCA reaction, low cost of production, ease of large-scale production, high drug payload capacity, and especially ease of doxorubicin loading, our RCA NPs provide an alternative means of exploiting the RCA technique on

- 29 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

doxorubicin delivery systems as well as condensing the RCA products into the highly packed DNA nanoparticles. An efficient displaying of folate ligands via DNA-DNA base pairing could deliver the doxorubicin-loaded RCA NPs to folate receptor-positive cancer cells such as SKOV3 ovarian cancer cells, and thus can reduce the risk of unwanted side effects in the normal cells. Ease of conjugation chemistry allows various “smart” molecules, such as high affinity of peptides, antibodies and sugars, to be readily connected to DNA fragments like folate-DNA conjugates, and thus our alternative approach to displaying targeting ligands on the RCA products can facilitate the versatility for active targeting to a variety of cancers. RCA NPs did not induce any severe cytotoxicity on the cell viability tests, and the preliminary proinflammatory cytokine studies showed any adverse immune function in neither INF-α nor TNF-α activation. The intrinsic degradability of DNA is expected to avoid the potential chronic accumulation of RCA NPs in the body. In addition, the acidity could trigger the dissociation of doxorubicin from Dox/RCA NPs complexes into the environment, and thus after cellular internalization, these functionalities of Dox/RCA NPs complexes facilitated release of doxorubicin into the cytosol. Particularly, the much enhanced stability of RCA NPs against a variety of nucleases in the blood, when

- 30 -


Page 30 of 57

Page 31 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


compared with that of RCA products, satisfies the requirement for drug delivery in vivo. To assess whether RCA NPs are suitable for systemic delivery to tumor sites, we are planning to perform the in vivo studies in the near future. Finally, Dox/RCA NPs showed the selective and efficient intracellular delivery of doxorubicin to the folate receptorpositive cancer cells, while lowering anti-cancer effects on the normal cells. In the folate receptor-negative cells, the remarkable decrease of cytotoxicities induced by Dox/RCA NPs complexes, when compared to free doxorubicin, implies the increase of MTD in the normal cells, and thus may increase MTD of doxorubicin delivered by RCA NPs in the therapeutic applications. Therefore, RCA NPs have great potential as a doxorubicin carrier for the targeted cancer therapy, and suggest that the RCA technique can be efficiently applicable to drug delivery systems.

- 31 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



ASSOCIATED CONTENT

Supporting Information Standard curves for determination of conjugation ratio of folate to DNA fragment, quantitative analysis of band intensities on electrophoresis, Debye plotting for determination of molecular weights of RCA products, and DLS results of particles in the presence of EDTA.

Corresponding Author * E-mail: [email protected]

Notes The authors declare no competing financial interest.



ACKNOWLEDGEMENTS

This study was supported by the KIST Institutional Program (Project No. 2E25270) and by a grant from the National R&D Program for Cancer Control, Ministry of Health and Welfare, Republic of Korea (1520100).

- 32 -


Page 32 of 57

Page 33 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




ABBREVIATIONS USED

CH-DNA, cholesterol-DNA; DLC, drug loading content; DLS, dynamic light scattering; DMSO, dimethyl sulfoxide; DNA, deoxyribonucleic acid; Dox, doxorubicin; dsDNA, double-stranded DNA; DTT, dithiothreitol; EDC, 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide; EDTA, ethylenediaminetetraacetic acid; FACS, Fluorescence-activated cell sorting; FBS, fetal bovine serum; FO-DNA, folate-DNA; FR, folate receptor; INF, interferon; MTD, maximum tolerated dose; MTT, methylthiazol tetrazolium; NHS, Nhydroxysuccinimide; PBMC, peripheral blood mononuclear cell; PBS, phosphate buffered saline; RCA, rolling circle amplification; shDNA, short hairpin DNA; ssDNA, single-stranded DNA; SLS, static light scattering; TEA, triethylene amine; TEM, transmission electron microscopy; TNF, tumor necrosis factor; UV, ultraviolet

- 33 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



REFERENCES

(1) Kuhn, H.; Demidov, V. V.; Frank-Kamenetskii, M. D. Rolling-circle amplification under topological constraints. Nucleic Acids Res. 2002, 30, 574-580. (2) Zhao, W.; Cui, C. H.; Bose, S.; Guo, D.; Shen, C.; Wong, W. P.; Halvorsen, K.; Farokhzad, O. C.; Teo, G. S.; Phillips, J. A.; Dorfman, D. M.; Karnik, R.; Karp, J. M. Bioinspired multivalent DNA network for capture and release of cells. PNAS 2012, 109, 19626-19631. (3) Zhang, Z.; Ali, M. M.; Eckert, M. A.; Kang, D. K.; Chen, Y. Y.; Sender, L. S.; Fruman, D. A.; Zhao, W. A polyvalent aptamer system for targeted drug delivery. Biomaterials 2013, 34, 9728-9735. (4) Ali, M. M.; Li, Y. Colorimetric sensing by using allosteric-DNAzyme-coupled rolling circle amplification and a peptide nucleic acid-organic dye probe. Angew. Chem., Int. Ed. 2009, 48, 3512-3515. (5) Tang, L.; Liu, Y.; Ali, M. M.; Kang, D. K.; Zhao, W.; Li, J. Colorimetric and ultrasensitive bioassay based on a dual-amplification system using aptamer and DNAzyme. Anal. Chem. 2012, 84, 4711-4717. (6) Ali, M. M.; Li, F.; Zhang, Z.; Zhang, K.; Kang, D. K.; Ankrum, J. A.; Le, X. C.; Zhao, W. Rolling circle amplification: a versatile tool for chemical biology, materials

- 34 -


Page 34 of 57

Page 35 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


science and medicine. Chem. Soc. Rev. 2014, 43, 3324-3341. (7) Beyer, S.; Nickels, P.; Simmel, F. C. Periodic DNA nanotemplates synthesized by rolling circle amplification. Nano lett. 2005, 5, 719-722. (8) Su, H.; Yuan, R.; Chai, Y.; Mao, L.; Zhuo, Y. FerrocenemonocarboxylicHRP@Pt nanoparticles labeled RCA for multiple amplification of electroimmunosensing. Biosens. Bioelectron. 2011, 26, 4601-4604. (9) Berr, A.; Schubert, I. Direct labelling of BAC-DNA by rolling-circle amplification. Plant J. 2006, 45, 857-862. (10) Ma, P.; Mumper, R. J. Anthracycline nano-delivery systems to overcome multiple drug resistance: a comprehensive review. Nano Today 2013, 8, 313-331. (11) Minotti, G.; Menna, P.; Salvatorelli, E.; Cairo, G.; Gianni, L. Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacol. Rev. 2004, 56, 185-229. (12) Lindley, C.; McCune, J. S.; Thomason, T. E.; Lauder, D.; Sauls, A.; Adkins, S.; Sawyer, W. T. Perception of chemotherapy side effects cancer versus noncancer patients. Cancer Pract. 1999, 7, 59-65. (13) Martin, M.; Lluch, A.; Segui, M. A.; Ruiz, A.; Ramos, M.; Adrover, E.; Rodriguez-Lescure, A.; Grosse, R.; Calvo, L.; Fernandez-Chacon, C.; Roset, M.;

- 35 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Anton, A.; Isla, D.; del Prado, P. M.; Iglesias, L.; Zaluski, J.; Arcusa, A.; LopezVega, J. M.; Munoz, M.; Mel, J. R. Toxicity and health-related quality of life in breast cancer patients receiving adjuvant docetaxel, doxorubicin, cyclophosphamide (TAC) or 5-fluorouracil, doxorubicin and cyclophosphamide (FAC): impact of adding primary prophylactic granulocyte-colony stimulating factor to the TAC regimen. Ann. Oncol. 2006, 17, 1205-1212. (14) Pennock, G. D.; Dalton, W. S.; Roeske, W. R.; Appleton, C. P.; Mosley, K.; Plezia, P.; Miller, T. P.; Salmon, S. E. Systemic toxic effects associated with highdose verapamil infusion and chemotherapy administration. J. Natl. Cancer Inst. 1991, 83, 105-110. (15) Debbage, P. Targeted drugs and nanomedicine: present and future. Curr. Pharm. Des. 2009, 15, 153-172. (16) Peer, D.; Karp, J. M.; Hong, S.; Farokhzad, O. C.; Margalit, R.; Langer, R. Nanocarriers as an emerging platform for cancer therapy. Nat. Nanotechnol. 2007, 2, 751-760. (17) Choi, K. M.; Kwon, I. C.; Ahn, H. J. Self-assembled amphiphilic DNAcholesterol/DNA-peptide hybrid duplexes with liposome-like structure for doxorubicin delivery. Biomaterials 2013, 34, 4183-4190.

- 36 -


Page 36 of 57

Page 37 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(18) Gao, Y.; Chen, Y.; Ji, X.; He, X.; Yin, Q.; Zhang, Z.; Shi, J.; Li, Y. Controlled intracellular release of doxorubicin in multidrug-resistant cancer cells by tuning the shell-pore sizes of mesoporous silica nanoparticles. ACS Nano 2011, 5, 9788-9798. (19) Chi, L.; Na, M. H.; Jung, H. K.; Vadevoo, S. M.; Kim, C. W.; Padmanaban, G.; Park, T. I.; Park, J. Y.; Hwang, I.; Park, K. U.; Liang, F.; Lu, M.; Park, J.; Kim, I. S.; Lee, B. H. Enhanced delivery of liposomes to lung tumor through targeting interleukin-4 receptor on both tumor cells and tumor endothelial cells. J. Controlled Release 2015, 209, 327-336. (20) Wang, F.; Wang, Y. C.; Dou, S.; Xiong, M. H.; Sun, T. M.; Wang, J. Doxorubicin-tethered responsive gold nanoparticles facilitate intracellular drug delivery for overcoming multidrug resistance in cancer cells. ACS Nano 2011, 5, 3679-3692. (21) Milane, L.; Duan, Z.; Amiji, M. Development of EGFR-targeted polymer blend nanocarriers for combination paclitaxel/lonidamine delivery to treat multi-drug resistance in human breast and ovarian tumor cells. Mol. Pharmaceutics 2011, 8, 185-203. (22) Lee, J. B.; Hong, J.; Bonner, D. K.; Poon, Z.; Hammond, P. T. Self-assembled RNA interference microsponges for efficient siRNA delivery. Nat. Mater. 2012, 11,

- 37 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

316-322. (23) Katayose, S.; Kataoka, K. Water-soluble polyion complex associates of DNA and poly(ethylene glycol)-poly(L-lysine) block copolymer. Bioconjugate Chem. 1997, 8, 702-707. (24) Luo, D.; Saltzman, W. M. Synthetic DNA delivery systems. Nat. Biotechnol. 2000, 18, 33-37. (25) Douglas, S. M.; Bachelet, I.; Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science 2012, 335, 831-834. (26) Schuller, V. J.; Heidegger, S.; Sandholzer, N.; Nickels, P. C.; Suhartha, N. A.; Endres, S.; Bourquin, C.; Liedl, T. Cellular immunostimulation by CpG-sequencecoated DNA origami structures. ACS Nano 2011, 5, 9696-9702. (27) Jiang, Q.; Song, C.; Nangreave, J.; Liu, X.; Lin, L.; Qiu, D.; Wang, Z. G.; Zou, G.; Liang, X.; Yan, H.; Ding, B. DNA origami as a carrier for circumvention of drug resistance. J. Am. Chem. Soc. 2012, 134, 13396-13403. (28) Ouyang, X.; Li, J.; Liu, H.; Zhao, B.; Yan, J.; Ma, Y.; Xiao, S.; Song, S.; Huang, Q.; Chao, J.; Fan, C. Rolling circle amplification-based DNA origami nanostructrures for intracellular delivery of immunostimulatory drugs. Small 2013, 9, 3082-3087.

- 38 -


Page 38 of 57

Page 39 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29) Vlashi, E.; Kelderhouse, L. E.; Sturgis, J. E.; Low, P. S. Effect of folate-targeted nanoparticle size on their rates of penetration into solid tumors. ACS Nano 2013, 7, 8573-8582. (30) Min, K.; Jo, H.; Song, K.; Cho, M.; Chun, Y. S.; Jon, S.; Kim, W. J.; Ban, C. Dual-aptamer-based delivery vehicle of doxorubicin to both PSMA (+) and PSMA (-) prostate cancers. Biomaterials 2011, 32, 2124-2132. (31) Zhu, G.; Zheng, J.; Song, E.; Donovan, M.; Zhang, K.; Liu, C.; Tan, W. Selfassembled, aptamer-tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics. PNAS 2013, 110, 7998-8003. (32) Zuba-Surma, E. K.; Abdel-Latif, A.; Case, J.; Tiwari, S.; Hunt, G.; Kucia, M.; Vincent, R. J.; Ranjan, S.; Ratajczak, M. Z.; Srour, E. F.; Bolli, R.; Dawn, B. Sca-1 expression is associated with decreased cardiomyogenic differentiation potential of skeletal muscle-derived adult primitive cells. J. Mol. Cell. Cardiol. 2006, 41, 650660. (33) Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406-3415. (34) Martin, T. G.; Dietz, H. Magnesium-free self-assembly of multi-layer DNA objects. Nat. Commun. 2012, 3, 1103.

- 39 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(35) Daly, T. A.; Wang, M.; Regen, S. L. The origin of cholesterol's condensing effect. Langmuir 2011, 27, 2159-2161. (36) Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 2001, 289, 150-154. (37) Shopsowitz, K. E.; Roh, Y. H.; Deng, Z. J.; Morton, S. W.; Hammond, P. T. RNAi-microsponges form through self-assembly of the organic and inorganic products of transcription. Small 2014, 10, 1623-1633. (38) Gibson, N. J.; Newton, C. R.; Little, S. A colorimetric assay for phosphate to measure amplicon accumulation in polymerase chain reaction. Anal. Biochem. 1997, 254, 18-22. (39) Agudelo, D.; Bourassa, P.; Berube, G.; Tajmir-Riahi, H. A. Intercalation of antitumor drug doxorubicin and its analogue by DNA duplex: structural features and biological implications. Int. J. Biol. Macromol. 2014, 66, 144-150. (40) Yu, M. K.; Jeong, Y. Y.; Park, J.; Park, S.; Kim, J. W.; Min, J. J.; Kim, K.; Jon, S. Drug-loaded superparamagnetic iron oxide nanoparticles for combined cancer imaging and therapy in vivo. Angew. Chem., Int. Ed. 2008, 47, 5362-5365. (41) Putnam, D.; Gentry, C. A.; Pack, D. W.; Langer, R. Polymer-based gene delivery

- 40 -


Page 40 of 57

Page 41 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with low cytotoxicity by a unique balance of side-chain termini. PNAS 2001, 98, 1200-1205. (42) Falcone, S.; Cocucci, E.; Podini, P.; Kirchhausen, T.; Clementi, E.; Meldolesi, J. Macropinocytosis: regulated coordination of endocytic and exocytic membrane traffic events. J. Cell Sci. 2006, 119, 4758-4769. (43) Elsabahy, M.; Wooley, K. L. Cytokines as biomarkers of nanoparticle immunotoxicity. Chem. Soc. Rev. 2013, 42, 5552-5576. (44) Elsabahy, M.; Wooley, K. L. Design of polymeric nanoparticles for biomedical delivery applications. Chem. Soc. Rev. 2012, 41, 2545-2561. (45) Petros, R. A.; DeSimone, J. M. Strategies in the design of nanoparticles for therapeutic applications. Nat. Rev. Drug Discovery 2010, 9, 615-627. (46) Shi, J.; Xiao, Z.; Kamaly, N.; Farokhzad, O. C. Self-assembled targeted nanoparticles: evolution of technologies and bench to bedside translation. Acc. Chem. Res. 2011, 44, 1123-1134. (47) Leamon, C. P. Folate-targeted drug strategies for the treatment of cancer. Curr. Opin. Invest. Drugs 2008, 9, 1277-1286. (48) Bhattacharya, S.; Franz, A.; Li, X.; Jasti, B. Synthesis of folate-conjugated amphiphiles for tumor-targeted drug delivery. J. Drug targeting 2008, 16, 780-789.

- 41 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(49) Ross, T. L.; Honer, M.; Lam, P. Y.; Mindt, T. L.; Groehn, V.; Schibli, R.; Schubiger, P. A.; Ametamey, S. M. Fluorine-18 click radiosynthesis and preclinical evaluation of a new 18F-labeled folic acid derivative. Bioconjugate Chem. 2008, 19, 2462-2470. (50) Yamada, A.; Taniguchi, Y.; Kawano, K.; Honda, T.; Hattori, Y.; Maitani, Y. Design of folate-linked liposomal doxorubicin to its antitumor effect in mice. Clin. Cancer Res. 2008, 14, 8161-8168.

- 42 -


Page 42 of 57

Page 43 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. (A) A schematic diagram demonstrating self-assembly of RCA products via sequential base-pairing with DNA conjugates. As a result of RCA reaction, RCA products contain multiple copies of shDNA structures, of which single repeat unit is denoted by a square bracket with subscript, R. Complementarily annealed RCA products/cholesterolDNA (CH-DNA) complexes have the amphiphilic properties that facilitate self-assembly into the highly packed nanoparticles. Sequential complementary annealing of folate-DNA (FO-DNA) conjugates with RCA products/cholesterol-DNA complexes also leads to the highly condensed nanoparticles with the displayed folate ligands on their surface. The blue and red color represent the complementary sequences between DNA strands (A,B). - 43 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(B) The predicted DNA hairpin structure of single repeat unit. The sequences from single repeat unit of RCA products were simulated by the mfold web server (available in http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form).

- 44 -


Page 44 of 57

Page 45 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A) DNA ligation of the nicked sequences. When both end sequences of ssDNA templates were complementarily annealed to T7 primer sequences, the nicked sequences of circular DNA templated were connected by T4 DNA ligase, yielding the closed DNA templates feasible for RCA reaction. Difference in the elecrophorectic mobilities on 1% agrose gel shows the formation of the closed DNA templates in the lane 3, compared with the linear ssDNA templates in the lane 2. Nucleic acids stained with SYBR gold were visible under UV irradiation (A-E). (B) Phi29 DNA polymerase amplified the circular DNA templates into multiple copies of DNA polymers for the indicated reaction time period. RCA products were maximally generated at 120 h reaction time. M represents

- 45 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

DNA molecular markers. (C) Electrophorectic mobility shift assay of RCA/CH-DNA complexes at the indicated weight ratio. When a fixed amounts of RCA products were complexed with various amounts of CH-DNA conjugates (1:0, 1:0.05, 1:0.25, 1:0.5, w/w) in an excess of MgCl2, RCA/CH-DNA complexes were stuck in the wells on 1% agarose gels, whereas RCA products alone or uncomplexed CH-DNA conjugates moved down. The results indicate that RCA/CH-DNA complexes self-assemble to form the particles with high molecular weights. (D) Effect of magnesium ions on formation of RCA/CHDNA complexes. At a given weight ratio of 1:0.25, formation of RCA/CH-DNA complexes was examined in the various concentration of MgCl2 by using electrophoresis. RCA products completely complexed with CH-DNA conjugates over 20 mM MgCl2. (E) Electrophorectic mobility shift assay of RCA/CH-DNA/FO-DNA complexes at the indicated weight ratio. For more clarity, the fluorescence dye Cy5-labeled FO-DNA-Cy5 conjugates were complexed with RCA/CH-DNA complexes. The Cy5 fluorescence was detected by a 12 bit CCD camera. FO-DNA conjugates completely complexed with RCA/CH-DNA complexes at a ratio of RCA/CH-DNA/FO-DNA (1:0.25:0.2, w/w/w). M respresents DNA molecular markers.

- 46 -


Page 46 of 57

Page 47 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Characterization of RCA products, RCA/CH-DNA complexes and RCA/CHDNA/FO-DNA complexes. (A,B) Size distribution profiles and averaged hydrodynamic diameters of particles using dynamic light scattering. The averaged hydrodynamic diameter of RCA/DNA complexes, which were composed of RCA and cholesterol-free DNA fragments, was also compared, as a control (B). The results represent the mean ± s.d. (n=5). (C) Zeta potentials of particles using electrophoretic light scattering. The results represent the mean ± s.d. (n=5). (D) TEM images of RCA/CH-DNA/FO-DNA complexes. Inset shows the high-magnification images of particles. (E) Averaged hydrodynamic diameters of RCA product-containing particles in the presence or absence of EDTA.When each particles were incubated with an excess of EDTA for 1 h, there was no detectable difference in the hydrodynamic diameter between EDTA-treated and EDTA-untreated particles. The results represent the mean ± s.d. (n=5). * p > 0.05 by one-

- 47 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

way ANOVA.

- 48 -


Page 48 of 57

Page 49 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A) Fluorescence spectra of doxorubicin complexed with RCA NPs at the indicated weight ratio. A fixed amount of doxorubicin was complexed with an increasing ratio of RCA NPs and after 12 h, the emission spectra of mixtures were measured at 500 - 750 nm with excitation at 480 nm. Sequential decrease in the fluorescence intensities of doxorubicin spectra was recorded while the amounts of RCA NPs increased. A weight ratio between RCA NPs and doxorubicin of 1:1 was chosen as a intercalation ratio in the current studies. (B) pH effect on Dox/RCA NPs complexes. Doxorubicin-loaded RCA NPs were incubated at each of pH conditions for the indicated time period, and then the fluorescence intensities of the dissociated doxorubicin were measured by using a fluorescence spectrophotometer. The results represent the mean ± s.d. (n=5). (C)

- 49 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hydrodynamic diameter of Dox/RCA NPs complexes in the neutral pH over the extended time period. (D) Proinflammatory cytokine induction of RCA NPs in human PBMC cells. INF-α or TNF-α release was measured 24 h after treatment with PBS buffer, RCA NPs (10 μg/mL) or anionic pegylated liposomes (PegLipos) composed of DSPE-PG8G, DPPC, Cholesterol and DPPG (10 μg/mL). As the positive control, 10 μM CpG oligodeoxynucleotides and 50 ng/mL lipopolysaccharides were used for INF-α and TNFα induction, respectively. The results represent the mean ± s.d. (n=3). * p < 0.01 by oneway ANOVA with Tukey’s multiple comparison test, as compared to PBS control. (E) Stability test under fetal bovine serum (FBS) condition. RCA NPs and RCA products incubated in 20% FBS for the indicated time were electrophoresed on agarose gels. The relative band intensities are plotted versus incubation time and represented the mean ± s.d. (n=5).

- 50 -


Page 50 of 57

Page 51 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. FACS analysis of RCA NPs in folate receptor-positive SKOV3 cells, folate receptor-negative A549 cells, and folate receptor-negative HepG2 cells. SKOV3 ovarian cancer cells, A549 lung adenocarcinoma cells, and HepG2 liver cancer cells were treated with PBS or fluorescence dye Cy5-labeled RCA NPs (10 μg/mL) for 2 h, and then folate receptor-selective cellular binding was examined. After folate receptors were blocked by binding an excess of free folate, the cellular binding of RCA NPs was also measured and compared. In the SKOV3 cells, the percentage of cells sorted within the prefixed gate is 88.8% (RCA NPs-treated) and 55.9% (RCA NPs-treated after folate receptors were blocked). In contrast, the RCA NPs-treated A549 cells and RCA NPs-treated HepG2 cells show the significantly low level of cellular binding (12.0% and 5.84%, respectively). - 51 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

These experiments for each cell line were carried out in triplicate and the representative histograms were shown.

- 52 -


Page 52 of 57

Page 53 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. (A) Folate receptor-selective cellular uptake of Cy5-labeled RCA NPs in FRpositive SKOV3 cells and FR-negative A549 cells. Red and blue signals show the fluorescence Cy5-labeled RCA NPs and DAPI dyes, respectively (A,B). The dashed box, as shown in the right, represents the high-magnification images of Cy5-RCA NPs-treated SKOV3 cells. When folate receptors were saturated with free folate, the cellular uptake of Cy5-RCA NPs was significantly decreased in the SKOV3 cells. In the Cy5-RCA NPstreated A549 cells, there was little fluorescence signal corresponding to the internalized Cy5-RCA NPs. The relative Cy5 fluorescence signals emitted from intracellular Cy5-

- 53 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

RCA NPs were plotted by Image J software (right). The results represent the mean ± s.d. (n=5). (B) Fluorescence microscopy images of doxorubicin-loaded RCA NPs or free doxorubicin in SKOV3 cells. Dox/RCA NPs complexes were treated to SKOV3 cells for the various incubation time (30 m, 1 h, and 2 h) to track doxorubicin within the cells. At early time point such as 30 m, a small amount of doxorubicin were found only in the cytosol, and as incubation time increased, a significant amount of doxorubicin were observed in both cytosol and nucleus. At 2 h incubation time, most doxorubicin were seen in the nucleus. In a similar way, free doxorubicin was treated to SKOV3 cells for the various incubation time. When SKOV3 cells were treated with free doxorubicin, drugs were diffused into nucleus within a short period. (C) The inctracellular fluorescence intensities of doxorubicin in the free Dox-treated or Dox/RCA NPs-treated SKOV3 cells were plotted according to incubation time. The results represent the mean ± s.d. (n=5).

- 54 -


Page 54 of 57

Page 55 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Anti-cancer effects of doxorubicin-loaded RCA NPs in FR-positive SKOV3 cells, FR-negative A549 cells, and nonmalignant HFF normal cells. Cytotoxicities of Dox/RCA NPs complexes at the indicated concentration were measured by using MTT assay. As a control, cell viabilities of the cells treated with doxorubicin alone or RCA NPs alone were compared.

- 55 -



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Name

Sequences

ssDNA template

5’-CTGTGCAAACACAAGCTCTAAGCTCTAAGCT CGGAGACGAATACGAATACGAACATCTAAAAG TGGTGGGTGTGACCCTAAATGTTCGTATTCGTA TTCGTCTCCGAGCTTAGAGCTTAGAGCTTGCAT-3’

CH-DNA

5’-cholesterol-CTGTGCAAACACAAGCTCTA-3’

FO-DNA

5’-folate-CTAAAAGTGGTGGGTGTGACCCTAA-3’

T7 primer

5’-TAGAGCTTGTGTTTGCACAGATGCAAGCT-3’

Table 1. Oligonucleotide sequences of ssDNA template, cholesterol-DNA conjugates, folate-DNA conjugates, and T7 primer. The colored seqeunces of CH-DNA or FO-DNA conjugates were rationally designed to be complementary to the same colored sequences of RCA products, which were multiple tandem copies of DNA templates. The underlined sequences of both end of ssDNA template were also rationally designed to be complimentary to the sequences of T7 primers.

- 56 -


Page 56 of 57

Page 57 of 57

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents Graphic

- 57 -


Design and Application of Rolling Circle ... - ACS Publications

Recommend Documents