Article pubs.acs.org/est
Determining the Solar Inactivation Rate of BK Polyomavirus by Molecular Beacon Dane C. Reano* and Marylynn V. Yates Department of Environmental Sciences, University of California, Riverside, California 92521, United States S Supporting Information *
ABSTRACT: The application of molecular beacons (MB) that bind to precise sequences of mRNA provides a near-universal approach in detecting evidence of viral replication. Here, we demonstrate the detection of BK Polyomavirus (BKPyV), an emerging indicator of microbiological water quality, by a quantum dot-based MB. The MB allowed us to rapidly characterize the inactivation rate of BKPyV following exposure to a solar simulator (kobs = 0.578 ± 0.024 h−1, R2 = 0.92). Results were validated through a traditional cell-culture assay with immunofluorescence detection (kobs = 0.568 ± 0.011 h−1, R2 = 0.97), which exhibited a strong correlation to MB data (R2 = 0.93). Obtaining solar inactivation rates for BKPyV demonstrates the first use of a MB in characterizing a microbiological inactivation profile and helps assess the appropriateness of adopting BKPyV as an indicator organism for water quality.
■
INTRODUCTION The time and costs associated with microbiological assays capable of evaluating viability precludes the analysis of water samples for the presence of all pathogens. Instead, water quality assessments are made through the quantification of fecal indicator organisms (FIO). Water contaminated with viable FIO inhabitants of the human digestive tract, like Escherichia coli, indicates probable fecal contamination, and hence, an elevated risk for the presence of human pathogens. Additionally, assays for FIO are routinely completed within 24 h, thereby generating more relevant data useful for the protection of public health.1 Although effective, poor correlations between FIO and pathogens, particularly between bacterial FIO and viral pathogens, can occur.2,3 BK Polyomavirus (BKPyV) persists as a potential alternative to current FIO, but its use remains hindered by many factors, including the lack of a rapid detection assay capable of assessing infectivity.4 Polyomaviruses are double-stranded DNA (dsDNA) viruses that establish a subacute latent infection in childhood lasting throughout the host’s lifetime. Furthermore, BKPyV retains a near ubiquitous seroprevalence in humans (greater than 90%), and is periodically excreted in the feces and urine.5 Most importantly, polyomaviruses are universally present in sewage waters throughout the world and have exhibited correlations to the occurrence of some waterborne pathogens.6,7 Although these qualities may seem enticing benefits toward potential adoption as an FIO, infectious assays for BKPyV require significant time due to the ability of the virus to establish a latent, and characteristically nonproductive, infection. Therefore, further investigations into the use of polyomaviruses as an FIO require a rapid detection scheme capable of assessing viral infectivity. © XXXX American Chemical Society
Molecular beacons (MB) have been employed as an integrated method capable of rapidly detecting viral replication, but have not yet been applied to BKPyV.8 Generally, a MB includes a partially self-complementary oligo capable of forming a stem-loop secondary structure and a fluorophore/quencher pair. The loop portion of the oligo is specific to a target sequence while the 5′ and 3′ ends of the oligo are bound to a reporter fluorophore and quencher, respectively. The absence of the target sequence thermodynamically favors the formation of the closed stem-loop secondary structure, thereby bringing the fluorophore and quencher into close proximity. While closed, light capable of exciting the fluorophore, hvex, is transferred to the quencher via contact Förster/Fluorescent Resonance Energy Transfer (FRET) and released as heat. However, the presence of a target sequence, complementary to the loop region, thermodynamically favors binding of the loop portion to the target. The formation of this loop/target hybrid abrogates the stem-loop structure of the MB; thus, the distance between the fluorophore and quencher increases, FRET is relaxed, and fluorescence occurs.9 By targeting an early stage of viral replication, such as mRNA production, MB are capable of rapidly quantifying infective viral titers.8 To this end, we developed a MB that allowed us to characterize the inactivation rate (kobs) of BKPyV following exposure to a solar simulator. We then validated this inactivation rate against the current standard for BKPyV detection, an immunofluorescence assay (IFA). Received: March 28, 2016 Revised: May 30, 2016 Accepted: June 7, 2016
A
DOI: 10.1021/acs.est.6b01541 Environ. Sci. Technol. XXXX, XXX, XXX−XXX
Article
Environmental Science & Technology
antibody. A total of 150 ng of mouse primary antibody 416 (EMD Millipore, Darmstadt, Germany), specific for the T antigen of the closely related SV40 Polyomavirus, was added to each well and allowed to incubate for 1 h. Unbound antibodies were removed by washing wells with TTBS 1% BSA before incubating each well with 750 ng of fluorescein-conjugated goat antimouse antibody (EMD Millipore) for 1 h at room temperature. After a final washing step, slides were stained and mounted with VECTASHIELD Mounting Media containing DAPI (Vector Laboratories, Burlingame, CA) and imaged on an IX71 inverted microscope (Olympus, Tokyo, Japan). All fluorescent microscopy images were processed in Image-Pro version 6.3 (Media Cybernetics, Incorporated, Rockville, MD). Molecular Beacon Design. To ensure active viral replication, the MB was designed to target mRNA encoding the VP1 capsid protein of BKPyV through sequence reverse complementarity. Capsid protein VP1 remains an early product of BKPyV replication, and, unlike VP2 and VP3, is an integral component of capsid formation.17 Conserved regions of VP1 were identified through aligning 30 BKPyV genomes (ST1, SI) in Clustal Omega (EMBL-EBI, Cambridgeshire, UK), and validated against BKPyV transcript sequences deposited in GenBank. Identifying conserved VP1 transcripts allowed the design of a MB that was synthesized by Gene Link (Hawthorne, NY). Briefly, an oligo of 2′-O-methyl RNA nucleotides was attached to a carboxylic acid functionalized Quantum Dot 525 (Qdot 525) via an amino functionalized 6 carbon spacer (C6) through 1-ethyl-3-(3-(dimethylamino)propyl) carbodiimide (EDC) condensation. Finally, Black Hole Quencher 1 (BHQ-1) was added to the 3′ of the oligo to absorb fluorescence in the absence of VP1 mRNA. Overall, the MB structure was as follows; 5′-(Qdot 525)-(C6)-(CAGAUCUUUUAACUUCUAGAACUUCUGAUCUG)-(BHQ-1)-3′ (nontarget binding stem regions underlined, Figure 1).
An ideal FIO exhibits elevated resistance to water treatment processes and environmental decay relative to the pathogenic microorganisms of interest.10 Ultraviolet waves from sunlight between 280−320 nm (UVB) can drive microbial inactivation by directly damaging genomic and some proteomic targets.11 These same wavelengths can also react with photosensitive compounds contained within (i.e., endogenous to) the microorganism to form reactive intermediates (e.g., ROS) that cause inactivation. Similarly, photosensitive compounds contained within the environment (i.e., exogenous) can also absorb light from UVB and longer wavelengths (UVA, 320− 400 nm and visible, 400−700 nm) to form similar reactive intermediates.12−14 Viruses possessing a dsDNA genome, like BKPyV, may be uniquely recalcitrant to direct genomic damage from sunlight due to subsequent repair from host machinery during intracellular infection.15 In this paper, we demonstrate the first application of a MB to quantify microbiological inactivation by establishing kobs for BKPyV following treatment from a solar simulator.
■
MATERIALS AND METHODS Propagation of BKPyV. Primary human renal proximal tubule epithelial cells (RPTEC, CC-2553, Lonza, Basel, Switzerland), grown in renal epithelial media (REM, SI) with 10% heat inactivated fetal bovine serum (FBS), allowed for the propagation of BKPyV obtained from the American Type Culture Collection (VR-837, Manassas, VA). Media was changed every two to 3 days and washed with 0.22-μm filter sterilized HEPES Buffered Saline (HBS; 25 mM HEPES, 137 mM NaCl, 5 mM KCl, 0.74 mM Na2HPO4, 5.55 mM dextrose, pH 7.3). Subculturing occurred when flasks exceeded 80% confluency and cells were discarded after nine passages. Unless otherwise stated, all incubation steps occurred at 37 °C with 5% CO2 under humidified conditions. Viral stocks were obtained by infecting 80% confluent T-75 flasks of RPTEC with 3 mL of viral inoculum diluted in REM 5% FBS for 1 h. After infection, 10 mL of REM 5% FBS was added to the T-75 flask and allowed to incubate for 4 weeks, or until over 80% of cells exhibited cytopathic effect. Media, changed on a weekly basis, was centrifuged at 960g in a JA-17 rotor (Beckman Coulter, Brea, CA) for 15 min at 4 °C; the resulting pellet was resuspended in about 1 mL of the supernatant and stored at −80 °C. These collected supernatants were pooled, freeze−thawed 3 × at −80 and 37 °C, and layered on 4 mL of reassociation buffer (150 mM NaCl, 20 mM Tris base, 0.1% v/v Tween 20, 1 mM anhydrous CaCl2, and 20% w/v sucrose) and centrifuged for 2 h at 100 000g in a SW 41 rotor (Beckman Coulter) at 4 °C. The resulting pellet was dissolved in 1 mL of buffer A (1 M Tris-Cl, 5 M NaCl, 0.1 M anhydrous CaCl2) through vortex mixing overnight at 4 °C, aliquoted, and stored at −80 °C until use. Immunofluorescence Assay. A protocol by Moriyama and Sorokin served as a general guide for IFA, and a full description can be found in SI.16 Briefly, 80% confluent cells, grown in 8- well chamber slides, were infected with 150 μL of BKPyV diluted in REM 2% FBS and allowed to incubate for 72 h. Cells were washed with 350 μL Tris buffered saline (TBS; 150 mM NaCl, 20 mM Tris base, pH 7.5) and fixed with icecold absolute methanol at −20 °C for 20 min. After fixation, cells were permeabilized with TBS containing 0.1% (v/v) Tween 20 (TTBS) and 1% (w/v) bovine serum albumin fraction V (BSA) for 5 min. Next, cells were blocked with TTBS 3% BSA for 30 min before the addition of the primary
Figure 1. Quantum dot-based molecular beacon. 2′-O-methyl modification of RNA boxed in red. QD, Quantum Dot 525; BHQ-1, Black Hole Quencher 1. B
DOI: 10.1021/acs.est.6b01541 Environ. Sci. Technol. XXXX, XXX, XXX−XXX
Article
Environmental Science & Technology
Here, αλ equates to sample absorbance and Iλ,0 is the irradiance at the surface of the sample for a specific wavelength (measured by spectrophotometer and spectroradiometer, respectively) kobs,thick estimates the sum of irradiance ⟨Iλ⟩z at a specific depth (z) and wavelength;
Molecular Beacon Assay. Chamber slides of 90% confluent cells were infected with BKPyV following the IFA protocol before quantification by MB. After overnight incubation, infected cells were fixed with a 4% PFA solution made in HBS for 10 min, and permeabilized with TTBS for 5 min at room temperature. Next, 150 μL of the MB, diluted to 5 nM in REM 2% FBS warmed to room temperature, was added to each well and allowed to incubate for 30 min before imaging via fluorescent microscopy (Qdot 525 filter 32010, Chroma Technology Corporation, Bellows Falls, VT). Solar Inactivation. The variability in daily solar output, coupled with the hypothesized lengthy treatment times, required the use of a solar simulator. Artificial sunlight was generated from a Sol2A solar simulator equipped with a 1000 W ozone free xenon lamp and 1.5 global air mass filter (94062A, Newport Corporation, Irvine, CA) in accordance with the American Society for Testing and Materials standard E927−10.18 Total irradiance between 250−675 nm was measured through an ILT1700 radiometer equipped with a SED005/W light detector (International Light Technologies, Peabody, MA) thereby covering the ultraviolet and near entire visible spectra. To ensure similar spectral overlap between natural sunlight and the solar simulator, specific wavelength measurements of natural sunlight were obtained with an ILT950 spectroradiometer every 1.4 nm (the resolution of the spectroradiometer) on a sunny day in Riverside, CA. Treatment samples consisted of BKPyV, diluted in 200 or 100 mL (n = 12 and 10, respectively), of phosphate buffered saline (PBS; 12 mM Na2HPO4, 10 mM NaCl, 6 mM NaH2PO4, pH 7.3). Samples were treated under the solar simulator at room temperature (∼22.2 °C) with gentle stirring, and 1 mL was periodically removed to quantify BKPyV titers, in triplicate, by MB and IFA. A control was included for each set of experiments (three treatment times per experiment set) by placing PBS-diluted samples of BKPyV, covered in foil, directly under the solar simulator for half of the maximum treatment time. Inactivation studies were conducted until reaching a minimum of 99.9% reduction in viral titers, and specific treatment times were repeated twice. Inactivation Measurements and Statistical Analyses. Inactivation was calculated by comparing viral titers after treatment (N) to controls (N0) (=ln(N/N0)). When plotted against the duration of treatment (in h), kobs is equal to the negative slope of the regression line (in h−1). Additionally, kobs estimation can be improved by accounting for light attenuation due to column depth and sample absorbance.19 Due to a lack of photosensitive materials in the treatment media (PBS), inactivation was expected to be driven by endogenous effects from the UVB spectra of sunlight.20 Therefore, measurements of irradiance and sample absorbance at specific wavelengths were limited to 280−320 nm to develop a correction factor (CF) that was applied to kobs;
CF =
320
kobs, thick = 2.303
Finally, SAS Enterprise Guide version 5.1 (SAS Institute, Cary, NC) was used for analysis of covariance, simple linear regression, and finding standard errors for kobs.
■
RESULTS AND DISCUSSION The MB assay reduced detection times for BKPyV to periods that align with current FIO protocols. By targeting mRNA production, an early stage of viral replication, the MB assay required overnight incubation, while proteomic targets of IFA could not be detected until 3 days post infection. Representative images of MB and IFA results, spanning 3 orders of magnitude, are shown in Figure 2 and 3. Relative to
Figure 2. Immunofluorescence assay of renal proximal tubule epithelial cells performed
