Developing Rice Embryo Proteomics Reveals Essential Role for

May 27, 2009 - Cloned genes were used as a probe for Northern blot analysis. .... The beta-expansin gene has been shown to be related to root hair for...
0 downloads 0 Views 4MB Size
Download PDF
Developing Rice Embryo Proteomics Reveals Essential Role for Embryonic Proteins in Regulation of Seed Germination Sun Tae Kim,†,‡,# Yiming Wang,#,§ Sun Young Kang,§ Sang Gon Kim,‡ Randeep Rakwal,|,⊥ Yong Chul Kim,† and Kyu Young Kang*,‡,§,∇ Department of Plant Bioscience, Pusan National University, Miryang, 627-706, South Korea, Environmental Biotechnology National Core Research Center, Gyeongsang National University, Jinju, 660-701, South Korea, Division of Applied Life Science (BK21 Program), Gyeongsang National University, Jinju, 660-701, South Korea, Health Technology Research Center, National Institute of Advanced Industrial Science and Technology West, Tsukuba 305-8569, Ibaraki, Japan, Research Laboratory for Biotechnology and Biochemistry, G.P.O. Box 8207, Kathmandu, Nepal, and Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National University, Jinju, 660-701, South Korea Received April 20, 2009

Two-dimensional gel electrophoresis (2-DGE) in conjunction with mass spectrometry was utilized to unravel the changes in embryo proteins of geminating rice seeds. For this purpose, the embryos were dissected at 1 and 2 days after imbibition and germination of mature dry seeds. Proteins were extracted and their expression patterns were analyzed by large-format 2-DGE. A total of 642 silver nitrate stained protein spots were detected on 2-D gels, subjected to image analysis using the ImageMaster 6.0 2D Platinum software, resulting in the identification of 109 differentially expressed protein spots compared with imbibed seeds. MALDI-TOF-MS analysis resulted in the identification of 60 proteins, including 6 redundant and 54 nonredundant proteins. The identified proteins were classified according to their functional groups: metabolism (15 spots), oxygen-detoxifying (11 spots), protein processing/degradation (8 spots), stress/defense (5 spots), and energy (3 spots). Northern blot analysis demonstrated a good correlation between the mRNA expression profile and 2-DGE results for 27 proteins. Furthermore, Western blot analysis was used to confirm the high expression patterns of ascorbate peroxidase b (OsAPxb, spot 12/13) and L-ascorbate peroxidase 1 (OsAPx1, spot 17/27) in the embryo as compared with the endosperm of dry seeds. Present results suggest that seed germination is related with multiple regulations of functional proteins. For example, proteins related to metabolism (i.e., glycolysis and TCA cycle) are essential for the energy supply. On the other hand, oxygen-detoxifying proteins and stress/defense related proteins may take part in an important role in adaptation to environmental conditions during seed germination. Keywords: Embryo • MALDI-TOF-MS • Rice seed germination • Two-dimensional gel electrophoresis

Introduction The formation and subsequent germination of seeds is one of the most critical stages in the life cycle of a plant.1 The germination process not only includes significant morphological changes, but also helps in the activation of a multitude of intercellular molecular processes that aid the germination process itself. Of note, seed germination is a complex process * To whom correspondence should be addressed. Dr. Kyu Young Kang. E-mail, [email protected]; fax, +82-55-757-0178. † Pusan National University. ‡ Environmental Biotechnology National Core Research Center, Gyeongsang National University. # These authors contributed equally to this work. § Division of Applied Life Science (BK21 Program), Gyeongsang National University. | National Institute of Advanced Industrial Science and Technology West. ⊥ Research Laboratory for Biotechnology and Biochemistry. ∇ Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National University.

3598 Journal of Proteome Research 2009, 8, 3598–3605 Published on Web 05/27/2009

of cell division and cell expansion of plants, involving activation of most metabolic pathways, signal transduction, and energy synthesis.2 During seed germination, the two distinct but interconnected parts of the seed, namely, embryo and endosperm take different roles. The embryo contains most of the genetic information and development abilities essential for rapid shoot and root tissue formation during the germination process, whereas the endosperm supplies energy and carbon source to the developing embryo during the germination process.3,4 These complex processes occur in a very short time mostly in the embryonic tissues. Therefore, profiling changes in the developing embryo is very important in understanding seed germination and early seedling development processes. Proteomic analysis is necessary to unravel the precise role of proteins expressed in seed germination and plant development stages. Several proteomic-based studies are available for Arabidopsis, tomato, and barley seeds. In Arabidopsis, ap10.1021/pr900358s CCC: $40.75

 2009 American Chemical Society

research articles

Rice Embryonic Proteome in Seed Germination proximately, 1300 total seed proteins were detected on twodimensional (2-D) gels, and 74 changed (up- and downregulated) proteins were observed during germination sensu stricto and at the radicle protrusion step.5 Forty-seven major germination-related proteins were identified from embryo and endosperm of germinating tomato seeds.6 Forty-four, 42 and 19 spots were identified from dissected barley embryo, aleurone layer and endosperm tissues, respectively.7 Recently, a proteomics study of whole germinating rice seeds (subspecies indica) was performed and differentially expressed proteins upor down-regulated during the 72 h germination process were identified.8 A studies dealing with hybrid rice cultivars have investigated the development or stress-related protein profiles in rice embryo tissues by 2-D gel electrophoresis (2-DGE).9 Recently, a proteomic analysis of rice germination under gibberellin and abscisic acid (ABA) modulation was carried on embryonic tissue, which revealed that proteins in the embryo rather than the endosperm are sensitive to applied phytohormones.10 However, there is no complementary study on protein regulation in embryo tissues during the germination process. In this study, using high-format 2-DGE, we report, for the first time, proteomic analyses of rice (subspecies japonica) embryonic proteins during seed germination, resulting in the characterization of 60 significantly changed proteins having multiple functions. With the use of Northern blot analysis, a link between differentially expressed protein patterns and their mRNAs expressions was further demonstrated. In addition, we also verified the accumulation patterns of two identified proteins by Western blot analysis. Our present results provide new data suggesting an essential role for the identified embryonic proteins in regulation of seed germination.

Materials and Methods Rice Seed and Imbibition. The dehulled seeds of rice (Oryza sativa cv. Dongjin) were washed with 70% ethanol for 5 min followed by second washing in 3% sodium hydrochlorite for 30 min. Seeds were rinsed with distilled water at least five times followed by imbibition in distilled water at 4 °C for 48 h. The imbibed seeds were transferred onto 0.8% phytagel plates and incubated in a dark chamber at 28 °C. Seeds were collected at 24 and 48 h postgermination. A hundred embryos at each timepoint were harvested (separated from the endosperm using a surgical blade), frozen in liquid nitrogen, and stored at -70 °C until further analysis. 2-DGE Analyses. Total protein was extracted with Mg/NP40 buffer (0.5 M Tris-HCl, pH 8.3), 2% (v/v) NP-40, 20 mM MgCl2, 1 mM phenyl methyl sulfonyl fluoride, 2% (v/v) β-mercaptoethanol and 1% (w/v) polyvinyl polypyrrolidone) and fractionated with water-saturated phenol, followed by centrifugation (12 000g) for 15 min. The supernatant was precipitated by acetone essentially following a previously published method.11 2-DGE was performed according to the method of Kim et al.12 The IEF gel mixture consisted of a 4.5% (w/v) acrylamide solution, 9.5 M urea, 2% (v/v) NP-40, and 2.5% (v/ v) ampholytes (pH 3-10/pH 5-8/pH 4-6.5 ) 1:3.5:2.5). Equivalent samples (150 µg) were loaded into 18 cm isoelectric focusing (IEF) tube gel (pH 4-7) for the first dimension electrophoresis step followed by separation of proteins in the second dimension on 12% polyacrylamide gels. Separated proteins were detected by staining with silver nitrate. Digitized gel images were analyzed using the ImageMaster 6.0 2D Platinum software (Amersham Biosciences AB, Uppsala, Sweden). A minimum of three independent experiments were used

to create averaged images for 2-D gels presented in this study. The average of three samples with SD (p < 0.05) was calculated by Student’s t test. In-Gel Digestion and MALDI-TOF-MS Analysis. Protein spots were excised from silver nitrate stained gels. The gel spot was first washed with 50% (v/v) acetonitrile (ACN) in 0.1 M NH4HCO3, and dried by vacuum centrifugation. Dried gels were treated with 10 mM DTT in 0.1 M NH4HCO3 for 45 min at 55 °C followed by 55 mM iodoacetamide in 0.1 M NH4HCO3. The gel was washed with 50% ACN in 0.1 M NH4HCO3 and digested with 12.5 ng/mL trypsin and 25 mM NH4HCO3 in 10 µL of digesting solution overnight at 37 °C and air-dried. Samples were analyzed using a Voyager-DE STR MALDI-TOF mass spectrometer (PerSeptive Biosystems, Framingham, MA) as described previously.12 Database searches were performed using Protein Prospector (http://prospector.ucsf.edu). The search parameters allowed for one miscleavage, and variable modifications of methionine oxidation and cysteine carboxyamidomethylation with a mass tolerance of 50 ppm for MALDI. RNA Extraction, cDNA Library Construction, and Northern Blot Analysis. RNA samples were extracted by phenol/SDS method.13 Rice cDNA library was constructed using SuperScript Synthesis kit according to the manufacturer’s instructions (Invitrogen). All gene sequences were obtained by NCBI (http://www.ncbi.nlm.nih.gov/) or TIGR (http://www. tigr.org/tdb/e2k1/osa1/). Gene specific primer pairs were designed by Primer 3 program (Whitehead Institute/MIT Center for Genome Research) and listed in Table 1. Cloned genes were used as a probe for Northern blot analysis. Total RNA was separated on 1% (w/v) formaldehyde denaturing agarose gels, blotted onto nylon membranes (GeneScreen Plus; NEN Life Sciences, Wilmington, DE), and hybridized with (R-32P) dCTP probes labeled by means of previous hybridization and washing conditions.14 Equal sample loading (20 µg total RNA) was verified by staining rRNA with ethidium bromide. Western Blot Analysis. Total protein (20 µg) was separated by 12% SDS-PAGE, and transferred to a PVDF membrane using a semidry electrophoretic apparatus (Hoefer, Holliston, MA). The blotted membrane was blocked for 4 h at room temperature in 1× TTBS buffer (50 mM Tris-HCl, pH 8.2, 0.1% (v/v) Tween 20, and 150 mM NaCl) with 7% skim milk, and then incubated for 2 h after adding 1/1000 purified protein-specific primary antibody. Ascorbate peroxidase b (OsAPxb), and Lascorbate peroxidase 1 (OsAPx1) recombinant proteins with 6× His-tag were generated in a pQE30 expression vector, and proteins were purified according to the supplier’s instructions (Qiagen, Valencia, CA). The recombinant proteins were used to raise antibodies in adult female rabbits. Antibodies were purified by the antigen-antibody interaction method as described previously.14 Membrane was washed with TTBS for 15 min × 3 times. A secondary anti-rabbit IgG antibody conjugated with horseradish peroxidase diluted 1:10 000 in TTBS was used for immunodetection. The antigen-antibody interaction was carried out for 2 h, and the cross-reacting proteins were detected using ECL (Perkin-Elmer Life Sciences, Boston, MA).

Results and Discussion Identification of Differentially Expressed Embryo Protein during Seed Germination by 2-DGE and MS. To identify proteins differentially expressed in rice embryos during germination, a proteomics approach was used to generate highquality 2-D gels of embryo proteins. Seeds imbibed for 48 h at 4 °C were frozen in liquid nitrogen and used as a control. Journal of Proteome Research • Vol. 8, No. 7, 2009 3599

research articles

Kim et al.

Table 1. Gene Specific Primer Sets for Northern Blot Analysis spot no.

1 2, 35 3 4 7 9 12, 13 17, 27 20 21 22 23 28 30, 44 31 32 33, 59 36 39 40 41 45 46 54 55 56 60

protein name

Probenazole-induced protein Putative glutathione S-transferase Elongatioin factor1-BETA Fructokinase II Cysteine synthase Isoflavone reductase-like protein L-ascorbate peroxidase Ascorbate peroxidase Protein disulfide isomerase DnaK-type molecular chaperone BiP Glutaredoxin Group 3 LEA protein Nucleoside diphosphate kinase I S-adenosylmethionine synthetase 2 Beta-expansin Salt-stress induced protein 20S proteasome subunit alpha type 5 Adenosine kinase Enolase actin 1 Succinyl-CoA ligase Catalase isozyme A Fructose-bisphosphate aldolase, Glyceraldehyde 3-phosphate dehydrogenase, Voltage-dependent anion channel 26S protease regulatory subunit 4 homologue Cytoplasmic malate dehydrogenase

accession no.

forward primer

reverse primer

expected size

D38170 AF309378 D12821 AF429947 AF073695 AY071920 AB050724 D45423 AB039278 AF006825 D86744 AF046884 D16292 U82833 AF261271 AF001395 AB026561 AB050624 U09450 X16280 AY087596 X61626 X53130 U31676

TAGCTACAGGCATCAGTGGT CAATCATCGTGCAGTACATC CCTCTTCAAAGAAGAAAGAAAG ACTTCATCAAGGTGAGCCAC AACTGTACAAGTTTCAAGTGATG AGAACAAGACGGTGAACATAC GGATTGATTGATTGATTCGGATTG CTTGAGTGATCAGGACATTG GATGTTGTCATCGCTAAGAT TACCAGGATCAGCAGACAAC CTTGGAGCAACTTTCAAGGC CAGTACACCAAGGACTCTGC AGAAGAAAGGATTCTACCTGAG AAGGAGAACTTCGATTTCAG ATCGACATCCAGTTCAAGAG TCAGCATTCCACTGCAAGAC ACTACACAAGCTATCTGTGACTTAG AGACTGAGAATGTTGAGGAGAT GTTAACCAAATTGGATCTGTC GTATCCATGAGACTACATACAACTC GCTAAAGTTGACCTGAACTACAT GATACACAAGCAGAACGACTT AGGTCATCGCTGAGTACACC ACATGGCCAAGACCCAGTAG

ACGATGTCCTTCTCCTTCTC CTCATCTTAGCGAACTCGAC ATCACTCAAAAATAAACTCAAACTA TTAAATCGACCCTAAAATTCC TGATATACAGGGAAGATAAAATGTA AGATTAAACCAAGACACTCACTC CGTACTGACTCTAAGGCTCAAAAT AGCAGTAGTAGACTAGAAACCTCTT GTTGATTGTACAGTATTTCTCAATG TCTCCTCGTACTCCTCCTTC TGTCGTCTTTGCAGAACTGG ATAATAAACAGAACACAGACGAGA AAAACTCAAATATTTAACGAGAACT AAGATATCTGAACACTAAAACTCTG GAGGTATGTATAGTAGCTAATGCTG CACGTACACAGACAATGGGG GACTGATAATCCATTTAGGAAGTT GTACAGGTAGAACACACCAAAC GATTCTACGAGCTTTTTAACTAGAG TTTGAATAGAAGAAAATGATAACAG GGCTTTTGGTATATATAGAGAGATT ATTAATTAAGTTACACATATGCAGG TCTAGATATCAAAACCACATTAAGC TGAACACCGTCCACGTTTTA

479 463 422 461 413 424 875 327 437 496 222 432 435 402 425 196 457 406 405 452 452 458 482 113

Y18104 D17788

AGAACTCCCTCACCTTCGGT ATGGCCTTGGTGTCAACTTC ATAGTGAAGTTAGTGGTGACAGAG AATAATTTAAAVTGGACTTCTTTTT

AF353203 TGTGTACTCTGATGGTTCGTAT

Embryos were harvested from germinating seeds 24 and 48 h postgermination and processed for total protein extraction and 2-DGE. With the use of the ImageMaster software, more than 642 silver nitrate-stained protein spots were reproducibly detected through three independent replicates on each 2-D gel for control and 24/48 h postgermination samples. Among these, a total of 109 differentially accumulated protein spots were detected, suggesting their involvement in the germination process (Figure 1). Out of these, the expression levels of 60 significantly altered protein spots (p < 0.05) were quantified and recorded as digitalized images (Figure 2). The identity of these 60 protein spots were established using MALDI-TOF-MS and summarized in Table 1. Results revealed that, among 60 protein spots, 41 protein spots were up-regulated in embryos during seed germination, five spots were strongly induced at day 1 but decreased at day 2 (spots 19, 24, 26, 30 and 50), eight spots showed decrease at day 1 but were induced at day 2 (spots 8, 16, 26, 30, 40, 44, 45, 53 and 58), while six protein spots (spots 3, 11, 14, 22, 23 and 52) were found to be downregulated in embryo during germination process. Functional Classification of the Differentially Expressed Embryo Proteins. We grouped these differentially expressed proteins according to their functions, and these functional categories [metabolism (25%) > oxygen-detoxifying enzymes (18.3%) > protein processing/degradation (13.9%)] are depicted in Figure 3. We discuss the significance of these proteins in subsequent subsections below. 1. Metabolism. It is highly likely that the metabolic proteins are tightly involved in biological processes in mature seeds during embryogenesis and germination.15 Metabolism-related proteins were found to be significantly up- or down-regulated during germination not only in rice, but also in barley, tomato, 3600

Journal of Proteome Research • Vol. 8, No. 7, 2009

CAATGTTTTCAGCAAATGTC

157 423 419

and other plants.7-9 In the present study, proteins involved in metabolism were found to be the largest up-regulated protein group. Among these, proteins related to glycolysis [spot 46, fructose-bisphosphate aldolase and spot 54, glyceraldehyde 3-phosphate dehydrogenase (key regulation enzymes); spot 4, fructokinase II and spot 34, fructokinase (involved in transfer of fructose to glucose); and spot 39, enolase)] were the most prominently expressed during seed germination. Of note, the glycolysis cycle plays an essential role in energy production by utilizing endosaccharides. We also identified proteins of the TCA cycle (spot 41, succinyl-CoA ligase; and spot 60, cytoplasmic malate dehydrogenase) that were stably accumulated during the germination process. It should be noted that TCA cycle can produce high-energy phosphate compounds, which serve as the main source of cellular energy. Taken together, these results indicated that energy supply during germination process depends on both glycolysis and TCA cycles. Although Yang’s group reported that glycolysis appears to be the main energy source during seed germination, they could not identify TCA-cycle related proteins in their study.8 2. Oxygen-Detoxifying Proteins. Oxygen-detoxifying proteins play multiple roles in plant growth, development, defense and biotic or abiotic responses, and are also closely related with seed germination.16,17 The redox balance is therefore essential for proper plant growth and development. During the germination process, reactive oxygen species (ROS) comes from both aerobic metabolisms and environmental stimuli/stresses.18 It is believed that a high accumulation of ROS may suppress germination and early development via oxidative stressinduced cellular damage.19 In rice plant, ROS were found to be present at high levels during the germination stages, especially in roots, which may play multiple roles in plant

research articles

Rice Embryonic Proteome in Seed Germination 21-23

Figure 1. Proteomics analyses of rice embryo proteins during seed germination process. Seeds were imbibed at 4 °C for 48 h in dark and germinated on 0.8% phytagel plates. Proteins were extracted from rice embryos after imbibition for 24 and 48 h after germination. Germination assays were carried out on three independent replicates with 100 seeds each. Total embryo proteins (150 µg) were separated by 2-DGE with IEF (pH 4-7) in the first dimension and SDS-PAGE in the second dimension, and detected by silver nitrate staining. Significantly changed proteins (p < 0.05) were indicated by arrows. IM, Imbibition.

development.20 Here we found 11 spots encoding oxygendetoxifying enzymes in embryo tissues including APx isoforms (spots 12, 13, 17, and 27), Monodehydroascorbate reductase (spot 5), glyoxalase (spot 8), GST (spots 2, and 35), protein disulfide isomerase (spot 20: PDI), and NADPH-dependent oxidoreductase (spot 42). In the ascorbate-glutathione cycle, APx is a key enzyme involved in reducing hydrogen peroxide (H2O2) to water, and MDAR reduces glutathione as the electron donor. These results indicate that ROS generation accompanies the seed germination process. It is possible that the antioxidative enzymes may play an important role for maintenance of intercellular ROS balances and protect plant structure reconstruction and cell extension process. 3. Heat Shock and Stress-Induced Proteins. A 16.9 kDa class I heat shock protein (HSP, spot 18) and a 70 kDa danktype molecular chaperone immunoglobulin binding protein (spot 21, chaperone BiP) showed increased accumulation during germination. The HSPs were reported to be closely related with thermo-tolerance during seed germination process, embryo development protection, and response to various

environmental stresses. Dank-type molecular chaperone BiP protein belongs to the HSP70s subfamily, and is known to prevent proteins from unfolding under stressful conditions.24 During the germination process, a group of stress-induced genes was found to be strongly expressed. Probenazole (PBZ)induced protein (spot 1) has been reported as a molecular marker in response to biotic stresses.25 Isoflavone reductase (IFR)-like protein (spot 9) and salt-stress induced protein (spot 32, SalT) are stress-related proteins induced by fungal elicitor and under salt stress.12,14 Induction of HSPs and stress-related proteins may prevent seed damage resulting from various environmental stresses encountered during the germination process. On the other hand, it may be possible that, as the germination process is itself “stressful”, these proteins may part of a self-defense mechanism activated during germination. 4. Protein Processing/Degradation. The ubiquitin proteasome group including 20S, 26S proteasome subunits (spots 15, 33, 48, and 56) showed accumulation during seed germination. It was reported that the ubiquitin-proteasome system regulates plant development and cell division by regulating different cellular signals.26 It is highly likely that the accumulation of these proteins may be involved in degradation of proteins used during cell division and cell structure construction. Therefore, the proteasome mediated protein degradation could be an essential pathway for seed germination and development. 5. Cytoskeleton and Structure. The cytoskeleton reconstruction enzymes were found to be highly expressed during the germination process. Caffeoyl-CoA 3-O-methyltransferase (spot 51) was reported as the key enzyme in lignin biosynthesis.27 UDP-glucose dehydrogenase (spot 43) is an important enzyme in the synthesis of hemicellulose and pectin.28 These proteins may help in the foundation of plant structures during rapid growth accompanying seed germination and seedling formation. Expansin (spot 31) is now generally accepted to be a key regulator of wall extension during growth. The betaexpansin gene has been shown to be related to root hair formation in barley and internodal elongation in deepwater rice.29,30 Our data indicate that cytoskeleton and structurerelated proteins may play important roles in cell structure biosynthesis during the germination process. Comparison of Rice Embryonic Proteins with Previously Identified Proteins. To date, several proteomics studies have focused on the seed germination processes in various plants, such as tomato, Arabidopsis and barley.5-7 For the tomato and Arabidopsis, dry seed was used as a control for comparative analysis. Most of the changed proteins belonged to the category of storage proteins, such as vicilins. However, only one storage protein (glutelin) was identified in our present study, and it was found to be induced during seed germination when compared to imbibed embryos. In Arabidopsis, a catalase 2 protein (ROS-related protein) and S-adenosylmethionine synthetase (metabolic protein) were found to be induced during imbibition and the LEA protein showed a decrease during imbibition. These proteins were also identified in our study. Bønsager et al. used barley seeds to analyze the differentially regulated proteins in embryo, aleurone layer and endosperms during germination process.6 The authors used imbibed seeds as a control, which is similar to that used in our present study. In the embryo tissues, more functional proteins including stress-related proteins, oxygen-detoxifying proteins, protein folding and storage-related proteins were reported. Five spots encoding LEA protein showed an embryo specific accumulation and decreased during germination. APX, enolase, and protein Journal of Proteome Research • Vol. 8, No. 7, 2009 3601

research articles

Kim et al.

Figure 2. Intensity of protein expression levels of 60 proteins identified by MALDI-TOF-MS. The intensity was detected by ImageMaster software on 2-D gels after imbibition (white bar) for 1 day (gray bar) and 2 day (black bar). IM, Imbibed seeds.

for homeostasis of ROS levels increased during rice seed germination compared with those of barley.

Figure 3. The functional categorization of proteins identified by 2-DGE. Proteins were classified using the NCBI database.

process/degradation-related proteins (proteasome R subunit and subunit β-type) showed an increase, which is in good agreement with our results. HSP70 and six small HSPs were also detected during germination process, indicating that HSPs may play a role as molecular chaperones. However, these proteins were reported to be decreased during germination, which was opposite to our present results. Therefore, we suggest that the activity of HSPs as chaperones may be required 3602

Journal of Proteome Research • Vol. 8, No. 7, 2009

Expression Profiling of the Corresponding Genes Regulated During Seed Germination. To demonstrate whether protein expression levels changed during seed germination can be correlated with their mRNA expression levels, we performed Northern blot analysis using gene-specific primers. Probes obtained from the cDNA library encoding 27 proteins were selected (Table 2). Total RNA from dry seed, imbibed seed, and germinated seeds were used for Northern blot analysis and the results are presented in Figure 4. Most metabolism-related protein (spots 4, 39, 41, 46, 54, and 60) genes were not expressed in the dry seed, but were found to be highly induced during the germination process. Although S-adenosylmethionine synthetase (spots 30, and 44) was constitutively expressed in the dry seed, its expression was further induced only after germination, indicating that most metabolic process are activated after seed imbibition. Oxygen-detoxifying protein genes glutathione S-transferase (spots 2, and 35), OsAPxb (spots 12, and 13), OsAPX1 (spots 17, and 27), PDI (spot 20), and catalase isozyme A (spot 45) were strongly detected in germinating seed, indicating that these oxygen-detoxifying enzymes are essential for homeostasis of ROS balancing during seed germination. We speculate that a high expression of genes encoding these proteins has a role in maintaining redox balance in the embryonic cells of germinating seed. Stress/defense-related

research articles

Rice Embryonic Proteome in Seed Germination

Table 2. Protein Identification by MALDI-TOF-MS Fingerprint Analysis of Differentially Expressed Proteins during Seed Germination and Functional Classification of the Identified Proteinsa spot no.

protein name

obs. MW/pI

exp. MW/pI

ac. no.

MP no.

Sc (%)

function

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Probenazole-induced protein Putative glutathione S-transferase OsGST 4 β-Elongatioin factor 1 Putative fructokinase II Monodehydroascorbate reductase Putative IAA amidohydrolase Cysteine synthase Glyoxalase Isoflavone reductase-like protein Calcium-dependent protein kinase Reverse transcriptase L-ascorbate peroxidase L-ascorbate peroxidase RAB24 protein 20S proteasome subunit alpha type 6 Putative nucleoside diphosphate kinase Ascorbate peroxidase 16.9 kDa class I heat shock protein r40c1 protein Protein disulfide isomerase DnaK-type molecular chaperone BiP Glutaredoxin Group 3 LEA protein Glutelin Cysteine synthase RAB24 protein Ascorbate peroxidase Nucleoside diphosphate kinase I Photosystem I protein psaH precursor S-adenosylmethionine synthetase 2 Beta-expansin Salt-stress induced protein 20S proteasome subunit alpha type 5 Putative fructokinase Putative glutathione S-transferase OsGST 4 Adenosine kinase Vacuolar ATPase B subunit ATP synthase beta chain, mitochondrial precursor Enolase ACTIN 1 Succinyl-CoA ligase beta subunit Putative NADPH-dependent oxidoreductase Putative UDP-glucose dehydrogenase S-adenosylmethionine synthetase 2 Catalase isozyme A Fructose-bisphosphate aldolase, cytoplasmic isozyme Hypothetical protein 26S protease regulatory subunit 6A homologue F1-ATP synthase, beta subunit Putative serine/theronine protein phosphatase Caffeoyl-CoA 3-O-methyltransferase Putative 40S ribosomal protein S12 Putative TNP2 transposase Glyceraldehyde 3-phosphate dehydrogenase, cytosolic Voltage-dependent anion channel 26S protease regulatory subunit 4 homologue S-adenosylmethionine synthetase MADS box protein 20S proteasome subunit alpha type 6 Cytoplasmic malate dehydrogenase

17/4.7 25/4.62 29/4.4 33/4.78 48/4.9 44/5.35 31.5/4.98 32/5.1 33/5.35 33/6.1 10.4/9.45 24/5.1 24.5/5.3 24/59.5 26/6.1 15/6.4 23.5/48.6 14/5.95 33/6.6 57/4.68 68/4.72 13/5.4 20.5/5.88 57.1/ 8.96 31.5/4.98 24.1/ 5.87 25/4.95 14.5/5.88 30/5.65 42/5.4 27/5.12 25/4.8 27/4.5 37/4.7 39/4.78 38.6/4.72 57/4.88 56/4.95 57/5.2 40/4.9 45.3/6.08 32/4.88 64/5.6 66/5.72 71/5.85 40/6.6 99.6/6.25 51/4.68 49.1/ 5.25 35.7/ 5.28 28/4.8 14.8/5.33 97.4/8.22 38/6.15 25/6.7 18.5/6.2 66/5.72 27.2/8.59 34.5/5.3 44/5.8

16.7/4.9 25.6/5.0 23.8/4.9 35.6/5.0 43.0/5.4 44.0/5.4 33.9/5.4 32.6/5.5 33.5/5.7 58.8/8.0 10.4/9.5 27.2/5.4 27.2/5.4 24.1/5.9 27.6/6.2 16.8/6.8 20.5/5.9 17.0/6.2 38.9/6.3 33.4/4.8 73.5/5.3 11.8/5.8 20.5/5.9 57.1/9.0 34.3/5.4 24.1/5.9 27.1/5.2 16.9/6.3 15.1/10.2 42.9/5.7 29.2/5.5 15.2/5.2 26.0/4.7 34.7/5.1 25.6/5.0 32.2/5.3 54.1/5.1 59.1/6.3 48.0/5.4 41.9/5.3 45.3/6.1 35.7/5.3 52.9/5.8 42.9/5.7 56.6/6.7 38.8/8.5 10.0/6.2 47.8/5.0 49.1/5.3 35.7/3.5 27.7/5.1 14.8/5.3 97.4/8.2 36.5/6.6 29.2/7.1 49.6/5.9 43.2/5.9 27.2/8.6 27.6/6.2 35.6/5.7

7442204 11177833 232031 16566704 4760483 28376718 11131899 4126809 18250364 6689920 7489576 7489542 7489542 1710078 12229922 12597873 11094301 123543 7489571 7209794 7441868 7430859 4105441 4126687 11131901 1710078 11094301 585551 72679 3024122 8118423 134190 12229920 16566707 11177833 21698922 14150751 231587 3023713 113222 21593189 14029046 13236672 3024122 1705624 113622 18071396 1174613 4388533 21104823 5257275 23617253 19920120 3023816 7339529 1172635 17529621 2055376 12229922 10140741

4 7 4 7 10 12 8 4 8 4 2 8 9 6 4 5 5 6 9 12 9 13 3 4 10 4 5 11 4 10 9 4 4 11 6 4 27 7 13 6 5 11 8 10 8 9 2 12 8 4 7 8 7 9 6 6 9 3 6 4

47 48 27 38 32 39 33 26 43 23 34 36 46 26 19 43 24 38 30 34 36 54 23 13 20 25 25 49 25 35 35 31 16 34 16 19 51 21 35 21 19 43 22 41 16 48 31 27 28 20 48 88 18 21 25 32 29 21 30 20

Stress/defense Oxygen-detoxifying enzymes Development Metabolism Oxygen-detoxifying enzymes Metabolism Processing/degradation Metabolism Stress/defense Signal translation Ribosome, protein translation Oxygen-detoxifying enzymes Oxygen-detoxifying enzymes Signal translation Processing/degradation Development Oxygen-detoxifying enzymes Chaperonin, Heat shock Stress/defense Oxygen-detoxifying enzymes Chaperonin, Heat shock Oxygen-detoxifying enzymes Stress/defense Storage protein Processing/degradation Signal translation Oxygen-detoxifying enzymes Signal translation Unknown Metabolism Cytoskeleton structure Stress/defense Processing/degradation Metabolism Oxygen-detoxifying enzymes Nucleotide translation Energy Energy Metabolism Cytoskeleton structure Metabolism Oxygen-detoxifying enzymes Metabolism Metabolism Oxygen-detoxifying enzymes Metabolism Unknown Processing/degradation Metabolism Signal translation Metabolism Processing/degradation Ribosome, protein translation Metabolism energy Processing/degradation Metabolism Unknown Processing/degradation Metabolism

a Obs. MW/pI, observed molecular weight/isoelectric point. Exp. MW/pI, experimental molecular weight/isoelectric point. Ac. no., accession number via NCBI database. Mp no., number of matched peptides. Sc, sequence coverage.

protein genes PBZ1 (spot 1), IFR (spot 9), and SalT (spot 32) expressions were detected only in germinating embryos. The late embryogenesis abundant protein (LEA) (spot 23), a wellknown ABA-induced protein associated with breaking of seed dormancy, was found to be decreased during the germination process.10,31 The mRNA level of LEA was constitutively higher in dry seed and showed a decrease after germination. The 20Sproteasome (spots 33, and 59) and actin 1 (spot 40) mRNAs were also weakly expressed in dry and imbibed seed, but the remaining nine genes (spots 3, 7, 21, 22, 28, 31, 36, 55, and 56) were regulated at the expression level during germination showing a significant increase with germination time. Taken

together, the expression patterns of mRNA and protein showed a positive correlation during seed germination. It is important to mention here that some of the identified proteins were detected as different spots with a distinct pI and molecular weight (MW), such as spots 12 and 13. Both of these proteins are encoded by the OsAPxb gene, but showed a different expression level during the germination process. The intensity of spot 13 was very high and this correlated well with the mRNA expression profile of the OsAPxb gene. However, spot 12 mRNA was constitutively expressed and only showed a weak increase in expression during the germination process. From this result, we can infer that the same protein with Journal of Proteome Research • Vol. 8, No. 7, 2009 3603

research articles

Kim et al.

Figure 4. Northern blot analyses of 27 gene expressions during seed germination. Total RNAs were obtained from embryo parts that were harvested from dry seeds, imbibed seeds, and germinated seeds after 24 or 48 h. Each RNA sample (20 µg) was blotted onto nylon membranes, hybridized with 32P-labeled probes, and washed at high stringency condition. Equal loading was verified by staining rRNA with ethidium bromide. Blots were exposed to X-ray film at -70 °C for 1 day. Abbreviations: D, dry seeds; I, Imbibed seeds; G24, germinated for 24 h; G48, germinated for 48 h.

Concluding Remarks

Figure 5. Western blot analyses of OsAPxb and OsAPx1 proteins in dry seed, embryo and endosperm tissues. Protein extracts (each 20 µg) from dry seed, endosperm and embryo tissue after imbibitions were separated on SDS-PAGE, transferred onto a PVDF membrane, and subjected to Western blot analysis with OsAPxb, and OsAPx1 specific antibodies, respectively.

different pI/MW may be the products of post-translational modification, processing, degradation or dimerization. Western Blot Analysis Reveals Distinct Accumulation Patterns of OsAPxb and OsAPx1 Proteins. To verify some of the 2-DGE results, the expression patterns of three proteins (spots 12 and 13, OsAPxb; spots 17 and 27, and OsAPx1) were further confirmed by immunoblotting. It is highly likely that these ROS-related proteins are closely related with early root development and root hair formations functioning as H2O2 scavenger.32 We further determined the expression levels of each protein in dry seed, embryo and endosperm tissues (Figure 5). OsAPxb accumulated only in the embryo tissue. On the other hand, OsAPx1 was found to accumulate in all tissues examined, but showed the highest and weakest accumulation in embryo and endosperm compared to dry seed. Their high accumulation in embryonic tissue is also in line with the protein profiles on 2-D gels. Moreover, OsAPx1 was also detected in the dry seed and endosperm tissues, indicating its abundance in all tissues. 3604

Journal of Proteome Research • Vol. 8, No. 7, 2009

In this study, we investigated the molecular responses in rice embryos during seed germination process using a proteomic approaches. A total of 60 proteins were identified by mass spectrometry to be differentially expressed in the seed germination process. The majority of these altered proteins were related to metabolism, antioxidant enzymes, protein degradation/process, and stress or defense, indicating that selfdevelopment and stress adaptation is important for the germination process. In addition, we analyzed the expression levels of transcripts corresponding to those of the differentially expressed proteins. The transcript levels and their expression profiles were found to be in good agreement with the observed protein profiles on 2-D gels. A further analysis of tissue expressions of OsAPxb at the protein level reflected well on an essential role for regulation of embryonic proteins in seed germination. In summary, using a proteomics approach on germinating rice seed embryos, our study generates clues to better understanding seed germination in rice as well as other plants.

Acknowledgment. This work was supported by Biogreen 21 (03-2008-0172), the Crop Functional Genomic Center (CG1322), and a grant from KOSEF/MOST to the Environmental Biotechnology National Core Research Center (R15-2003-012-010020), and by scholarships from the Brain Korea 21 Program (Y. Wang). References (1) Keller, M.; Kollmann, J. Effects of seed provenance on germination of herbs for agricultural compensation sites. Agric. Ecosyst. Environ. 1999, 72, 87–99. (2) Shu, X. L.; Frank, T.; Shu, Q. Y.; Engel, K. H. Metabolite profiling of germinating rice seeds. J. Agric. Food Chem. 2008, 56, 11612– 11620. (3) Dure, L.; Waters, L. Long-lived messenger RNA: evidence from cotton seed germination. Science 1965, 147, 410–412. (4) Bewley, J. D. Seed germination and dormancy. Plant Cell 1997, 9, 1055–1066.

research articles

Rice Embryonic Proteome in Seed Germination (5) Gallardo, K.; Job, C.; Groot, S. P.; Puype, M.; Demol, H.; Vandekerckhove, J.; Job, D. Proteomic analysis of Arabidopsis seed germination and priming. Plant Physiol. 2001, 126, 835–848. (6) Bønsager, B. C.; Finnie, C.; Roepstorff, P.; Svensson, B. Spatiotemporal changes in germination and radical elongation of barley seeds tracked by proteome analysis of dissected embryo, aleurone layer, and endosperm tissues. Proteomics 2007, 7, 4528–4540. (7) Sheoran, I. S.; Olson, D. J.; Ross, A. R.; Sawhney, V. K. Proteome analysis of embryo and endosperm from germinating tomato seeds. Proteomics 2005, 5, 3752–3764. (8) Yang, P.; Li, X.; Wang, X.; Chen, H.; Chen, F.; Shen, S. Proteomic analysis of rice (Oryza sativa) seeds during germination. Proteomics 2007, 7, 3358–3368. (9) Wang, W.; Meng, B.; Ge, X.; Song, S.; Yang, Y.; Yu, X.; Wang, L.; Hu, S.; Liu, S.; Yu, J. Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines. Proteomics 2004, 8, 4808– 4821. (10) Kim, S. T.; Kang, S. Y.; Wang, Y.; Kim, S. G.; Hwang, D. H.; Kang, K. Y. Analysis of embryonic proteome modulation by GA and ABA from germinating rice seeds. Proteomics 2008, 8, 3577–3587. (11) Kim, S. T.; Cho, K. S.; Jang, Y. S.; Kang, K. Y. Two-dimensional electrophoretic analysis of rice proteins by polyethylene glycol fractionation for protein arrays. Electrophoresis 2001, 22, 2103– 2109. (12) Kim, S. T.; Kim, S. G.; Hwang, D. H.; Kang, S. Y.; Kim, H. J.; Lee, B. H.; Lee, J. J.; Kang, K. Y. Proteomic analysis of pathogenresponsive proteins from rice leaves induced by rice blast fungus. Magnaporthe grisea. Proteomics 2004, 4, 3569–3578. (13) Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., Eds. Phenol/SDS method for plant RNA preparation. In Current Protocols in Molecular Biology; J. Wiley and Sons: New York, 1987; pp. 4.3.1-4.3.4. (14) Kim, S. T.; Cho, K. S.; Kim, S. G.; Kang, S. Y.; Kang, K. Y. A rice isoflavone reductase-like gene, OsIRL, is induced by rice blast fungal elicitor. Mol. Cells 2003, 16, 224–231. (15) Catusse, J.; Strub, J. M.; Job, C.; Van Dorsselaer, A.; Job, D. Proteome-wide characterization of sugarbeet seed vigor and its tissue specific expression. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 10262–10267. (16) Moons, A. Regulatory and functional interactions of plant growth regulators and plant glutathione S-transferases (GSTs). Vitam. Horm. 2005, 72, 155–202. (17) Bailey-Serres, J.; Mittler, R. The roles of reactive oxygen species in plant cells. Plant Physiol. 2006, 141, 311. (18) Apel, K.; Hirt, H. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399.

(19) Sattler, S. E.; Gilliland, L. U.; Magallanes-Lundback, M.; Pollard, M.; DellaPenna, D. Vitamin E is essential for seed longevity and for preventing lipid peroxidation during germination. Plant Cell 2004, 16, 1419–1432. (20) Kim, S. G.; Kim, S. T.; Kang, S. Y.; Wang, Y.; Kim, W.; Kang, K. Y. Proteomic analysis of reactive oxygen species (ROS)-related proteins in rice roots. Plant Cell Rep. 2008, 27, 363–375. (21) Su, P. H.; Li, H. M. Arabidopsis stromal Hsp70s are essential for plant development and important for thermotolerance of germinating seeds. Plant Physiol. 2008, 146, 1231–1241. (22) Prasinos, C.; Krampis, K.; Samakovli, D.; Hatzopoulos, P. Tight regulation of expression of two Arabidopsis cytosolic Hsp90 genes during embryo development. J. Exp. Bot. 2005, 56, 633–644. (23) Vierling, E. The roles of heat shock proteins in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1991, 42, 579–620. (24) Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heatshock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2008, 9, 244–252. (25) Takahashi, A.; Kawasaki, T.; Henmi, K.; Shii, K.; Kodama, O.; Satou, H.; Shimamoto, K. Lesion mimic mutants of rice with alterations in early signaling events of defense. Plant J. 1999, 17, 535–545. (26) Moon, J.; Parry, G.; Estelle, M. The ubiquitin-proteasome pathway and plant development. Plant Cell 2004, 16, 3181–3195. (27) Do, C. T.; Pollet, B.; The´venin, J.; Sibout, R.; Denoue, D.; Barrie`re, Y.; Lapierre, C.; Jouanin, L. Both caffeoyl coenzyme A 3-Omethyltransferase 1 and caffeic acid O-methyltransferase 1 are involved in redundant functions for lignin, flavonoids and sinapoyl malate biosynthesis in Arabidopsis. Planta 2007, 226, 1117–1129. (28) Johansson, H.; Sterky, F.; Amini, B.; Lundeberg, J.; Kleczkowski, L. A. A Molecular cloning and characterization of a cDNA encoding poplar UDP-glucose dehydrogenase, a key gene of hemicellulose/ pectin formation. Biochim. Biophys. Acta 2002, 1576, 53–58. (29) Kwasniewski, M.; Szarejko, I. Molecular cloning and characterization of beta-expansin gene related to root hair formation in barley. Plant Physiol. 2006, 141, 1149–1158. (30) Lee, Y.; Kende, H. Expression of beta-expansins is correlated with internodal elongation in deepwater rice. Plant Physiol. 2001, 127, 645–654. (31) Calvo, E. S.; Rodermel, S. R.; Shoemaker, R. C. A third highly conserved group 1 Lea gene from Arabidopsis thaliana L. Plant Physiol. 1994, 106, 787–788. (32) Carol, R. J.; Dolan, L. The role of reactive oxygen species in cell growth: lessons from root hairs. J. Exp. Bot. 2006, 57, 1829–1834.

PR900358S

Journal of Proteome Research • Vol. 8, No. 7, 2009 3605