Differential Proteomic Analysis of a Polymicrobial Biofilm - Journal of

Oral Health CRC, Melbourne Dental School and the Bio21 Institute, The University of Melbourne, Victoria 3010, Australia. J. Proteome Res. , 2012, 11 (...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/jpr

Differential Proteomic Analysis of a Polymicrobial Biofilm Zamirah Zainal-Abidin,†,‡ Paul D. Veith,† Stuart G. Dashper,† Ying Zhu, Deanne V. Catmull, Yu-Yen Chen, Deasy C. Heryanto, Dina Chen, James S. Pyke, Kheng Tan, Helen L. Mitchell, and Eric C. Reynolds* Oral Health CRC, Melbourne Dental School and the Bio21 Institute, The University of Melbourne, Victoria 3010, Australia S Supporting Information *

ABSTRACT: Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia exist in a polymicrobial biofilm associated with chronic periodontitis. The aim of this study was to culture these three species as a polymicrobial biofilm and to determine proteins important for bacterial interactions. In a flow cell all three species attached and grew as a biofilm; however, after 90 h of culture P. gingivalis and T. denticola were closely associated and dominated the polymicrobial biofilm. For comparison, planktonic cultures of P. gingivalis and T. denticola were grown separately in continuous culture. Whole cell lysates were subjected to SDS-PAGE, followed by in-gel proteolytic H216O/H218O labeling. From two replicates, 135 and 174 P. gingivalis proteins and 134 and 194 T. denticola proteins were quantified by LC−MALDI TOF/TOF MS. The results suggest a change of strategy in iron acquisition by P. gingivalis due to large increases in the abundance of HusA and HusB in the polymicrobial biofilm while HmuY and other iron/haem transport systems decreased. Significant changes in the abundance of peptidases and enzymes involved in glutamate and glycine catabolism suggest syntrophy. These data indicate an intimate association between P. gingivalis and T. denticola in a biofilm that may play a role in disease pathogenesis. KEYWORDS: bacterial community, Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, 18O, quantitative proteomics, LC−MALDI-TOF/TOF, iron, glycine, protein secretion, chronic periodontitis

1. INTRODUCTION The vast majority of bacteria exist naturally as components of polymicrobial biofilms. This is especially true of non-motile bacteria where planktonic cells are mainly a mechanism for dispersal and colonization of new sites. Biofilm formation and development enables the bacterium to remain in nutrient-rich environments and resist physical removal by the shear forces of the liquid phase.1 It also provides a number of advantages, including protection from host immune responses, toxic substances such as antibiotics, and environmental stresses and provides a perfect environment for horizontal gene transfer.2,3 Biofilms pose a major medical problem due to persistent and chronic infections, and their ability to form on inanimate surfaces of indwelling medical devices, which are difficult to eradicate using antimicrobials.4 When growing as homotypic or polymicrobial biofilms, bacteria moderate the expression of a large percentage of their genes.5−7 Bacteria have restricted genomic capacity that limits their metabolic capability and their ability to adapt to changes in the environment. Growth as part of a polymicrobial biofilm enables the community to produce a level of multicellularity and extend metabolic capacity. One of the most studied microbial biofilms is dental plaque, a dense, polymicrobial biofilm that accretes on the hard, nonshedding surface of the tooth.8,9 Subgingival plaque alone may harbor up to 400 species that fall into nine bacterial phyla.10 A study employing cluster analysis of bacterial species © 2012 American Chemical Society

isolated from 13,261 subgingival plaque samples taken from healthy and periodontally diseased subjects revealed five major bacterial consortia and an ecological succession from health to disease.11 The presence and relative abundance of a specific consortium comprising the anaerobic, proteolytic species Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia was strongly associated with the clinical measures of chronic periodontitis.11−14 This has led to the belief that these three species are spatially as well as temporally co-localized in subgingival plaque; however, there is little direct evidence to support this belief. In fact Zijnge et al.15 have shown that T. forsythia was located in the middle layer of subgingival plaque, whereas P. gingivalis and T. denticola were present as microcolonies in the superficial layer. Furthermore, the abundance of P. gingivalis and T. denticola but not T. forsythia in subgingival plaque has been related to imminent progression of periodontitis in a prospective clinical study.13 These results are consistent with a recent study suggesting that P. gingivalis is a key pathogen in the initiation and progression of periodontitis.16 Previous in vitro studies on the interrelationship of P. gingivalis, T. denticola, and T. forsythia and with other species provide insights on how they interact during biofilm developReceived: February 29, 2012 Published: July 19, 2012 4449

dx.doi.org/10.1021/pr300201c | J. Proteome Res. 2012, 11, 4449−4464

Journal of Proteome Research

Article

workflow using H 2 16 O/H 2 18 O labeling to explore the adaptations of P. gingivalis and T. denticola to growth as a polymicrobial biofilm. The findings demonstrate significant adaptations regarding the acquisition of iron, the sharing of nutrients, the structure of flagella, and the secretion of virulence factors.

ment and how these interactions may contribute to the initiation and progression of periodontitis. Synergistic biofilm formation has been reported between T. forsythia and Fusobacterium nucleatum17,18 and between P. gingivalis and T. denticola.19,20 Synergy has been further demonstrated in murine models of periodontitis, where inoculation of the animals with P. gingivalis together with one of T. denticola and T. forsythia resulted in more extensive alveolar bone destruction than inoculation with a single species.21,22 The understanding of the changes of the proteomes of these bacteria when they interact as a consortium within a biofilm community, compared with monospecies planktonic culture, may help elucidate the mechanisms involved in the development of a pathogenic biofilm. The establishment of in vitro oral biofilm model systems allows investigations that can address scientific questions on polymicrobial biofilm formation and bacterial interactions in biofilm structures. Dental plaque models for both in vivo and in vitro studies have been extensively reviewed.23 An approach is the construction of in vitro consortia biofilm models, where the species that comprise the biofilm are well-defined, and can be further divided into two systems: flowing and static. For the flowing systems, nutrients from fresh medium are continuously supplied to the biofilm culture. One type of flowing system is the flow-cell apparatus, which allows the direct microscopic investigation of the biofilm development in time course experiments.7,24,25 Comparative analyses of the proteomes of bacterial pathogens between biofilm and planktonic growth modes have been reported.7,26−28 These investigations revealed changes in the abundance of numerous proteins that may be involved in the adaptation to the biofilm mode of growth. For P. gingivalis, T. denticola, and T. forsythia, profiles of the relative abundances between the two growth states have been carried out at both the proteomic and transcriptomic levels. The significant changes observed include proteins associated with iron transport, amino acid metabolism, and biofilm formation for P. gingivalis,5,6 whereas for T. denticola, changes were observed in the expression of genes encoding known virulence factors such as cystalysin and dentilisin, putative transposases, and toxin-antitoxin systems.29 A comparative proteomics study conducted on T. forsythia revealed changes of abundance in predicted membrane proteins and those associated with stress response.30 In contrast to the number of proteomic studies conducted on biofilms and despite the polymicrobial nature of most natural biofilms, there are few quantitative studies examining the effect of culturing bacteria in the presence of other microbes. Lactobacillus plantarum DC400 has been studied in co-culture with other lactobacilli grown in liquid culture in separate vessels separated by a 0.4 μm filter in a quantitative 2D gel electrophoresis study.31 In addition, changes to the proteome of P. gingivalis induced by the presence of both S. gordonii and F. nucleatum have been studied by LC−MS/MS and spectral counting techniques.32 To the best of our knowledge, no quantitative proteomic study has yet been conducted to assess the effect of multiple bacterial species establishing and growing together as a polymicrobial biofilm, such that they can interact both physically and in ways that foster synergistic growth. In the current study, we cultured the three bacterial species associated with periodontitis in a flow cell system and found that P. gingivalis and T. denticola dominated the polymicrobial biofilm over time. We therefore employed a quantitative proteomics

2. METHODS 2.1. Bacterial Strains and Growth

Porphyromonas gingivalis strain W50, Treponema denticola ATCC 35405, and Tannerella forsythia ATCC 43037 were used in this study. The cultures were grown at 37 °C in a MACS MG500 anaerobic workstation (Don Whitley Scientific, U.K.). T. denticola was grown in oral bacteria growth medium (OBGM) as described previously.33 P. gingivalis was grown in brain heart infusion (BHI) (Oxoid, U.K.), supplemented with hemin (5 μg/mL) and cysteine (0.5 g/L), and maintained by weekly passage on horse blood agar (HBA) plates. T. forsythia was grown in tryptic soy broth, BHI (Oxoid, Hampshire, U.K.), yeast extract (Oxoid, Hampshire, U.K.), and vitamin K (0.4 μg/ mL) medium (TSBYK), plus N-acetylmuramic acid (NAM) (10 μg/mL) (Sigma Aldrich, MO, USA). Frozen bacterial stocks were prepared for each strain to use as the starting inoculum for each polymicrobial biofilm. Each strain was cultured as described above, adjusted with fresh medium to a cell density that gave an absorbance at a wavelength of 650 nm (A650) of 2.0, and dispensed into cryovials in 500 μL aliquots. The aliquots were then snap frozen in liquid nitrogen and stored at −70 °C. 2.2. Polymicrobial Biofilm Cultures

For the visualization of biofilm development, polymicrobial biofilms (PBFs) were cultured in a custom-made flow cell with a single channel (40 × 16 × 2 mm) covered by a standardsized, uncoated glass microscope coverslip (ProSciTech, Queensland, Australia), which served as the substratum for the biofilm. To ensure sterility, sodium hypochlorite (0.5% v/v) was pumped through the flow cell system for 2 h, followed by overnight rinsing with sterile ultrapure water to flush out the bleach. The flow cell system was then treated with pre-reduced 20% full strength OBGM for 2 h at 37 °C in an MG500 anaerobic workstation to lower the redox potential of the system and to condition the glass surface with medium. Snap frozen stocks of P. gingivalis, T. denticola, and T. forsythia were thawed at 37 °C and used as the inoculum. After inoculation, the system was incubated for 1 h prior to a constant flow (3 mL/h) of 20% OBGM. Glass coverslips with adherent biofilms were harvested 30 min and 24 and 90 h after the commencement of constant medium flow. The biofilms were rinsed with PBS to remove residual OBGM and unattached bacterial cells prior to fixation with 4% paraformaldehyde for 1 h at room temperature. After fixation, residual paraformaldehyde was flushed out with PBS. For in situ hybridization biofilms were embedded in 20% acrylamide with 0.02% ammonium persulfate and 0.8% N,N,N′,N′-tetramethylethylenediamine. The coverslips were removed, and biofilms were embedded in polymerized acrylamide slabs stored in PBS at 4 °C prior to hybridization. A 1 cm square was cut from the center of the polymerized acrylamide slab and subjected to fluorescent in situ hybridization (FISH). Species-specific probes B(T)AFO and POGI (CGTATCTCATTTTATTCCCCTGTA and CAATACTCGTATCGCCCGTTATTC) were used for the detection of T. 4450

dx.doi.org/10.1021/pr300201c | J. Proteome Res. 2012, 11, 4449−4464

Journal of Proteome Research

Article

forsythia and P. gingivalis, respectively.34 The group-specific probe TRE II (GCTCCTTTCCTCATTTACCTTTAT)35 was used for the detection of T. denticola. All FISH probes were synthesized commercially and 5′ end labeled with Alexa Fluor 488, Alexa Fluor 555, or Alexa Fluor 647. Probes were used at final concentrations of 3.3 μM in the presence of 10% formamide in the hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl, 0.01% SDS, pH 7.3). FISH was performed in a 4-well NunclonΔ Surface multidish (Thermo Scientific, NY, USA) at 46 °C. Hybridized biofilms were visualized on an Axiovert 200 M inverted microscope (Carl Zeiss, Germany) fitted with a Zeiss LSM 510 META Confocal scan head, using the 458/477/488 nm argon, 543 nm HeNe, and 633 nm HeNe laser lines. A 63x, 1.2-numerical aperture water immersion lens and a 10x, 0.45numerical aperture dry objective lens were used to record confocal image stacks in 10 random locations. The confocal data sets were analyzed with COMSTAT software to determine biometric parameters of the biofilm.36 Three-dimensional reconstructed images were produced using MetaMorph software (Molecular Devices, Sunnyvale, CA). For proteomic analyses polymicrobial biofilms were cultured in a custom-made fermentor system that consisted of four 10 cm glass tubes measuring 1 cm in diameter (33 cm2 internal surface area, 7.85 cm3 internal volume) connected to a four-way glass adapter with silicone tubing. Pre-reduced OBGM was delivered through this adapter into each tube (channel) by means of a four-channel, mini peristaltic pump (Watson Marlow, USA). A bubble trap (Stovall Life Sciences, NC, USA) was placed in line to prevent gas bubbles entering the glass tubes and disrupting biofilm formation. Spent medium was collected from each glass tube (channel) in a Teruflex transfer bag (Terumo Corporation, Tokyo, Japan). The whole system including medium reservoir and Teruflex transfer bags was located within a MG500 anaerobic workstation and the temperature was maintained at 37 °C. Two biological replicates, designated PBF1 and PBF2, were generated from this system. The fermentor was autoclaved in segments and assembled in the anaerobe chamber. Sodium hypochlorite (0.5% v/v) was delivered through the system at a rate of 1.6 mL/h for 24 h after assembly to ensure sterility prior to inoculation. Sterile ultrapure water was then used to flush out the bleach prior to media addition. OBGM was prepared at 20% full strength with respect to the following components: BHI, tryptone soya broth, yeast extract, asparagine, glucose, ascorbic acid, pyruvic acid, and rabbit serum. All other components were at full strength. Prior to autoclaving, 0.1 mg/mL resazurin (Sigma-Aldrich, MO, USA) was added to monitor the oxidation/reduction potential (Eh) over the course of the experiment. This indicator turned a bright raspberry color in the medium prior to autoclaving, then colorless following autoclaving, addition of supplements, and gassing. Resazurin becomes colorless when the redox potential of the media reaches −100 mV or less.37,38 Growth medium was incubated in the anaerobic workstation for at least 2 days prior to the start of each experiment. Snap frozen stocks of each strain were thawed at 37 °C and inoculated aseptically into the 20% OBGM-filled glass tubes through rubber septa fitted to the ends of each tube. This was incubated for 48 h as a batch culture to allow bacterial cell attachment to the inner walls of the glass tubes prior to OBGM addition at a constant flow rate of 3 mL/h/channel. The system was then incubated for a total of 12 days, and the anaerobic conditions and temperature were

monitored. Biofilms were harvested after unattached cells were washed off gently with 20% OBGM using a pipet. Biofilms cells were harvested by suspension in 5 mL of 20% OBGM and collected into separate tubes for each channel. A 200 μL sample was then taken from each tube for microscopic examination. The suspended biofilms from each channel were then pooled, and a 3 mL sample was collected for scanning electron microscopy (SEM) analysis prior to vortexing. After vortex mixing, five 200 μL samples for quantitative real-time PCR were collected. 2.3. Growth of Planktonic Cultures

P. gingivalis and T. denticola were grown separately as anaerobic continuous cultures in a Bioflo 110 Modular Benchtop Fermentor (New Brunswick Scientific, CT, USA) with OBGM as the growth medium. The starting volume was 600 mL, and growth was initiated by inoculating the culture vessel with a 300 mL, 24 h batch culture of either P. gingivalis or T. denticola grown in OBGM, resulting in a final working volume of 900 mL. The culture vessel was continuously gassed with a N2/CO2 (95:5) mixture. After 24 h of batch culture growth OBGM at a constant flow rate of 40 mL/h was added to the culture vessel giving a dilution rate, D, of 0.04 (h−1), equivalent to a mean generation time (MGT) of 17.3 h. The culture was subjected to low agitation (50 rpm), and the temperature was maintained at 37 °C. The purity of the culture was determined by Gram stain. At steady state, after 10 MGTs, the consecutive daily optical density (A650) readings using a spectrophotometer (Novaspec III, GE Healthcare, NJ, USA) varied by less than 5% (data not shown). The cell density of the cultures (y) was calculated according to the equation derived from the relationship between the A650 and cell number determined by DNA quantitation and flow cytometry for T. denticola such that y = [3 × 109(A650)] + (9 × 107 cells/mL)33 and for P. gingivalis as follows: y = [2 × 109(A650)] + (2 × 106 cells/mL). 2.4. Scanning Electron Microscopy

Coverslips were prepared by smearing 22 mm2 glass coverslips with a 0.1% solution of polyethyleneimine (PEI) and dried by heating under a flame. The harvested PBF sample was incubated on PEI-coated glass coverslips for 1 h. Following incubation the excess sample was drained, and coverslips with adhered cells were immersed in 2.5% glutaraldehyde in PBS for 1 h. The coverslips were rinsed three times in PBS for 10 min each, before being dehydrated in increasing concentrations of ethanol consisting of 10%, 30%, 50%, 70%, 90%, and 100% ethanol in water for 10 min each step. The coverslips were dried in a Balzers critical point dryer (Balzers, Liechtenstein, Germany) and mounted onto 25 mm aluminum stubs with double-sided carbon tabs. The edges of the coverslips were dagged with silver liquid, dried, and then gold-coated in an Edwards S150B sputter coater (Edwards High Vacuum, Crawley, West Sussex, U.K.). The cells on coverslips were imaged with a Philips XL30 field-emission scanning electron microscope (Philips, Eindhoven, Netherlands) at a voltage of 2 kV. 2.5. Enumeration of Biofilm Cells by Quantitative Real-Time PCR

Polymicrobial biofilm samples of 200 μL were centrifuged (5724g, 10 min), and pellets were stored at −30 °C. DNA extractions were performed using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Australia). The biofilm samples were diluted 1 in 50 prior to DNA extraction. Each sample was then 4451

dx.doi.org/10.1021/pr300201c | J. Proteome Res. 2012, 11, 4449−4464

Journal of Proteome Research

Article

were eluted using a linear gradient of 0−40% buffer B followed by 40−100% buffer B for 5 min at a flow rate of 2 μL/min directly into an HCTultra ion trap mass spectrometer via a 50 μm ESI needle (Bruker Daltonics, Bremen, Germany). The ion trap was operated in the positive ion mode at an MS scan speed of 8100 m/z/s over an m/z range of 200−2500 and a fast Ultra Scan of 26,000 m/z/s for MS/MS analysis over an m/z range of 100−2800. The drying gas (N2) was set to 5 L/min and 300 °C. The peptides were fragmented using auto-MS/MS with the SmartFrag option on up to 5 precursor ions between m/z 400− 1200 for each MS scan. Proteins were identified by MS/MS Ion Search using Mascot software v2.3. Search parameters were as follows: database = P. gingivalis, T.denticola & T. forsythia (as described in Section 2.11), enzyme = trypsin, MS tolerance = 1.5 Da, MS/MS tolerance = 0.5 Da, missed cleavages = 1, fixed modifications = carbamidomethyl (Cys), optional modifications = oxidation (Met). The number of proteins identified for each species was used as an estimate of their protein content.

subjected to real-time PCR amplification using the Platinum SYBR Green qPCR Super-Mix-UDG detection kit (Invitrogen, Melbourne, Australia) and a Corbett Rotor-Gene 3000 Real Time Thermal Cycler (Corbett Research, Sydney, Australia). Primers used targeted the 16S rRNA gene and have been described previously.39 All reactions were carried out in triplicate in a 25 μL reaction volume as previously described.13 Quantification of each bacterial strain was determined using the Corbett Rotor Gene 6 software program and a set of standards for each strain. 2.6. Whole Cell Lysate Preparation

All bacterial cell manipulations were carried out on ice or at 4 °C. Planktonic and biofilm cell samples were washed 3 times at 7000g with PGA buffer,40 resuspended in 50 mM Tris-HCl, 150 mM NaCl, 5 mM MgCl2, pH 8.0 to a final volume of 15 mL, snap frozen, and stored at −80 °C until further use. The frozen washed cells were thawed and disrupted by 5 passages through a French Press Pressure Cell (Thermo Scientific, NY, USA) at 138 MPa. N-α-Tosyl-lysine-chloromethylketone (TLCK) (Sigma-Aldrich, MO, USA) was added to a final concentration of 2 mM prior, during, and after the lysing process. After microscopic inspection using Gram stain to ensure lysis, cell debris and unbroken cells were removed by centrifugation (2000g, 30 min, 4 °C.) The supernatant was carefully transferred to a fresh tube, concentrated by freeze-drying, resuspended in ultrapure water to 1/10 of the original volume, and used immediately for further analyses or snap-frozen and stored at −80 °C until further use.

2.9. In-Gel Digestion and H216O/H218O Labeling

The gel lanes were divided into 15 gel bands of equal sizes using a custom-made stencil, with each band cut into approximately 1 mm3 cubes. Destaining was carried out in 50 mM NH4HCO3/ACN (1:1), with several changes of the solution until the gel cubes became clear. After destaining, the gel cubes were dehydrated with 100% ACN, followed by rehydration/reduction with 10 mM dithiothreitol in 50 mM ammonium bicarbonate (ABC) buffer at 56 °C for 1 h. The excess solution was removed before the addition of 55 mM iodoacetamide in 50 mM ABC buffer for 30 min at RT in the dark to allow the alkylation reaction. The gel cubes were washed 3 times, 15 min each in 50 mM ABC buffer, followed by dehydration twice in 100% ACN for 10 min. The gel cubes were further dried under centrifugation for 60 min. The gel cubes from each excised band were rehydrated with 150 μL of trypsin buffer solution containing excess (2 μg) sequencing grade modified bovine trypsin (Roche, IN, USA) in 25 mM ABC buffer made up in either H216O or H218O (97% purity, Marshall Isotopes, Tuvia, Israel). In order to promote the complete incorporation of two 18O atoms into the carboxyl terminus of tryptic peptides, protein hydrolysis was allowed to take place for 16−18 h at pH 8 at 37 °C, after which the digestion mixtures were acidified to pH 6 by the addition of 4 μL of 1 M acetic acid and incubated for a further 6−8 h.43 The trypsin activity was quenched by immediately boiling the samples for 10 min. Sequential extraction of the peptides, aided by sonication for 5 min each, was carried out using the following extraction buffers (150 μL per excised band) prepared in ultrapure water: 50% ACN/2.5% TFA; 10% ACN/0.1% TFA; 70% ACN/0.1% TFA. The pooled extract was freeze-dried for 24 h, and the dried extract was then stored at −20 °C until further use.

2.7. Sample Preparation for SDS-PAGE

Determination of the protein concentration of whole cell lysates was carried out using the 2-D Quant Kit (GE Healthcare NJ, USA) according to the manufacturer’s protocol. The samples were subjected to precipitation with trichloroacetic acid (16% v/v), followed by washing with ice-cold acetone to inactivate any proteolytic activity of the endogenous enzymes as well as to remove salts. The samples were then resuspended in 1X NuPAGE LDS sample buffer (Invitrogen, Melbourne, Australia) containing 50 mM dithiothreitol, aided by sonication and vortexing, and heated at 70 °C for 10 min prior to loading onto a precast 10-well NuPAGE Novex 10% Bis-Tris gel with NuPAGE 3-(N-morpholino) propanesulfonic acid (MOPS) running buffer (Invitrogen, Melbourne, Australia). SDS-PAGE was then carried out at 120 V until the dye front was approximately 1 cm from the bottom of the gel. Staining was carried out overnight in colloidal Coomassie Brilliant Blue G250,41 followed by destaining with ultrapure water until a clear background was achieved. 2.8. Protein Analysis by LC−MS/MS

The species-specific protein content of the biofilm and mixed planktonic cultures was determined by LC−MS/MS. Gel lanes were divided into 10 equal segments and digested with trypsin.42 Tryptic digests were acidified with TFA to 0.1% before online LC−MS/MS analyses. An UltiMate 3000 system (Dionex, Sydney, Australia) was used with a precolumn of PepMap C18, 300 mm i.d. × 5 mm (Dionex, Sydney, Australia) and an analytical column of PepMap C18, 180 mm i.d. × 15 cm (Dionex, Sydney, Australia). Buffer A was 2% (v/v) acetonitrile, 98% H2O, 0.1% (v/v) formic acid, and buffer B was 98% (v/v) acetonitrile, 2% H2O, 0.1% (v/v) formic acid. Digested peptides (20 μL) were initially loaded and desalted onto the precolumn in buffer A at a flow rate of 30 μL/min for 5 min. The peptides

2.10. LC−MALDI-TOF/TOF

For the separation and analyses of the labeled samples, the freeze-dried peptides were resuspended in a solution of 0.1% TFA in H216O and combined in a 1:1 ratio just before analysis. Fifty microliters of the combined samples was manually loaded onto an UltiMate Nano LC system (Dionex, Sydney, Australia).The samples were first loaded onto a precolumn (C18 PepMap100, 300 μm i.d. × 5 mm, 5 μm, 100 Å, LC Packings) and washed at 30 μL/min for 10 min in Buffer A (2% ACN/0.1% TFA). Chromatographic separation was carried out using a reversed phase analytical column (C18 PepMap100, 4452

dx.doi.org/10.1021/pr300201c | J. Proteome Res. 2012, 11, 4449−4464

Journal of Proteome Research

Article

300 μm i.d. × 15 cm, 5 μm, 100 Å, Dionex, Sydney, Australia) with a flow rate of 6 μL/min, and gradient elution of the samples was performed using a buffer system comprising Buffer A and Buffer B (80% ACN/0.1% TFA). The gradient was as follows: 0−10 min (0% B), 10−15 min (0−10% B), 15−65 min (10−50% B), 65−70 min (50−100% B), 70−75 (100% B). Eluents were cospotted with matrix buffer (12 μL/min) containing 1 part of matrix solution (CHCA saturated in 97% acetone/3% of 0.1%TFA) in 9 parts of ethanol:acetone:10 mM (NH4)3PO4 /0.1% TFA mixed in 6:3:1 ratio. The spotting was performed using the Proteineer fc robot (Bruker Daltonics, Bremen, Germany) onto a polished steel 384-position MALDI target plate (Bruker Daltonics, Bremen, Germany) at 12 s intervals. Both the LC separation and robot spotting were under the control of HyStar software version 3.2 (Bruker Daltonics, Bremen, Germany). The plate was air-dried before being subjected to automated analysis by MALDI TOF/TOF, using an ultraflex III TOF/TOF (Bruker Daltonics, Bremen, Germany). Peptide Calibration Standard II (Bradykinin 1−7, Angiotensin II, Angiotensin I, Substance P, Bombesin, Renin Substrate, ACTH 1−17, ACTH 18−39, ACTH 1−24, Insulin b-chain; Bruker Daltonics, Bremen, Germany) was used as the external calibrant, spotted in the middle of each set of eight sample spots. MS analyses were performed in positive reflectron mode measuring from 700−4000 Da using an accelerating voltage of 25 kV. All MS spectra were produced from 6 sets of 100 laser shots. The spectra acquisition in both MS mode and MS/MS (LIFT) mode for MALDI-TOF/TOF was carried out in a fully automated mode using flexControl version 3.0 and WARP-LC version 1.2 software. In LIFT mode, all ions were accelerated to 8 kV and “lifted” to 19 kV in the LIFT cell and all MS/MS spectra were produced from accumulating 4200 consecutive laser shots. Early termination of the MS and MS/MS mode acquisitions was achieved if a S/N value of 30 for a single peak (MS mode) or 10 peaks (MS/MS mode) was reached. The precursor ion selection was carried out using WARP-LC version 1.2 with the customized LC−MALDI SILE (Stable Isotope Labeling Experiment) workflow. The most intense peak separated by 5 Da was selected for MS/MS measurements. The S/N threshold for the paired peaks was 8, whereas for the singlet it was 10. Compounds separated by less than four LC−MALDI fractions (48 s) were merged and selected only once.

equal composition and size. The matched peptides for a protein were accepted using the following criteria: (A) For identification, it was by two or more peptides with a Mascot score ≥20, and the protein score above the p-value