Direct Optical Detection of Aptamer Conformational Changes Induced

Nov 23, 2009 - Direct Optical Detection of Aptamer Conformational Changes Induced by Target Molecules ... Phone: (713) 348-5612. Fax: (713) 348-5686...
0 downloads 0 Views 971KB Size
Download PDF
Anal. Chem. 2009, 81, 10002–10006

Direct Optical Detection of Aptamer Conformational Changes Induced by Target Molecules Oara Neumann,†,‡ Dongmao Zhang,§ Felicia Tam,| Surbhi Lal,†,‡ Pernilla Wittung-Stafshede,⊥ and Naomi J. Halas*,†,‡,# Department of Electrical and Computer Engineering, Department of Chemistry, and Laboratory for Nanophotonics, Rice University, 6100 Main Street, Houston, Texas 77005, Department of Chemistry, Mississippi State University, Mississippi State, Mississippi 39762, Oxonica Materials, Inc., Mountain View, California 94043-4003, and Department of Chemistry, Umeå University, 901 87 Umeå, Sweden Aptamers are single-stranded DNA/RNA oligomers that fold into three-dimensional conformations in the presence of specific molecular targets. Surface-enhanced Raman spectroscopy (SERS) of thiol-bound DNA aptamer selfassembled monolayers on Au nanoshell surfaces provides a direct, label-free detection method for the interaction of DNA aptamers with target molecules. A spectral crosscorrelation function, Γ, is shown to be a useful metric to quantify complex changes in the SERS spectra resulting from conformational changes in the aptamer induced by target analytes. While the pristine, unexposed anti-PDGF (PDGF ) platelet-derived growth factor) aptamer yields highly reproducible spectra with Γ ) 0.91 ( 0.01, following incubation with PDGF, the reproducibility of the SERS spectra is dramatically reduced, yielding Γ )0.67 ( 0.02. This approach also allows us to discriminate the response of a cocaine aptamer to its target from its weaker response to nonspecific analyte molecules. Aptamers are nucleic acid macromolecules of single-stranded DNA or RNA that can fold into three-dimensional complexes upon interaction with other molecules, providing preferential binding sites for molecular recognition of analytes.1-3 Single-stranded DNA typically possesses a complex secondary structure due to many intramolecular base pairing opportunities,4,5 which imparts increased stability to the folded complex. This provides a binding affinity in the picomolar to nanomolar range for highly target dependent aptamer-large molecule complexes, and in the mi* Corresponding author. Phone: (713) 348-5612. Fax: (713) 348-5686. E-mail: [email protected]. † Department of Electrical and Computer Engineering, Rice University. ‡ Laboratory for Nanophotonics, Rice University. § Mississippi State University. | Oxonica Materials, Inc. ⊥ Umeå University. # Department of Chemistry, Rice University. (1) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818–822. (2) Robertson, D. L.; Joyce, G. F. Nature 1990, 344, 467–468. (3) Tuerk, C.; Gold, L. Science 1990, 249, 505–510. (4) Bloomfield, V. A.; Crothers, D. M.; I. Tinoco, J. Nucleic Acids Research; University Science Books: Sausalito, CA, 2000. (5) Zhang, Y.; Zhou, H.; Ou-Yang, Z.-C. Biophys. J. 2001, 81, 1133–1143.

10002

Analytical Chemistry, Vol. 81, No. 24, December 15, 2009

cromolar range for complexes formed with small molecules.6-11 While numerous aptamer-based detection methods have been reported,8-10,12-22 these techniques typically require complex labeling and sample preparation. The goal of direct optical detection of aptamer-target binding remains a key analytical challenge. In the past several years, interest in surface-enhanced Raman spectroscopy (SERS) for chemical detection has increased dramatically. SERS exploits the intense, localized optical fields at metal surfaces and junctions due to surface plasmons to probe substrate-adsorbed molecules spectroscopically. Substrates with a strong plasmon excitation near the pump laser wavelength and a plasmon bandwidth sufficient to excite strong local fields at the Stokes frequencies of the adsorbate provide strong SERS enhancements.23,24 While substrates with large field enhancements over nanoscale volumes may be most appropriate for (6) Floege, J.; Ostendorf, T.; Janssen, U.; Burg, M.; Radeke, H. H.; Vargeese, C.; Gill, S. C.; Green, L. S.; Janjic’, N. Am. J. Pathol. 1999, 154, 169–179. (7) Stojanovic, M. N.; Prada, P. d.; Landry, D. W. J. Am. Chem. Soc. 2001, 123, 4928–4931. (8) Lai, R. Y.; Plaxco, K. W.; Heeger, A. J. Anal. Chem. 2007, 78, 229–233. (9) Huang, C. C.; Huang, Y. F.; Cao, Z.; Tan, W.; Chang, H. T. Anal. Chem. 2005, 77, 5735–5741. (10) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. J. Am. Chem. Soc. 2006, 128, 3138–3139. (11) Hermann, T.; Patel, D. J. Science 2000, 287, 820–825. (12) Huang, C. C.; Chiu, S. H.; Huang, Y. F.; Chang, H. T. Anal. Chem. 2007, 79, 4798–4804. (13) Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan, W. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 17279–17283. (14) Hong, F.; Jung, M. C.; Meng, R.; Zhao, H.; Weber, S. G. TrAC, Trends Anal. Chem. 2004, 23, xiii–xvi. (15) Liu, J.; Lu, Y. Angew. Chem., Int. Ed. 2006, 45, 90–94. (16) Stojanovic, M. N.; Landry, D. W. J. Am. Chem. Soc. 2002, 124, 9678–9679. (17) Fredriksson, S.; Gullberg, M.; Jarvius, J.; Olsson, C.; Pietras, K.; Gu´stafsdo´ttir, S. M.; o ¨stman, A.; Landegren, U. Nat. Biotechnol. 2002, 20, 473– 477. (18) Fang, X.; Sen, A.; Vicens, M.; Tan, W. ChemBioChem 2003, 4, 829–834. (19) Fang, X.; Cao, Z.; Beck, T.; Tan, W. Anal. Chem. 2001, 73, 5752–5757. (20) Zhao, J.; Zhang, X.; Yonzon, C.; Haes, A. J.; Duyne, R. P. V. Nanomedicine 2006, 1, 219–228. (21) Braun, G.; Lee, S. J.; Dante, M.; Nguyen, T. Q.; Moskovits, M.; Reich, N. J. Am. Chem. Soc. 2007, 129, 6378–6379. (22) Shanmukh, S.; Jones, L.; Driskell, J.; Zhao, Y.; Dluhy, R.; Tripp, R. Nano Lett. 2006, 6, 2630–2636. (23) Camden, J. P.; Dieringer, J. A.; Zhao, J.; Van Duyne, R. P. Acc. Chem. Res. 2008, 41, 1653–1661. (24) Jackson, J. B.; Halas, N. J. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 17930– 17935. 10.1021/ac901849k  2009 American Chemical Society Published on Web 11/23/2009

Scheme 1. Schematic of Aptamer SAM SERS-Based Analyte Detectiona

a Aptamers whose secondary structure is essentially eliminated by thermal treatment form SAMs on nanoshell substrates. Conformational changes in the aptamers induced by target molecule interaction are monitored by SERS.

single-molecule SERS,25,26 substrates with strong yet highly regular enhanced fields over a larger sensing volume are more practical for many sensing applications. SERS substrates such as nanoshells and film-over-nanoparticle geometries provide this latter type of electromagnetic nanoenvironment: the usefulness of these types of SERS substrates has been documented extensively.23,27 Nanoshell-based SERS substrates have shown excellent spotto-spot and sample-to-sample spectral reproducibility.27,28 Changes in the molecular conformation of adsorbate molecules will typically result in changes in the SERS spectrum of that adsorbate. Therefore, SERS provides an optical method to detect changes in the conformation of adsorbate molecules. Since DNA aptamers respond to their target molecules by changing conformation, aptamer-target interactions should be detectable using SERS. This approach to detecting aptamer-target binding is direct and label-free, requiring only that the aptamer be thiolated on one terminus so it is stationary on the SERS substrate (Scheme 1). We have previously shown that the SERS spectrum of a thiolated DNA oligomer self-assembled monolayer (SAM) on Au nanoshell SERS substrates has a characteristic, highly reproducible SERS spectrum dominated by adenine and guanine and largely independent of the base sequence.28,29 Changes in the conformation of the aptamer molecules in the SAM upon exposure to analyte molecules induce complex, random changes in the SERS spectrum. This randomization of the aptamer SAM due to interactions with the target molecules can be quantified by obtaining several SERS spectra and calculating the pairwise spectral correlation function, Γ, before, then after, exposure to the target analyte.28 The pairwise spectral correlation function is calculated using m n

Γ)

∑ ∑ Pi,j

i)1j)1

mn

(1)

(25) Michaels, A. M.; Jiang, J.; Brus, L. E. J. Phys. Chem. B 2000, 104, 11965– 11971. (26) Ward, D. R.; Halas, N. J.; Ciszek, J. W.; Tour, J. M.; Wu, Y.; Nordlander, P.; Natelson, D. Nano Lett. 2008, 8, 919–924. (27) Lal, S.; Grady, N. K.; Kundu, J.; Levin, C. S.; Halas, N. J. Chem. Soc. Rev. 2008, 37, 898–911. (28) Barhoumi, A.; Zhang, D.; Tam, F.; Halas, N. J. J. Am. Chem. Soc. 2008, 130, 5523–5529. (29) Barhoumi, A.; Zhang, D.; Halas, N. J. J. Am. Chem. Soc. 2008, 130, 14040– 14041.

where i and j are the matrix column vectors (spectral intensities) to be analyzed and m and n are the total number of spectra analyzed. The correlation coefficient between all nonidentical spectral pairs (i * j) in the same data set is determined by W

Pi,j )

∑ (Ii(k) - ¯I i)(Ij(k) - ¯I j)

k)1

σiσj

(2)

where W is the spectral range, σi is the standard deviation of the ith row, and I is the spectral intensity. Simply put, the correlation function Γ measures the degree of randomness introduced into the SERS spectrum by the ensemble aptamertarget molecule interactions: for identical, unchanging spectra, Γ ) 1.0, and for completely randomized spectra, Γ ) 0. Determining Γ before, then after, exposure of the aptamer to the target molecule assesses the degree of conformation change induced in the ensemble of aptamer molecule adsorbates by the target molecules. With this approach we observe changes in the SERS spectrum for thiolated aptamer SAMs specific to a protein, platelet-derived growth factor (PDGF-BB), and a small molecule analyte, cocaine. These aptamers were chosen to allow us to examine two distinct detection regimes: high-specificity detection of biomolecules and lower specificity detection of small molecules. For both cases, aptamer SAM-target molecule interactions were compared to interactions with nonspecific control molecules. Our SERS studies were correlated with circular dichroism (CD) spectroscopy, a method used extensively to study and characterize conformational structures of biomolecules.30-32 CD spectroscopy of the anti-PDGF and the anticocaine DNA aptamers before and after exposure to analyte provided independent confirmation that the SERS spectra areindeeddetectingconformationalchangesduetoaptamer-analyte molecule interactions. EXPERIMENTAL SECTION Materials. ss-DNA oligonucleotides and Tris-EDTA buffer (TE), pH 7.5, were purchased from Integrated DNA Technologies (IDT) and were employed without further purification. In our (30) Saenger, W.; Hunter, W. N.; Kennard, O. Nature 1986, 324, 385–388. (31) Johnson, N. P.; Baase, W. A.; Hippel, P. H. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 3426–3431. (32) Mukerji, I.; Williams, A. P. Biochemistry 2002, 41, 69–77.

Analytical Chemistry, Vol. 81, No. 24, December 15, 2009

10003

study we used two kinds of aptamers: anticocaine aptamer HSC6H12-5′AGACAAGGAAAATCCTTCAATGAAGTGGGTCG3′ and anti-PDGF aptamer HS-C6H12-5′CAGGCTACGGCACGTAGAGCATCACCATGATCCTG3′. Recombinant human PDGF-BB (PDGF) was purchased from Sigma-Aldrich. DTT (1,4-dithioDL-threitol; 1 M solution), cocaine, benzocaine, and caffeine were purchased from Sigma-Aldrich and employed without further purification. NaCl (Sigma-Aldrich) and K2HPO4 · 3H2O (Sigma-Aldrich) were used to prepare buffer solutions. The concentration of ss-DNA stock solutions was determined by UV spectroscopy at 260 nm at room temperature using a Cary 5000 UV-vis spectrophotometer. Substrate Preparation. Nanoshells were prepared as reported previously.33 Cleaned quartz slides were modified with poly(4-vinylpyridine) (PVP) to facilitate subsequent attachment of a dispersed submonolayer of nanoshells on the quartz surface.34 Au-silica nanoshells were fabricated with the core and shell radii r1, r2 ) 63, 75 nm, respectively, corresponding to a nanoshell plasmon resonance of 785 nm (Raman laser wavelength) in H2O (the absorption spectrum of nanoshells in water is presented in Figure S4, Supporting Information). The nanoshells were immobilized on the quartz substrates by depositing 100 µL of nanoshell solution onto the substrate, incubating overnight, and then removing the excess nanoshells by rinsing with water (the absorption spectra and SEM image of nanoshells used in SERS measurements are presented in Figures S1 and S2, Supporting Information). Thiolated ss-DNA aptamers were first treated with 100 mM reducing agent 1,4-dithio-DL-threitol solution for 1 h to allow for the complete reduction of disulfide bonds in solution. To prepare the aptamers for attachment to the SERS substrates, they were thermally treated by heating for 5 min at 100 °C in TE buffer followed by rapid cooling with an ice bath. RESULTS AND DISCUSSION Freshly prepared nanoshell SERS substrates were then incubated with the thermally treated aptamer solution (100 µM) overnight at room temperature and with high humidity. SERS spectra of the DNA aptamer SAMs on the nanoshell SERS substrates were acquired in a Renishaw inVia Raman microscope at a laser intensity of 55 µW. A 63× immersion lens (Leica, Germany) was used to collect high-resolution Raman spectra of hydrated aptamers with a 40 s integration time. After overnight incubation with the target molecules, changes to the Raman spectra were quantified. Spectra acquired using the highly specific anti-PDGF aptamer SAM are shown in Figure 1. Prior to the introduction of the target molecules, the anti-PDGF aptamer SAMs yield highly reproducible spectra with Γ ) 0.91 ± 0.01 (Figure 1, spectra i). This high degree of reproducibility is due to the thermal pretreatment of the aptamer, which relaxes the ss-DNA aptamer molecules into an extended conformation prior to SAM formation on the nanoshell surfaces.28 The spectra of the DNA aptamer modified SAM are dominated by the adenine ring breathing mode at 735 cm-1. SERS spectral reproducibility was dramatically changed as target molecules were introduced (33) Oldenberg, S. J.; Averitt, R. D.; Westcott, S. L.; Halas, N. J. Chem. Phys. Lett. 1998, 288, 243–247. (34) Malynych, S.; Luzinov, I.; Chumanov, G. J. Phys. Chem. B 2002, 106, 1280– 1285.

10004

Analytical Chemistry, Vol. 81, No. 24, December 15, 2009

Figure 1. SERS spectra of the anti-PDGF aptamer SAM (i) prior to exposure to PDGF, (ii) following PDGF exposure, and (iii) following lysosyme exposure (a control protein). Inset: Γ values for the DNA aptamer SAM-PDGF and -lysozyme interactions. Error bars represent the standard deviation.

into the system. Upon PDGF-BB incubation, the target protein modifies the secondary structure of aptamer molecules. In solution, this is performed by adopting a loop-step structure characteristic of aptamers.6,19,35 Because the aptamer conformation has been modulated by the target molecules, due to differences in the orientation of the folded bound complexes, the reproducibility of the SERS spectra from these substrates is dramatically reduced (Γ ) 0.67 ± 0.02) as is demonstrated in Figure 1, spectra ii. In contrast, when the anti-PDGF aptamer SAMs on nanoshells are incubated with lysozyme, a control protein, no changes in the spectral reproducibility are observed, an observation consistent with the known high specificity of the anti-PDGF aptamer for its target molecule. It is interesting to note that the SERS spectra of the anti-PDGF aptamer SAMs are modified quite dramatically by interaction with PDGF-BB for the 1 µM PDGF-BB concentrations used, despite the fact that the ability of the target analyte molecules to access and induce conformational changes in the aptamer SAM molecules is likely to be hindered by steric and chemical factors.6 Some aptamers possess very high affinity and selectivity for their targets, with dissociation constants (Kd) comparable to or surpassing those of some monoclonal antibodies.36 The Kd constant of an aptamer with its target can range from 0.04 pM (i.e., anti-PDGF) to 10 µM (i.e., anticocaine), with the majority falling in the low nanomolar range.10,16,37 Nanoshell-based SERS substrates can in fact be used to assess the specificity of an aptamer for its particular target. The specificity of the anticocaine aptamer SAM was studied by comparing the variation of the aptamer SAM SERS spectra upon interaction with target and nontarget molecules (Figure 2). As in the case of anti-PDGF, the anticocaine aptamer SAMs exhibit highly reproducible SERS spectra, Γ ) 0.93 ± 0.03, prior to exposure to their target molecules, due directly to the high degree (35) Green, L. S.; Jellinek, D.; Jenison, R.; o ¨stman, A.; Heldin, C.-H.; Janjic, N. Biochemistry 1996, 35, 14413–14424. (36) Balamurugan, S.; Obubuafo, A.; Soper, S. A.; McCarley, R. L.; Spivak, D. A. Langmuir 2006, 22, 6446–6453. (37) Gold, L.; Brody, E.; Heilig, J.; Singer, B. Chem. Biol. 2002, 9, 1259–1264.

Figure 3. CD spectra of the (A) anti-PDGF aptamer and (B) anticocaine aptamer showing a structural transition from a folding state (red) or hairpin state (blue) to an extended single-stranded state (black).

Figure 2. SERS spectra of the anticocaine aptamer (i) alone, (ii) with cocaine, (iii) with benzocaine, and (iv) with caffeine. Inset: crosscorrelation SERS spectra demonstrate that different target bindings induce spectral variation by reinducing the hairpin structure of the aptamer. Error bars represent 1 standard deviation.

of uniformity of the ss-DNA aptamer modified SAM. Incubation with cocaine (20 µM) induces conformational changes in the aptamer, with an increase in variability in the SERS spectra resulting in a decrease in Γ to 0.57 ± 0.04. In this case, however, nonspecific molecules were also able to induce conformational changes in the aptamer SAM. When the aptamer SAMs were incubated with benzocaine or caffeine (100 µM) for the same length of time as the cocaine aptamer, the spectral correlation function Γ decreased to 0.68 ± 0.02 and 0.76 ± 0.05, respectively. The decrease in Γ for both benzocaine and caffeine is easily observable, indicating some conformational response of the anticocaine aptamer to these molecules, although it is clearly not as pronounced as the decrease induced by the cocaine target molecule. This effect is likely due to the presence of three nonspecific base pairs in the folded state of the anticocaine aptamer, which can confer some stability to the binding of nontarget molecules. This type of measurement may provide a method for assessing the degree of specificity of an aptamer for its target. Conversely, since the Γ values for each target analyte are distinct and reproducible, this limited degree of specificity may in fact be advantageous and may lead to new optics-based strategies for the identification of multiple targets by a single aptamer where aptamer-target specificity is inherently limited. To understand the correlation between the conformational changes of aptamers in solution observed by CD and the conformational changes observed in SAM aptamers used in the SERS studies, control experiments were performed. The SERS spectra of random ss-DNA sequences alone and incubated with target molecules were obtained (Figure S3, Supporting Information). As the target molecule we chose benzocaine because it has an inherent strong SERS signal. As expected, after overnight incubation with benzocaine, no conformational changes in the randomly chosen DNA sequences were observed (confirmed by Γ ) 0.9968 ± 0.01 for ss-DNA alone and Γ ) 0.9889 ± 0.03 for ss-DNA with benzocaine). The SERS spectra of random ss-DNA incubated with benzocaine does not exhibit any peaks from

benzocaine (Figure S3, Supporting Information). This leads us to conclude that benzocaine does not bind to the DNA (and is thus not close to the surface) to produce an SERS signal. To confirm that the changes in the SERS spectra observed in the presence of target molecules resulted from changes in the molecular conformation of the aptamer molecules, CD spectroscopy was performed in correlation with the SERS experiments. CD spectroscopy has been valuable for studying the secondary structure of biomolecules, including aptamers, and for detection of aptamer-target interactions.30-32 CD spectra were acquired in TE buffer (pH 7.5) using DNA concentrations of 5 µM in a 1 cm path length quartz cell. Measurements were made using a Jasco J-810 spectropolarimeter equipped with a Peltier-type temperature control system for wavelengths ranging from 200 to 350 nm. Thermal unfolding and folding curves were obtained by monitoring the decrease in ellipticity with temperature in the desired wavelength range. The temperature was varied between 5 and 100 °C after an equilibration time of 300 s at a heating rate of 2 °C/min. The CD spectra of the anti-PDGF and anticocaine aptamers before and after thermal treatment and target introduction are shown in Figure 3. The aptamer CD spectrum is characterized by two positive-going features at 272 and 217 nm and a negativegoing feature at 244 nm. Prior to thermal treatment the CD spectrum showed a high CD intensity at 270 nm, indicating a high hairpin content of the aptamers in their natively folded state (red curve). Thermal treatment then destroys this secondary structure, as indicated by the decrease in the 270 nm peak for both aptamers (black curve). Introduction of the target molecules to these thermally treated aptamers causes the 270 nm peak to increase in intensity again, indicating that the target molecules have induced a refolding of the aptamers to their hairpin-conformational state (blue curve). The high stability of the anti-PDGF aptamerPDGF complex stabilizes the secondary structure formed by this interaction and restores the 270 nm spectral feature to its original level prior to thermal treatment. The increase in PDGF-BB concentration shown by the CD signal of the anti-PDGF aptamer in solution and the linear relationship of the ellipticity of the antiPDGF aptamer at 218 nm with low PDGF-BB concentrations is presented in Figure S4 of the Supporting Information. Thermal reversibility of the conformational changes of the aptamer in solution was tested by performing many cycles of thermal measurements between 5 and 95 °C (Figure S5, Supporting Information). Considering the aptamer-PDGF complex formation as a reversible reaction, any disturbance in aptamer concentration will slightly displace the system from its equilibrium condition. Analytical Chemistry, Vol. 81, No. 24, December 15, 2009

10005

The data suggest that the aptamer was not destroyed during the heating process and would be expected to return to its initial conformation if the perturbation were removed. The melting CD spectrum of the anticocaine aptamer, which shows structural transitions from the hairpin state to the single-stranded state, is shown in Figure S6 of the Supporting Information. These CD results confirm independently that thermal treatment eliminates the secondary structure of the aptamers and that interaction with target molecules induces aptamer refolding, entirely consistent with our SERS results. In conclusion, we have demonstrated a direct, label-free, optical method for monitoring the binding of an aptamer to its target. Interaction of target molecules with aptamer SAMs induces conformational modifications in the aptamer molecules, monitored by assessing the aptamer SERS spectral reproducibility. CD spectroscopy independently supports our observations that changes to the reproducibility of the SERS spectra are a result of conformational changes to the aptamer induced by target binding.

under Grant W911NF-04-01-0203, and Robert A. Welch Foundation Grant C-1220. We thank Prof. K. W. Plaxco and R. J. Brian (Ph.D.) for helpful discussions and Dr. Bruce Brinson for help with the SEM measurements.

ACKNOWLEDGMENT This work was supported by Air Force Office of Scientific Research Grant FA 9550-06-1-0021, the Army Research Office

Received for review August 16, 2009. Accepted November 9, 2009.

10006

Analytical Chemistry, Vol. 81, No. 24, December 15, 2009

SUPPORTING INFORMATION AVAILABLE Absorption spectrum of nanoshells in water, SEM image of nanoshells used in SERS measurements, CD spectra of the antiPDGF aptamer as a function of the PDGF-BB concentration, melting curves of the anti-PDGF aptamer with target and nontarget proteins, temperature-dependent CD spectra of the anticocaine aptamer in folding and unfolding states, average SERS spectra of the anticocaine aptamer and random ss-DNA alone, with benzocaine, and benzocaine, and corresponding Γ values. This material is available free of charge via the Internet at http://pubs.acs.org.

AC901849K