Directed Covalent Immobilization of Aminated DNA Probes on

Biomacromolecules 2004, 5, 883-888

883

Directed Covalent Immobilization of Aminated DNA Probes on Aminated Plates Manuel Fuentes,† Cesar Mateo,† Lucia Garcı´a,‡ Juan C. Tercero,‡ Jose´ M. Guisa´ n,*,† and Roberto Ferna´ ndez-Lafuente*,† Laboratorio de Tecnologı´a Enzima´ tica, Departamento de Biocata´ lisis, Instituto de Cata´ lisis y Petroleoquı´mica-CSIC, Campus UAM, Cantoblanco, 28049 Madrid, Spain, and Genomica S.A.U., Pol. Industrial Coslada, Coslada, 28820 Madrid, Spain Received October 6, 2003; Revised Manuscript Received January 20, 2004

A new protocol that enables the immobilization of DNA probes on aminated micro-titer plates activated with aldehyde-dextran via an amino group artificially introduced in the 3′ end of the oligonucleotide probe is reported in this work. The method is based on the use of hetero-functional-dextran as a long and multifunctional spacer arm covalently attached to an aminated surface capable of immobilizing DNA oligonucleotides. The immobilization occurred only via the amino introduced in the 3′ end of the probe, with no implication of the DNA bases in the immobilization, ensuring that the full length of the probe is available for hybridization. These plates having immobilized oligonucleotide probes are able to hybridize complementary DNA target molecules. The tailor-made hetero-functional aldehyde-aspartic-dextran together with the chemical blocking of the remaining primary amino groups on the support using acetic anhydride avoid the nonspecific adsorption of DNA on the surface of the plates. Using these activated plates, (studying the effect of the probe concentration, temperature, and time of the plate activation on the achieved signal), thus, the covalent immobilization of the aminated DNA probe was optimized, and the sensitivity obtained was similar to that achieved using commercial biotin-streptavidin systems. The new DNA plates are stable under very drastic experimental conditions (90% formamide, at 100 °C for 30 min or in 100 mM NaOH). Introduction The controlled covalent immobilization of DNA on solid supports is very relevant for the use of DNA probes in many biotechnological and molecular biology applications.1-8 To fully benefit from the covalent immobilization, the bond must be chemically very stable, the attachment must not imply the oligonucleotide bases to permit hybridization, and the immobilization must not generate steric hindrances to the hybridization.9-15 Many different methods for chemical immobilization of DNA probes to microtiter plates have been described.16-18 However, all of them have major drawbacks regarding the hybridization yield, the nonspecific adsorption of noncomplementary DNA, probe leakage, etc.1,14,18-19 The methodology that we chose was the covalent immobilization of aminated DNA probes in aldehyde activated plates. Commercially available aminated plates may be easily activated with diverse bifunctional or poly-functional aldehydes, enabling the immobilization of probes via amino groups. However, the probes immobilized directly on the activated surface of the plates are not very adequate for hybridization, producing a very low sequence specific hybridization and a large nonspecific adsorption of noncomplementary DNA. * To whom correspondence should be addressed. Fax: 34 91 585 47 60. Phone: 34 91 585 48 09. E-mail: [email protected] (R.F.-L.); jmguisan@ icp.csic.es (J.M.G.). † Instituto de Cata ´ lisis y Petroleoquı´mica-CSIC. ‡ Genomica S.A.U., Pol. Industrial Coslada.

Scheme 1

Here, we propose the use of poly-aldehyde-aspartic dextrans as spacer arms to perform the immobilization for different reasons (Scheme 1): (1) Dextrans have several active groups per molecule; thus, they permit not only to immobilize several DNA probes per dextran molecule, but also to immobilize different ligands such as aspartic acid and oligonucleotide probes.20-21 (2) Dextrans are long and flexible polymers, giving almost full freedom to the immobilized DNA molecules for hybridizing and avoiding steric hindrances generated by the surface of the solid.6,9,12,22

10.1021/bm0343949 CCC: $27.50 © 2004 American Chemical Society Published on Web 02/24/2004

884

Biomacromolecules, Vol. 5, No. 3, 2004

Fuentes et al.

Table 1. Oligonucleotides Used in This Studya oligonucleotide amino probe G+C A+C biotin probe

sequence 5′- GGG AGA GCC ATA GTC GTC GTC T GC GGA A-NH 2 C3-3′ 5′-GGG C GC GCG GTG GTG GTG G TG TGC GGA A-DIG-3′ 5′-GGG A GA ACC ACA CCA ACA ACC GGA AsDIG-3′ 5′Biotin-GGG AGA GCC ATA GTC GTC TGC GGA A-3′

a 3′Amino modifier C3: (2-Dimethoxymethyl-6-fluorenylmethoxycarbonylamino- hexane-1-succinoyl) short chain alkylamino CPG500. DIG: DNA probe labeled with digoxigenin.

The negative charge of the modified polymer may partially block the amino groups in the plate, decreasing ionic adsorption of DNA samples23 that may give false positive assays. The negative charge permits a rapid electrostatic adsorption of the aldehyde-dextran on the plate, which increases the rate of the covalent “intramolecular” reaction between the aldehydes groups in the dextran and the amino groups on the plates. This idea of a rapid physical adsorption to accelerate covalent immobilization of macromolecules has been demonstrated previously for epoxy-supports24,25 and glutaraldehyde supports26,27 to immobilize proteins. Materials Microtiter plates with primary amino groups were supplied by COSTAR Inc. (USA). Streptavidin coated microtiter plates were from Thermo-Labsystem. Dextran from Leuconostoc mesenteroides, sodium aspartic, and sodium periodate were supplied by SIGMA (Illinois, USA). DeoxiUTPdigoxigenin and the reagents for detection of digoxigenin labeled DNA were supplied by Roche Diagnostics. Oligonucleotide DNA probes (see Table 1) were synthesized by ISOGEN BIOSCIENCE (Netherlands). All reagents were of analytical grade. Methods 1. Preparation of Aldehyde-Dextran. Aldehyde-dextran was obtained by oxidation of a solution of 33 mg/mL dextran (different molecular weights) with 0.872 g of sodium periodate. The oxidation was performed for 2 h at room temperature. Once the reaction was finished, the solution was dialyzed against ultrapure water. The dextran obtained under these conditions has 20% of the glucose molecules present in the polymer oxidized as di-aldehydes.21,28 2. Preparation of Aldehyde-Aspartic-Dextran. The aldehyde-dextran was mixed with an equal volume of 3 M sodium aspartate at pH 7.5, and solid trimethylaminoborane was added to a concentration of 200 mM. The amino groups of the aspartic acid reacted with the aldehyde groups in the dextran. After 15 h, the obtained aspartic-dextran was reduced (to stabilize the Schiff’s bases formed and any remaining aldehyde) by the addition of 5 mL of 500 mM sodium carbonate buffer pH 10.5 containing 100 mg/mL of sodium borohydride. This mixture was incubated for 30 min at room temperature and pH of the mixture was lowered to pH 6 using hydrochloric acid to destroy the sodium borohydride. Once the dextran was modified with aspartic acid and reduced, it was dialyzed against ultrapure water.

The aspartic-dextran was oxidized once again at 20% with periodate) as described in step 1, and it was dialyzed 10 times against distilled water with a 1:10 ratio to produce aldehydeaspartic-dextran.29 3. Modification of the Aminated Plate with AldehydeAspartic-Dextran. 1 mL of 500 mM phosphate buffer pH 7 and 1 mL of 150 mM trimethylaminoborane were added to 20 mL of aldehyde-dextran. Then, 350 µL of this solution was added to each well of the aminated plate Costar (Corning Incorporated. NY) and incubated for 24 h at room temperature. After this time, the plate was emptied and dried. The remaining aldehyde groups on the dextran were reduced (forming very inert hydroxyl groups) by adding 350 µL of 500 mM sodium carbonate buffer pH 10.5, containing 10 mg/mL of sodium borohydride to each well. After 30 min, the plates were washed with water and dried.29 4. Blocking with Acetic Anhydride. After the modification of the aminated plates with aldehyde-aspartic-dextran, the remaining amino active groups were blocked by incubation with a solution of 10% (v/v) acetic anhydride in acetonitrile for 10 min, and finally, the plate was washed with water and dried.29 5. Immobilization of Aminated Oligonucleotide. The dextran immobilized (different sizes) on the plate was again oxidized by adding 100 µL of 50 mM sodium periodate to each well. After 1 h at room temperature, the plates were washed with abundant distilled water. This should produce the oxidation of the remaining 60% of the glucose molecules presented in the immobilized dextran-aspactic. Then, different amounts of DNA probe (aminated at 3′) in 15 µL of 65 mM phosphate buffer pH 7.0 and 330 mM NaCl were added per well. The plates coated with aspartic-aldehyde-dextran were incubated with this solution at different temperatures for different time intervals. Afterward, the plates with the immobilized probe were dried (by hit on dryer paper) and reduced by adding 350 µL of solution of 500 mM sodium carbonate buffer pH 10.5 containing 100 mg/mL sodium borohydride for 1 h at room temperature. Finally, the plates were washed with ultrapure water and dried (by hit on dryer paper). 6. Hybridization. A model system was used to test the hybridization efficiency of the oligonucleotides immobilized on the plates. In this model system, a DNA fragment of 330 bp obtained by PCR amplification from a clone of the 5′ UTR of the Hepatitis C virus was used as target DNA for hybridization. The PCR mix for amplification of the target DNA contained 1X Taq buffer, 1 mM MgCl2, 2 U. Taq Polymerase, 0.2 mM of each of the deoxi-nucleotides triphosphate, 100 ng of each of the PCR primers (RT-HCV: CATGGTGCACGGTCTACGAGAC, EXT-HCV: GGCGA-

Biomacromolecules, Vol. 5, No. 3, 2004 885

Immobilization of DNA Probes on Plates

CACTCCACCATAGATC), and 10 µM dUPT-Digoxigenin in a final volume of 50 µL. The PCR reaction proceeded for 40 cycles with 1-min incubations at 94 °C, 50 °C and 72 °C. In addition, a noncomplementary amplified DNA fragment of 750 bp was obtained from a clone having the sequence of the same PCR primers but the internal sequence corresponds to the nucleotides 920 to 1548 of the Lmip gene of Legionella pneumophila. The final amplified products, labeled during the PCR reaction with Digoxigenin, were characterized by agarose gel electrophoresis and by hybridization on Streptavidin coated microtiter plates using probes with the same sequence but labeled with biotin at the 5′ end of the probe. The probes listed in Table 1 were immobilized on the aldehyde-aspartic-dextran covered plates by the method described above. 15 µL of the amplified product containing approximately 50 ng/µL of DNA and 1:5 serial dilutions thereof were assayed. Target DNA was denatured by incubation at 100 °C for 5 min and stored immediately in ice. The hybridization was performed in wells that contained 100 µL of hybridization buffer (Tris HCl 5 mM, pH 7.5, 1 mM EDTA, 1X SSC and 2X Denhart’s) for 1 h at 55 °C. The Tm of the double helix formed by the specific probe used in this paper (50 mM salt, probe concentration 200 pM) is 74 °C, determinated as describe Breslauer et al.30 After this, the hybridized DNA was evaluated by detection of labeled digoxigenin that had been incorporated during PCR using detection reagents and conditions described by the manufacturer (Roche Diagnostics). Briefly, after hybridization, the wells were washed with PBS-Tween 20 (washing buffer) and incubated for 1 h at room temperature with 100 µL of anti-Dig Fab fragments conjugated with horseradish peroxidase, diluted 1/1000 with 1X Blocking solution. After incubation, the wells were washed with washing buffer, and 100 µL of the peroxidase substrate ABTS (2,2′-azido-di(3 ethyl benzthialzoline-6-sulfonic-acid) was added per well. The reaction proceeded at room temperature for 1 h. The absorbance of the resulting green color was measured at 405 nm using a micro-titer plate reader. Streptavidin-coated microtiter plates were used as a reference for monitoring the efficiency of the hybridization on the oligonucleotides probes immobilized on the dextranaspartic plates. In this case, the oligonucleotide probes and the hybridization protocol used were the same than those described above, but the oligonucleotide probes were labeled with Biotin (instead of amino) at the 5′ end for immobilization on the Streptavidin-coated microtiter plates (ThermoLabsystem). 7. Stability Assays. 7.1. Temperature. The dextranmodified plates (activated with aldehyde-aspartic-dextran) and control Streptavidin-coated plates, with the DNA probe immobilized, were incubated during 1 h at different temperatures (25-80 °C) with 100 µL of hybridization buffer per well. Afterward, the plates were washed with washing buffer, at the same temperature they were incubated. The presence and hybridization ability of the immobilized amino DNA probe was evaluated by hybridization with serial dilutions of complementary target DNA.

Table 2. Unspecific Adsorption of DNA over Different Microtiter Plate Covers modified plate

1:25

aminated >4.00 glutarladehyde 3.678 dextran 1.353 aspartic-dextran 0.417 aspartic-dextran double layer 0.256 layer aspartic-dextran monolayer + 0.101 block with anhydride acetic a

1:125 1:625 1:3125 3.889 3.657 1.245 0.402 0.245 0.095

3.785 3.436 1.356 0.396 0.234 0.086

3.678 2.542 1.246 0.388 0.243 0.084

Abs 405 nm.

7.2. Formamide. The dextran-modified plates (coated with aldehyde-aspartic-dextran) and control Streptavidin-coated plates were incubated during 1 h at 55 °C with hybridization buffer having different percentages of formamide. Then the plates were washed with the same hybridization solution. The presence and hybridization ability of the immobilized amino-DNA probe was evaluated by hybridization with serial dilutions of complementary target DNA. 7.3. 0.1 M NaOH. The dextran-modified plates (activated with aldehyde-aspartic-dextran) and control Streptavidincoated plates were incubated during 1 h with 0.1 M NaOH. Then, the presence and hybridization ability of the immobilized amino-DNA probe was evaluated by hybridization with serial dilutions of complementary target DNA. Results and Discussion 1. Nonspecific DNA Adsorption on Aminated Plates. One of the main problems of the use of aminated plates is the nonspecific adsorption of DNA on cationic surfaces.23 Table 2 shows the results of incubation of different modified plates in the nonspecific adsorption of noncomplementary DNA. The high ionic adsorption of PCR products onto the commercial amino plate prevents their use as biosensors. The coating with glutaraldehyde promoted a marginal decrease of this adsorption. Using aldehyde-dextran coated plates, the adsorption decreased significantly (to 4.000

2.446

0.855

0.685

1.768

0.941

0.463

0.235

0.958

0.684

0.231

0.156

a

Figure 2. Effect of the temperature of immobilization in the specific signal. Experiments were performed ass described in methods. (dilution complementary DNA 1:125).

Figure 3. Effect of the concentration of DNA amino probe in the specific signal. Plates were activated with aldehyde-aspartic-dextran (2000 kDa) and blocked by anhydride acetic. Immobilization temperature was 55 °C. Dilution complementary DNA 1: 625. Other specifications as described in Methods.

maximum at 55 °C. When the temperature was 72 °C, there was an increase of unspecific signal, perhaps due to chemical reactions of the aldehyde-dextran that could yield no inert groups. In fact, it was possible to observe in concentrated solutions of the reagent a strong brown color at these temperatures. Thus, 55 °C was chosen as the temperature to immobilize the probe. 2.2. Effect of the Concentration of DNA Amino Probe. The signal increased from 10 up to 300 ng/µL per well. When 500 ng/µL of probe was used, the signal decreased, probably due to steric hindrances during the hybridization promoted by an excessive amount of DNA probe on the dextran (Figure 3). Thus, 300 ng/µL of probe per well were used to prepare the biosensor.

Abs λ 405 nm.

2.3. Effect of the Immobilization Time. Figure 4 shows that initially, when the immobilization time was prolonged, the specific signal increased, reaching a maximum after 72 h. For longer times, a slight decrease of specific signal and an increase of unspecific signal were detected, related to the destruction of aldehyde groups and amino-aldehyde bonds. Thus, the optimal immobilization time was chosen to be 72 h. 2.4. Optimal Size of Aldehyde-Aspartic-Dextran. Table 3 shows the results when comparing the different sizes of dextran. The maximum signal was obtained in a plate activated with the largest aldehyde-aspartic-dextrans (40 × 106 Da) available, most likely because of the higher “volume” of immobilization when using larger dextrans. 3. Assessment of the Implication of the Bases in the Immobilization. Different probes (modified with primary amino group or not) marked with digoxigenin were incubated in the activated plates following the optimal protocol designed in the previous section. Figure 5 shows that, after washing the plates, only the plates modified with aminated probes group gave specific signal after incubation with antidigoxigenin marked with peroxidase. Therefore, the protocol proposed gave a covalent immobilization only implying the amino group introduced in the 3′ position of the probe. 4. Characterization of the Optimum Plate. 4.1. SensitiVity Compared to Commercial Plates. Our optimal DNA immobilized plate is able to detect concentrations of DNA of 240 fg/µL, which compares with the sensitivity of commercial plates. This good sensitivity level was based on the negligible unspecific adsorption of DNA on the plate plus the good specific response. (Figure 6) 4.2. Thermal Stability. The DNA dextran-modified plate could withstand 100 °C for 30 min, whereas biotin-

Immobilization of DNA Probes on Plates

Biomacromolecules, Vol. 5, No. 3, 2004 887

Figure 8. Stability of different immobilized DNA in Formamide. Hybridization assay (dilution 1:125) after incubation of the plates in different percentages of formamide at 55 °C as described in methods. Diamonds: Dextran-modified plates. Circle: Biotin-streptavidin plates. Figure 5. Assessment of the implication of the bases in the immobilization. Plates were incubated with different aminated or no aminated DNA probes under optimal conditions. Dilution complementary DNA 1: 625. Other specifications as described in Methods. Diamonds: DNA amino probe (HCV). Circles: G+T probe. Triangles: A+C probe.

Figure 9. Stability in NaOH 0.1 M of different immobilized DNA. The plates were incubated in NaOH during 1 h as described in methods before hybridization at 55 °C (dilution 1:125). Circles: DNA complementary. Squares: DNA noncomplementary.

Figure 6. Signal observed at different concentrations of DNA. 15 µL of the amplified product containing approximately 50 ng/µL of DNA and 1:5 serial dilutions thereof, were assayed. The hybridization was performed in wells that contained 100 µL of hybridization buffer (Tris HCl 5 mM, pH 7.5, 1 mM EDTA, 1X SSC and 2X Denhart’s) for 1 h at 55 °C. Other details are described in Methods. Circles: DNA complementary. Squares: DNA noncomplementary.

biotin DNA plates were almost fully inactivated by concentrations higher than 30% of formamide. (Figure 8) 4.4. Stability in NaOH 0.1 M. The DNA-dextran-modified plate could be incubated in the presence of NaOH 0.1 M for 1 h with only marginal decreases (less than 20%) in the signal obtained after hydridization with specific DNA, whereas biotin-streptavidin DNA plates lost all capacity for hybridization (Figure 9). Conclusions

Figure 7. Thermal stability of different immobilized DNA. The plates were incubated at different temperatures during 1 h as described in methods before hybridization at 55 °C (dilution 1:125). Circle: Dextran- modified plates. Squares: Biotin-streptavidin plates

streptavidin DNA plates were fully destroyed after this treatment. In fact, incubation at 70 °C promoted a severe decrease in the signal of these commercial plates while having no effect on dextran-modified plates. (Figure 7) 4.3. Stability in the Presence of Formamide. The DNAdextran-modified plate could be incubated even in the presence of 90% formamide at 55 °C for 1 h, keeping its ability to hybridize almost unaltered, whereas streptavidin-

The use of aldehyde-aspartic-dextran, with anionic and aldehyde groups, of very high molecular weight enables the directed covalent binding of artificially aminated DNA probes via very strong covalent bonds. The properties of this immobilization protocol may be summarized as follows: (i) The bond is very stable; in fact, it is resistant to drastic pHs, high temperatures or the presence of high concentrations of salts, solvents, and nucleophiles in the hybridization mixtures. (ii) The final supports surface is very inert. (iii) The long spacer arms facilitate the hybridization. (iv) The immobilization of the probe is only via the amino group artificially introduced at end of the DNA probe, which allows hybridization with the entire sequence of bases of the probe. This whole set of properties makes this protocol very promising to be used in PCR-ELISA or in DNA microarrays and may be reproduced in any other kind of aminated supports.

888

Biomacromolecules, Vol. 5, No. 3, 2004

In this work, we described a new procedure for immobilization of aminated DNA probes in aminated plates based on the use of hetero-poly-functional polymers, modified dextrans as spacer arms. These molecules are polyfunctional ones and may be modified step by step, to give hetero-functional polymers. They permit the immobilization of many DNA probes per dextran molecule. This new technology is protected by Patent PCT/GB02/01059, where are described all of the methods employed in this study. The key parameters (the lack of unspecific adsorption on the plate, the real covalent attachment via the amino introduced in the probe and the stability of the final composite) has been studied in order to optimize this new methodology. Acknowledgment. This work has been founded by Spanish FIS. We would also like to express our gratitude to A Ä ngel Berenguer (Departamento de Quı´mica Inorga´nica, Universidad de Alicante) for his interesting suggestions. References and Notes (1) Soumitra S. G.; Musso F. G. Covalent attachment of oligonucleotides to solid supports. Nucleic Acids Res. 1987, 15, 13-17. (2) Strother T.; Hamers R. J.; Smith M. L. Covalent attachment of oligodeoxyribonucleotides to amine-modifed S1 (001) surfaces. Nucleic Acids Res. 2000, 28, 18-25. (3) Wang, J.; Cai, X.; Rivas, G.; Shiraishi, H.; Dontha, N. Nucleic-acid immobilization, recognition and detection at chronopotentiometric DNA chips. Biosens. Bioelectron. 1997, 12, 587-599. (4) Rogers, Y. H.; Jiang-Baucom, P.; Huang, Z. J.; Bogdanov, V.; Anderson, S. Boyce-Jacino, M. T. Immobilization of oligonucleotides onto glass support via disulfide bonds: a method for preparation of DNA microarrays. Anal. Biochem. 1998, 266, 23-30. (5) Ushizawa, K.; Sato, Y.; Mitsumori, T.; Machinami, T.; Ando, T. Covalent immobilization of DNA on diamond and tis verification by diffuse reflectance infrared spectroscopy. Chem. Phys. Lett. 2002, 351. (6) Goris, J.; Suzuki, K.; De Vos, P.; Nakase, T.; Kersters, K. Evaluation of microplate DNA-DNA hybridization method compare with the initial renaturation method. Can. J. Microbiol. 1998, 44, 1148-1153. (7) McGown, L. B.; Joseph, M. J.; Pitner, J. B.; Vonk, G. P.; Linn, C. P. The Nucleic acid ligand, a new tool for molecular recognition. Anal. Chem. 1995, 11, 663A-8A. (8) Rasmussen, S. R.; Larsen, M. R.; Rasmussen, S. E. Covalent immobilization of DNA onto bound at the 5′ end. Anal. Biochem. 1991, 198, 138-42. (9) Shepinov, M. S.; Case-Green, S. C.; Southern, E. M. Steric factors influencing hybridization of nucleic acids to oligonucleotide arrays. Nucleic Acid Res. 1999, 25, 1155-1161. (10) Sojka, B.; Piunno, P. A. E.; Wust, C. C.; Krull, U. J. Evaluating the quality of oligonucleotides that are immobilized on glass supports for biosensor development. Anal. Chim. Acta 1999, 395. (11) Steel, A. B.; Leviky, R. L.; Herne, T. M.; Tarlov, M. J. Immobilization of Nucleic Acids at Solid Surfaces: Effect of Oligonucleotide length on Layer Assembly. Biophys. J. 2000, 79, 975-981. (12) Gingeras, T. R.; Kwoh, D. Y.; Davis, G. R. Hybridization properties of nucleic acids. Nucleic Acids Res. 1987, 15, 13.

Fuentes et al. (13) Day, P. J. R.; Flora, P. S.; Fox, J. E.; Walker, M. R. Immobilization of polynucleotides on magnetic particles. Factors influencing hybridization efficiency. Biochem. J. 1991, 278, 735-740. (14) Lamture, J. B.; Beattie, K. L.; Burke, B. E.; Eggers, M. D.; Erlich, D. J.; Fowler, R.; Hollis, M. A.; Kosicki, B. B.; Reich, R. K.; Smith, S. Direct detection of nucleic acid hybridization on the surface of a charge couple device. Nucleic Acids Res. 1994, 22, 21221-5. (15) Christensen, H.; Angen, O.; Mutters, R.; Olsen, J. E.; Bisgaard, M. DNA-DNA hybridization determined in microwells using covalent attachment of DNA. Int. J. Syst. EVol. Micr. 2000, 50, 1095-1102. (16) Cohen, G.; Deutsch, J.; Fineberg, J.; Levine, A. Covalent attachment of DNA oligonucletides to glass. Nucleic Acids Res. 1997, 25, 9112. (17) Joss, B.; Kuster, H.; Cone, R. Covalent attachment of DNA oligonucleotides to glass supports. Anal. Biochem. 1997, 247, 96101. (18) Walsh, M. K.; Xwen, W.; Weimer, B C. Optimizing the immobilization of single-stranded DNA onto glass beads. J. Biochem. Biophys. Methods 2001, 47, 221-231. (19) Lund, V.; Schmid, R.; Rickwood, D.; Hornes, E. Assesment of methods for covalent biding of nucleic acids to magnetic beads. Dynabeads, and the characteristics of the bound nucleic acids in hybridization reactions. Nucleic Acids Res. 1988, 16, 10861-80. (20) Goss, T. A.; Bard, M.; Jarret, H. W.; High-performance affinity chromatography of DNA. J. Chromatogr. 1990, 508, 279-287. (21) Schacht, E. H. Modification of dextran and application in prodrug design. In Industrial polysaccharides Engineering: Genetic Engineering, Structure/Property Relations and Applications; Yalpani, M., Ed.; Elservier: Amsterdam, 1987. (22) Penzol, G.; Armisen, P.; Ferna´ndez-Lafuente, R.; Rodes, L.; Guisa´n, J. M. Use of dextrans as long, inert and hydrophilic spacer arms to improve the performance of immobilized proteins acting on macromolecules. Biotechnol. Bioeng. 1998, 60, 518-523. (23) Unsal, E.; Bahar, T.; Tuncel, M.; Tuncel, A. DNA adsorption onto polyethylenimine-attached poly (p-chloromethylstyrene) beads. J. Chromotogr. A 2000, 898, 167-177. (24) Mateo, C.; Ferna´ndez-Lorente, G.; Pessela, C. C.B.; Vian A.; Carrascosa, A.; Jose, L.; Garcia, J. L.; Ferna´ndez-Lafuente, R.; Guisan, J. M. “Affinity chromatography of poly-his tagged enzymes: new dextran-coated IMAC matrixes for prevention of undesired multipoint adsorptions” J. Chromatogr. A 2001, 915, 97-106. (25) Mateo, C.; Torres, R.; Ferna´ndez-Lorente, G.; Ortiz, C.; Fuentes, M.; Hidalgo, A.; Lo´pez-Gallego, F.; Abian, O.; Palomo, J. M.; Betancor, L.; Pessela, C. C. B.; Guisa´n, J. M.; Ferna´ndez-Lafuente Epoxy-amino sepabeads: a new support for immobilization of proteins under mild conditions. Biomacromolecules 2003, 4, 772777. (26) Mieglo, I.; Moreira, M. T.; Palma, C.; Guisa´n, J. M.; Ferna´ndezLafuente, R.; Feijoo, G.; Lema, J. M. Catalytic properties of immobilized and stabilized manganeso peroxidases. Enzyme Microb. Technol. 2003, 32, 769-775. (27) Balcao, V. M.; Mateo, C.; Ferna´ndez-Lafuente, R.; Malcata, F. X.; Guisa´n, J. M. Structural and functional stabilization of L-asparraginasa upon immobilization onto highly activated supports. Biotechnol. Prog. 2001, 17, 537-542. (28) Drobchenko, S. N.; Isaeva-Ivanova, L. S.; Kleiner, A. R.; Lomanki, A. V.; Kolker, A. R.; Noskin, V. A. An investigation of the structure of periodate-oxided dextran. Carbohydr. Res. 1993, 241, 189-199. (29) Patent PCT/GB02/01059 “Use of dextrans as spacer arms for oriented covalent immobilization of DNA probes and other ligands at surface of interest in diagnostics”. (30) Breslauer, K. J.; Frank, R.; Bloker, H.; Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. 1986, 83, 3746-50.

BM0343949