DNA-Based Multiconstituent Dynamic Networks: Hierarchical Adaptive

Subscriber access provided by University of Sunderland

Article

DNA-Based Multi-Constituent Dynamic Networks: Hierarchical Adaptive Control Over the Composition and Cooperative Catalytic Functions of the Systems Zhixin Zhou, Liang Yue, Shan Wang, Jean-Marie Lehn, and Itamar Willner J. Am. Chem. Soc., Just Accepted Manuscript • DOI: 10.1021/jacs.8b06546 • Publication Date (Web): 29 Aug 2018 Downloaded from http://pubs.acs.org on August 30, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society

DNA-Based Multi-Constituent Dynamic Networks: Hierarchical Adaptive Control Over the Composition and Cooperative Catalytic Functions of the Systems Zhixin Zhou,§,† Liang Yue,§,† Shan Wang,† Jean-Marie Lehn,‡ and Itamar Willner*,† † ‡

Institute of Chemistry, The Hebrew University of Jerusalem, Jerusalem 91904, Israel. Institut de Science et d’Ingénierie Supramoléculaires (ISIS), University of Strasbourg, 8 allée Gaspard Monge, 67000 Strasbourg,

France

Supporting Information Placeholder ABSTRACT: The information encoded in the base sequences of nucleic acids is used to construct [3×2] or [3×3] constitutional dynamic networks (CDNs) composed of six or nine constituents, respectively. In the presence of appropriate triggers, the adaptive and hierarchical reconfiguration of the CDNs is demonstrated. The reconfiguration of the CDNs, which involves the triggered stabilization and up-regulation of a specific constituent is accompanied by the up-regulation of the constituents that do not share component-connectivities with the trigger-stabilized constituent, and by the concomitant down-regulation of the constituents sharing component-connectivities with the triggerstabilized constituent. Using a set of different triggers, a series of reconfigured networks-in-networks is demonstrated. The operation and reconfiguration of the CDNs are based on the following motives: (i) Each of the constituents in the [3×2] or [3×3] CNDs is composed of a supramolecular structure consisting of two duplex-bridged double-loop quasi-circle units. The hybridization of a single-strand trigger with the double-loop domain stabilizes the respective constituent and this results in the reconfiguration of the CDNs. (ii) To each of the constituents is conjugated a Mg2+-ion-dependent DNAzyme that cleaves a sequence-specific fluorophore/quencher substrate. The timedependent fluorescence changes, upon the cleavage of the different substrates by the reporter DNAzymes, and the use of appropriate calibration curves, provide means to evaluate quantitatively the contents of all constituents in the different CDNs. The triggered transitions of the parent [3×2] or [3×3] CDNs into three different CDNs using three different triggers, respectively, are exemplified. In addition, the transitions of the parent [3×2] or [3×3] CDNs using sequential triggers are demonstrated. Adaptive equilibrated reconfiguration of the CDNs subjected to simple triggers are demonstrated and hierarchical adaptive dynamic transitions of the CDNs, subjected to two sequential triggering signals are highlighted. In addition, emerging catalytic functions driven by the adaptive and hierarchical transitions across different equilibrated states of the [3×3] CDNs are demonstrated.

INTRODUCTION Many cellular transformations originate from complex signal triggered networks.1 These natural processes involve the intercommunication between networks, the operation of network

cascades,2 the branching and hierarchical control of networks,3 the operation of feedback-driven networks4 and the activity of multiconstituent network systems that adapt themselves to environmental triggers, such as metabolites or biomarkers.5 All of these processes involve signal transduction and information transfer between the constituents of the networks. Inspired by nature, extensive research efforts are directed toward the development of artificial constitutional dynamic networks (CDNs) that mimic natural processes (systems chemistry).6 Specifically, mixtures of dynamically inter-connected equilibrated supramolecular constituents that respond to environmental triggers by the reconfiguration of the equilibrated mixtures (adaptation) to yield emerging compositions, structures and functions, attract growing interest.7 The simplest equilibrated CDN consists of four equilibrated constituents AA', AB', BA' and BB' ([2×2] network). Although the four constituents exist in equilibrium, the network consists of two pairs of agonist constituents (that do not share common components in the constituent structures) AA'/BB' or AB'/BA', and four pairs of constituents exhibiting antagonist relationships (that share a common component), AA'/AB', AB'/BB', BB'/BA' and BA'/AA'. The triggered stabilization of any of the constituents results in the re-equilibration of the CDN. The stabilized constituent is upregulated (increase in its content) on the expense of the separation of constituents that share common components with up-regulated constituent (antagonist relations), resulting in the down-regulation of antagonist constituents. Concomitant to the up-regulation of one of the constituents, the agonistic constituent is up-regulated, due to the separation of the antagonist constituents. That is, in a [2×2] four-constituent CDN, the triggered up-regulation of any of the constituents is accompanied by the down-regulation of the constituents that exhibit component-connectivity with the stabilized constituent, and by the up-regulation of the constituents that lack component-connectivity to the stabilized constituent. This discussion emphasizes the fundamental features of CDNs: (i) The dynamic adaptivity of the CDN reconfigures into a new equilibrated mixture in response to an environmental trigger. (ii) The connectivities between the constituents control the upregulation and down-regulation features of the reconfigured CDN. Indeed, different triggers to stimulate adaptive dynamic reconfiguration of CDNs were reported,8 and the adaptive equilibration of different dynamic network configurations by environmental conditions (triggers) were computationally stimulated.9 Nonetheless, the construction of bioinspired systems requires the assembly of dynamic networks of enhanced

ACS Paragon Plus Environment

Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Schematic adaptive reconfiguration of the [3×3] CDN into CDN state “S” in the presence of trigger Ti, and the subsequent hierarchical reconfiguration of CDN state “S” into the state “K”, using Tj as an auxiliary trigger. complexity and functions. One path to increase the complexity of CDNs could involve the increase of the number of inter-connected constituents in the CDNs. This approach does not only increase the arsenal of triggers and CDN states of the mixture, but may lead to unique emerging functions of the system.10 This is exemplified in Figure 1 with the assembly of a [3×3] CDN that includes nine inter-connected constituents. The triggered stabilization of the constituent C1D2, using Ti as a trigger, results in the up-regulation of C1D2 and of all of the constituents that do not share common components with triggered constituent, C2D1, C3D1, C2D3 and C3D3, and the down-regulation of all other four constituents that share components with C1D2, state “S”. Subjecting the CDN “S” to trigger Tj results in, for example, the up-regulation of C3D1, and this is accompanied by the upregulation of C1D2-Ti and C2D3 and the down-regulation of the previously up-regulated constituents C2D1 and C3D3, state “K”. The example demonstrates the unique features of the [3×3] multiconstituent CDN system as compared to the [2×2] fourconstituent CDN: (a) Multi-constituent CDNs allow the reconfiguration of the networks by many different triggers. Sequential triggers may be applied on the networks. (b) The different triggers may lead to many different dictated adaptive states of up-regulated and down-regulated CDNs. (c) By applying sequential triggers, hierarchical re-equilibration of the CDN configurations may be tailored. Hierarchical transitions within the CDN networks may lead to amplification and selection of the adaptive CDN constituents. (d) By the conjugation of catalytic functions to the multi-triggered CDNs constituents, selective, adaptive and amplified catalytic transformations may be envisaged (vide infra). Recently, a mixture of aryl/pyridyl aldehydes and pyridyl hydrazine/aryloxyhydrazine was used as an equilibrated [3×2] CDN composed of the respective hydrazone constituents. The dynamic adaptive transitions of the network to newly equilibrated CDNs guided by multiple triggers consisting of metal ions (e.g., Zn2+, Cu+, that coordinate to dictated hydrazone constituents) were demonstrated.11 Similarly, the triggered adaptive transitions of [3×3] CDNs was reported. For example, a [3×3] mixture of nine hydrazone constituents composed of three different arylaldhydes and three different arylhydrazine compounds was transformed into a new CDN-equilibrated mixture in the presence of Zn2+ ions. In addition, a different [3×3] CDN mixtures consisting of nine hydrazone constituents that include multicoordination sites could be shifted to new equilibrated states by subjecting the CDN to different metal-ion triggers (e.g., Cu+ or Fe2+) or by the interaction of the [3×3] CDN to a sequence of metal-ion triggers.11 Although these systems revealed some of the fundamental features of higher order CDNs, such as the dynamic adaptation of the CDNs by multiple triggers, the dynamic hierarchical transitions between CDNs and the selective guided amplifications of the constituents by appropriate triggers. In addition to the adaptive dynamic reconfiguration of CDNs, previous studies have introduced peptide-based or enzyme-nucleic

Page 2 of 13

acid-based networks for the guided amplified synthesis of products. For example, Ghadiri and Ashkenasy have used peptide scaffolds for the templated-directed autocatalytic or crosscatalytic synthesis of self-replicated products.12 Also Rondelez has been used nucleic acid templates as functional scaffolds for the replication of products using polymerization/nicking machineries.13 Although substantial progress in developing cascaded catalytic networks and adaptive CDN systems was demonstrated, these pioneering efforts identified the difficulties and challenges for the future development of the topic: (a) A versatile concept to design multi-constituent CDNs, where each of CDN constituents can be triggered by a different stimulus, is essential. The demonstration of the transitions across all possible CDN states is important. (b) The complex CDNs should include reliable readout signals that allow the quantitative evaluation of the compositions of different CDNs, and particularly means to follow the dynamic adaptation and the hierarchical transition of the CDNs. (c) Most important, the multi-triggered, multiconstituent, CDNs should demonstrate emerging functions that are dictated by their unique adaptive and hierarchical features. Recently, we introduced nucleic acids as the building blocks to construct CDNs.14 The base-sequence of oligonucleotides encodes substantial structural and functional information into the polymer.15 Beyond the formation of duplex nucleic acids and their separation by the strand displacement process,16 the pH-induced formation and dissociation of i-motif17 or triplex structures,18 the K+-induced formation of G-quadruplexes or their separation by crown ethers,19 and the stabilization or separation of duplex nucleic acids in the presence of photoisomerizable trans-/cisazobenzene intercalators,20 represent sequence dictated reconfiguration of nucleic acid structures. Functional information encoded in the base sequence of nucleic acids includes specific recognition of ligands (aptamers)21 and sequence-controlled catalytic functions (DNAzymes or nucleoapzymes).22 These unique functions provided the grounds for the development of the DNA nanotechnology.23 Specifically, the triggered reconfiguration of supramolecular nucleic acid structures enabled the tailoring of DNA switches and machines,24 the design of sensors,25 the development of DNA-based materials with switchable functions (e.g., hydrogel with controlled stiffness or shape-memory hydrogels),26 and the assembly of switchable DNA-modified micro/nano-carriers for controlled drug release.27 Not surprising, these unique features of nucleic acids were used to tailor stimuli-triggered reconfigurable CDNs. Strand displacement or light-induced formation of duplex structures were used to reconfigure constituents of CDNs to energetically-stabilized structures, and the dynamic transitions of the CDNs into new equilibrated states were demonstrated. The nucleic acid-based CDN systems reported, till now, represent, however, simple [2×2], dynamically reconfigurable, four-constituent networks that do not lead to emerging functions. The reported systems suggest, however, that nucleic acids may provide useful building blocks for CDNs with enhanced complexity. In the present report, we describe the assembly of [3×2] and [3×3] multi-constituent dynamic networks driven by multiple triggers. Besides the ability to dynamically control the transitions across all possible adaptive states, we highlight the hierarchical stimuli-guided transitions within the set of networks-in-networks and demonstrate networkguided amplification processes. In addition, we demonstrate the use of the multi-triggered networks as a dynamic scaffold for the design and control of emerging catalytic functions.

RESULT AND DISCUSSION Figure 2A depicts schematically the equilibrated CDN, state “I” composed of six constituents A1B1, A2B1, A3B1, A1B2, A2B2, and A3B2. The system represents a [3×2] CDN. Each of the


Page 3 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A) Schematic configuration of a [3×2] nucleic acid-based CDN composed of six supramolecular constituents. Each of the constituents includes a double-loop domain that can be stabilized by an auxiliary trigger strand, and a functional Mg2+-ion-dependent DNAzyme reporter unit. (B) Schematic stabilization of a constituent of the [3×2] CDN using an auxiliary trigger and the biocatalytic readout of the constituents contents by the Mg2+-ion-dependent DNAzyme reporter units: (i) Schematic stabilization of the double-loop domain of a constituent by the hybridization with an auxiliary trigger T that bridges the loop domain, and the reversible switching of the constituent structure with a counter trigger T1', by a strand displacement process. (ii) The catalytic Mg2+-ion-dependent DNAzyme-induced cleavage of a fluorophore/quencher-functionalized substrate provides the mean to quantitatively evaluate the content of constituents. (C) Schematic adaptive reconfiguration of the [3×2] CDN in state “I” into three different CDNs in state “II”, state “III” and state “IV”, in the presence of triggers T1, T2, and T3, respectively, and the subsequent hierarchical reconfiguration of CDN “II” and CDN “IV” into CDN “V” and CDN “VI”, respectively, using T2 as an auxiliary trigger. constituents is composed of a supramolecular structure that consists of two nucleic acids. Each of these constituents includes a middle di-loop domain stabilized by two duplex stators. The diloop single-stranded domain provides the “operator” site for triggering the reconfiguration of the CDN in the presence of an appropriate trigger (T). Each of the constituents includes a supramolecular structure of the Mg2+-ion-dependent DNAzyme subunits linked to the “stator-duplexes”. The Mg2+-ion-dependent DNAzymes act as catalytic “reporter” units to report the contents (concentrations) of the respective constituents in the equilibrated mixtures (vide infra). The six DNAzyme reporter units differ in their single-stranded arm domains that bind the substrates to the DNAzymes. The method to trigger the reversible dynamic reconfiguration of the CDN and the DNAzyme-catalyzed readout of the content of the constituents are shown in Figure 2B. The trigger, T, to change the stability of the target constituent, is a nucleic acid strand that hybridizes with the “operator” di-loop domain, Figure 2B, (i). The resulting duplexes stabilize the supramolecular structure of the respective constituent. Treatment of the trigger-stabilized structure with counter trigger T' leads to the strand displacement of the T-strand stabilized structure, and this provides a means to reversibly switch the stabilized constituent to its original configurations. The quantitative evaluation of the contents of the constituents of the CDN is achieved by following the activities (time-dependent fluorescence changes) of the Mg2+-ion-dependent DNAzyme upon the catalyzed cleavage of the respective fluorophore/quenchermodified substrates associated with the different reporter units, Figure 2B, (ii). As stated, the DNAzyme reporter units associated with the constituents, differ in the arms that bind the respective

substrates. The composition of the fluorophore/quencherfunctionalized substrates differs in the fluorophore/quencher pair associated with each substrate, and in the sequence of the substrate dictated by the “arm” of the DNAzyme. The rates of cleavage of the different substrates relate to the content of the respective constituent, and thus using appropriate calibration curves that probe the activities of variable concentrations of intact individual structures of each of the constituents, the equilibrated contents of all constituents can be quantitatively evaluated. Naturally, the activities of the DNAzymes associated with the different constituents vary, and hence appropriate calibration curves for all of the DNAzymes linked to the constituents should be derived. Figure 2C shows the equilibrated mixture of six constituents (each marked with a different color) positioned each at the vertices of a prism. The upper face of the prism includes at its vertices constituents that share a common component (B1) and similarly, the lower face includes at its vertices three constituents that share a common component (B2). The initial state of the mixture is CDN “I”. Subjecting the CDN to different triggers results in the adaptive reconfiguration of CDN “I” into new equilibrated CDN mixtures, following the principles outlined in the introduction. Namely, the stabilization of a constituent and its up-regulation is accompanied by the down-regulation of constituents that share components with the stabilized (enriched) constituents, and by the up-regulation of constituents that do not share components with the stabilized/enriched constituents. For example, triggering of CDN “I” with T1 that stabilizes the di-loop domain of constituents A1B2 (that yields A1B2-T1), is anticipated to yield CDN “II”, where the constituents A1B1, A2B2 and A3B2



Figure 3. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the six constituents of the [3×2] CDN systems: (i) CDN “I” before the application of trigger T1. (ii) After applying trigger T1 to CDN “I” and re-equilibration of CDN “I” to CDN “II”. (iii) After applying counter trigger T1' and the reverse equilibration of CDN “II” to CDN “I”. Percentages displayed within each plot correspond to the relative change of the respective constituent content upon applying trigger T1. The changes in the contents of the constituents were evaluated from the respective calibration curves, Figures S1 and S2. Note that upon applying counter trigger T1', the original contents of the constituents (curves (iii)) were restored. are down-regulated (constituents sharing components with A1B2T1), and concomitantly, the constituents A3B1 and A2B1 should be up-regulated. Figure 3 depicts the time-dependent fluorescence changes stimulated upon the cleavage of fluorophore/quenchermodified substrates by the respective DNAzyme reporter units associated with six constituents in CDN systems: CDN “I” before applying trigger T1, curves (i), after applying trigger T1 and the reconfiguration of CDN “I” to CDN “II” (equilibration time 12 hours), curves (ii), and after subjecting CDN “II” to the counter trigger T1', curves (iii). The rates of the cleavage of the substrates by the respective DNAzymes relate to the contents of the different constituents. Using appropriate calibration curves that relate the catalytic activities of the DNAzymes to the concentrations of the individual constituents, Figures S1 and S2, the contents of the constituents in different CDN states were evaluated. That is, subjecting CDN “I” to trigger T1 to yield CDN “II”, where A1B1, A2B2 and A3B2 are down-regulated by 58%, 39% and 59%, respectively, and the constituents A2B1, A3B1 and A1B2 are upregulated by 80%, 22% and 57%, respectively. Subjecting CDN “II” with the counter trigger T1' regenerates CDN “I”. In analogy, the treatment of CDN “I” with trigger T2 stabilizes the di-loop domain of A2B1 (A2B1-T2), that yields CDN “III”. The stabilization (up-regulation) of A2B1-T2 is accompanied by the upregulation of the agonist constituents A1B2 and A3B2, and the down-regulation of the constituents A1B1, A2B2 and A3B1. Figure 4 depicts the experimental results that demonstrate the T2-induced adaptive reconfiguration of CDN “I” into CDN “III”. Subjecting CDN “III” with the counter trigger T2' regenerates CDN “I”, thus also highlighting the reversibility of the equilibration of CDNs. In addition, Figure 2C shows schematically the effect of trigger T3 on the CDN “I”. The stabilization of the di-loop region of constituent A1B1 with trigger T3 leads to its up-regulation, and this is accompanied by the up-regulation of the agonist constituents A3B2 and A2B2 and the down-regulation of the constituents A1B2, A2B1 and A3B1. Figure 5 depicts the experimental results that confirm the expected adaptive reversible transitions between CDN “I” and CDN “IV”. Figure 5 shows the time-dependent fluorescence changes generated by the respective Mg2+-iondependent DNAzyme reporter units associated with the

Page 4 of 13

Figure 4. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the six constituents of the [3×2] CDN systems: (i) CDN “I” before the application of trigger T2. (ii) After applying trigger T2 to CDN “I” and re-equilibration of CDN “I” to CDN “III”. (iii) After applying counter trigger T2' and the reverse equilibration of CDN “III” to CDN “I”. Percentages displayed within each plot correspond to the relative change of the respective constituent content upon applying trigger T2. The contents of the constituents were evaluated from the activities of DNAzymes associated with respective constituents and the respective calibration curves, Figures S1 and S2. Note that upon applying counter trigger T2', the original contents of the constituents (curves (iii)) were restored.

Figure 5. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the six constituents of the [3×2] CDN systems: (i) CDN “I” before the application of trigger T3. (ii) After applying trigger T3 to CDN “I” and re-equilibration of CDN “I” to CDN “IV”. (iii) After applying counter trigger T3' and the reverse equilibration of CDN “IV” to CDN “I”. Percentages displayed within each plot correspond to the relative change of the respective constituent content upon applying trigger T3. The contents of the constituents were evaluated from the activities of DNAzymes associated with respective constituents and the respective calibration curves, Figures S1 and S2. Note that upon applying counter trigger T3', the original contents of the constituents (curves (iii)) were restored. constituents of CDN “I” before the application of trigger T3 (curves (i)), after subjecting CDN “I” to trigger T3 and formation of the re-equilibrated CDN “IV” (curves (ii)), and after subjecting CDN “IV” to counter trigger T3' and the regeneration of CDN “I” (curves (iii)). By the evaluation of the time-dependent fluorescence changes upon cleavage of the respective substrates by the DNAzyme reporters associated with constituents in the CDN systems, and using the appropriate calibration curves, Figures S1 and S2, the quantitative evaluation of the concentrations of these constituents upon the T3-triggered


Page 5 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transition of CDN “I” to CDN “IV” was possible. The experimental results are fully consistent with the adaptive feature of CDN “I”. We find that A1B1-T3 is up-regulated by 57%, which is accompanied by the increase of the contents of A2B2 and A3B2 by 39% and 32%, respectively. Concomitantly, the constituents A2B1, A3B1 and A1B2 are down-regulated by 60%, 43% and 73%, respectively. In addition, the transition of CDN “IV” to CDN “I”, in the presence of the counter trigger T3', is evident. CDN “II” formed upon triggering CDN “I” with T1 was further subjected to trigger T2, Figure 2C. This results in the further stabilization of the constituent A2B1-T2 that is further up-regulated together with A1B2-T1 to yield CDN “V”. Note, however, that the constituent A3B1 (in the first T1-triggered CDN “II”, this constituent was upregulated!) is now down-regulated since it exhibits antagonistic relations (sharing components) with A2B1-T2. That is, the four constituents A1B1, A2B2, A3B1 and A3B2 are down-regulated. Thus, the sequential treatment of CDN “I” with triggers T1 and T2 leads to a hierarchical control over the contents of the constituents in the CDNs. In the first step, three constituents (A1B2-T1, A2B1 and A3B1) were up-regulated, and in the second step applying T2, the content of one of the up-regulated constituents (A3B1) was depleted, while the constituents A1B2-T1 and A2B1-T2 are further enriched. Figure 6 shows the time-dependent fluorescence changes generated by the DNAzyme reporter units associated with CDN “V”. From the appropriate calibration curves, we evaluate the contents of the constituents. Note that in Figure 6, we show the concentration changes of the constituents upon subjecting CDN “II” to trigger T2 that yields CDN “V”, as compared to the original CDN “I”. Evidently, hierarchical control over the concentrations of the constituents is demonstrated. The constituents A2B1 and A1B2 are up-regulated by 161% and 73%, respectively, whereas constituents A1B1, A3B1, A2B2 and A3B2 are down-regulated by 68%, 45%, 76% and 47%, respectively. It should be noted that treatment of the original CDN “I” with the two triggers T1 and T2 yields, as expected, the same, hierarchically-controlled, CDN “V” as the equilibrated mixture. In analogy, CDN “IV” was subjected to trigger T2, Figure 2C. The stabilization of the constituent A2B1 in the form of A2B1-T2 upregulates this constituent (in the first T3-triggered CDN “I”, this constituent was down-regulated!). The stabilization of A2B1 is accompanied by the down-regulation of A1B1-T3 that was overexpressed in CDN “IV”, down-regulation of A2B2 and upregulation of A3B2, CDN “VI”, as compared to the first T3triggered CDN “IV” (Figure 5). Evidently, treatment of CDN “IV” with T2 heads to an adaptive, hierarchical control over the

contents of the constituents in CDN “VI”. Figure S3 shows the experimental results confirming the control over the concentrations of the constituents upon re-equilibration of CDN “IV” to CDN “VI”. The contents of A1B1, A2B1 and A3B2 increase by 33%, 34% and 76%, respectively, while the concentrations of A3B1, A1B2 and A2B2 decrease by 72%, 65% and 29%, respectively, as compared to original CDN “I”. The equilibrated contents of all constituents in CDN “I”–CDN “VI” were quantitatively evaluated using the respective calibration curves, Figures S1 and S2. The results are summarized in Table 1. To further evaluate the contents of the constituents in the different CDNs, quantitative gel electrophoresis experiments were performed (For the electrophoretic separation of the different constituent, and accompanying discussion see Figure S4). Table 1 (in brackets) summarizes the contents of the constituents in the different CDNs that were derived from the separated constituent bands. Very good agreement between the contents of the constituents in the different CDNs determined by the DNAzyme reporter units and by the electrophoretic experiments is obtained. The complexity of the CDN systems was enhanced by increasing the number of constituents in the network to yield a [3×3] CDN, Figure 7A. Each of the constituents includes a diloop domain for its stabilization by an appropriate trigger, Figure 7B, (i). In addition, each of the constituents includes a Mg2+-iondependent DNAzyme unit, and this acts as a catalytic reporter for probing its contents. The different DNAzyme reporter units differ in their substrate binding arms (presented in different colors). The cleavage of the respective fluorophore/quencher-functionalized substrates, Figure 7B, (ii), provides then a means to probe the contents of the constituents by following the rates of cleavage of the respective substrates and their comparison to calibration curves that relate the activities of intact individual constituents to their concentrations (vide infra). These catalytic sites will be used later to introduce controlled adaptive and hierarchical catalytic functions into the CDN systems (vide infra). Table 1. The concentrations of the six constituents of the equilibrated [3×2] CDNs in states “I”–“VI”. Values were determined from the respective catalytic rates of the respective DNAzyme reporter units associated with constituents, and using the appropriate calibration curves, and (in brackets) by staining the separated electrophoretic bands and using the ImageJ software to quantify the concentrations of the constituents, Figure S4 CDN I II III IV V

Figure 6. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the six constituents of the [3×2] CDN system, upon the adaptive and hierarchical reconfiguration of CDN state “I” into CDN state “V”, using two triggers T1 and T2: (i) CDN “I” before the application of triggers T1 and T2. (ii) After sequential application of triggers T1 and T2 to CDN “I”, and re-equilibration of CDN “I” to CDN “V”.

VIa

Concentrations (µM) [A1B1] 0.58 (0.56) 0.24 (-b) 0.36 (-b) 0.91e (0.93)e 0.19 (-b) 0.77e (0.80)e

(a)

[A1B2] 0.49 (0.46) 0.77c (-b) 0.69 (0.80) 0.13 (0.17) 0.85c (-b) 0.17 (0.26)

[A2B1] 0.35 (0.40) 0.63 (0.63) 0.66d (-b) 0.14 (0.20) 0.91d (-b) 0.47d (0.62)d

[A2B2] 0.66 (0.60) 0.40 (0.38) 0.24 (0.22) 0.92 (0.82) 0.16 (0.17) 0.46 (0.35)

[A3B1] 0.60 (0.58) 0.73 (0.70) 0.34 (0.35) 0.34 (0.40) 0.33 (0.42) 0.17 (0.20)

[A3B2] 0.38 (0.47) 0.16 (0.27) 0.50 (0.59) 0.50 (0.60) 0.20 (0.30) 0.67 (0.75)

Fluorescence data provided in Figure S3. (b)Concentrations cannot be evaluated due to the overlap of the bands. (c)A1B2 stabilized by trigger T1, [A1B2-T1]. (d)A2B1 stabilized by trigger T2, [A2B1-T2]. (e)A1B1 stabilized by trigger T3, [A1B1-T3]



Page 6 of 13

Figure 7. (A) Schematic configuration of a [3×3] nucleic acid-based CDN composed of nine supramolecular constituents. Each of the constituents includes a double-loop domain that can be stabilized by an auxiliary trigger strand, and a functional Mg2+-ion-dependent DNAzyme reporter unit. (B) Schematic stabilization of the constituent of the [3×3] CDN using an auxiliary trigger and the biocatalytic readout of the constituent contents by the Mg2+-ion-dependent DNAzyme reporter units: (i) Schematic stabilization of the double-loop domain of a constituent by the hybridization with an auxiliary trigger T that bridges the loop domain. (ii) The catalytic Mg2+-ion-dependent DNAzyme-induced cleavage of a fluorophore/quencher-functionalized substrate provides the process to quantitatively evaluate the contents of the constituents. (C) schematic adaptive reconfiguration of the [3×3] CDN in state “X” into three different CDNs in state “XI”, state “XII”, and state “XIII”, in the presence of triggers T4, T5, and T6, respectively, and the subsequent hierarchical reconfiguration of CDN “XI” and CDN “XII” into CDNs “XIV” and “XV”, respectively, using T6 as an auxiliary trigger. Figure 7C shows schematically the triggered adaptive and hierarchical reconfigurations of the [3×3] equilibrated CDNs. Subjecting of CDN “X” to trigger T4 stabilizes the constituent C2D2-T4. The stabilization of the constituent C2D2 leads to its upregulation and to the adaptive re-equilibration of CDN “X” to CDN “XI”, where the constituents C1D1, C3D1, C1D3 and C3D3 are also up-regulated (these constituents do not share components with C2D2). In turn, the constituents C2D1, C1D2, C3D2, and C2D3 are down-regulated (these constituents share components with the stabilized constituent, C2D2-T4). Figure 8 shows the timedependent fluorescence changes generated by the DNAzyme reporter units associated with constituents in CDN “X”, prior to the addition of T4, curves (i), and after the addition of T4 and the re-equilibration of the mixture to CDN “XI”, curves (ii). Using the appropriate calibration curves that relate to the catalytic activities of the intact individual constituents with variable concentrations, Figures S5 and S6, the contents of the constituents upon the transition of CDN “X” to CDN “XI” are evaluated. In addition to the constituent C2D2 that is up-regulated by 137%, the constituents C1D1, C3D1, C1D3 and C3D3 are up-regulated, as expected, by 25%, 52%, 43% and 26%, respectively. Simultaneously, the constituents C2D1, C1D2, C3D2 and C2D3 are down-regulated by 59%, 83%, 80% and 67%, respectively. The adaptive dynamic transitions of CDN “X” to CDN “XII”, upon subjecting CDN “X” to trigger T5, are schematically presented in Figure 7(C). The stabilization of the constituent C1D2 via the hybridization of T5 to the di-loop domain of this constituent yields C1D2-T5. Concomitant to the up-regulation of C1D2-T5, the constituents C2D1, C3D1, C2D3 and C3D3 are up-regulated.

Figure 8. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the six constituents of the [3×3] CDN systems: (i) CDN “X” before the application of trigger T4. (ii) After subjecting CDN “X” to trigger T4 and re-equilibration of the CDN to state “XI”. Percentages displayed within each plot correspond to the relative change of the respective constituent content upon applying trigger T4. The changes in the contents of the constituents were evaluated from the respective calibration curves, Figures S5 and S6.


Page 7 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Similarly, the antagonist-constituents C1D1, C2D2, C3D2 and C1D3 (these constituents share components with the stabilized constituent C1D2-T5) are down-regulated. Figure 9 shows the time-dependent fluorescence changes generated by the DNAzyme reporter units associated with constituents in CDN “X”, before the addition of T5, curves (i), and after treatment of CDN “X” with T5 and the generation of CDN “XII”, curves (ii). Using the appropriate calibration curves, Figures S5 and S6, the contents of constituents in different CDN states were evaluated. Besides the up-regulation of the T5-stabilized C1D2 constituent by 141%, the constituents C2D1, C3D1, C2D3 and C3D3 are up-regulated by 26%, 63%, 56% and 41%, respectively. Concomitantly, the constituents C1D1, C2D2, C3D2 and C1D3 (these constituents share components with C1D2) are down-regulated by 85%, 54%, 75% and 82%, respectively. In addition, subjecting CDN “X” to trigger T6 stabilizes the constituent C3D1, Figure 7C, resulting in its upregulation and the concomitant up-regulation of C1D2, C2D2, C1D3 and C2D3. Simultaneously, the constituents C1D1, C2D1, C3D2 and C3D3 are down-regulated. Figure S8 shows the catalytic activities of the DNAzymes reporters associated with the constituents before and after the treatment of CDN “X” with trigger T6. As expected, the adaptive T6-induced transition of CDN “X” to CDN “XIII” is accompanied by the increase in the contents of C3D1-T6, C1D2, C2D2, C1D3 and C2D3 by 183%, 29%, 35%, 22% and 24%, respectively. Simultaneously, the constituents C1D1, C2D1, C3D2 and C3D3 are down-regulated by 83%, 48%, 58% and 51%, respectively. The triggered hierarchical adaptive transitions of the [3×3] CDN are, also, exemplified in Figure 7C. Treatment of CDN “XI”, which is generated by subjecting CDN “X” to trigger T4, with trigger T6 stabilizes the constituent C3D1 resulting in CDN “XIV”. That is, in addition to the up-regulated C3D1-T6, the C2D2T4 and C1D3 are further up-regulated and the constituent C1D1 and C3D3, which were originally up-regulated in CDN “XI” are now down-regulated. That is, subjecting the original CDN “X” to trigger T4 resulted in the up-regulated selection of five constituents, and the

Figure 9. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the nine constituents of the [3×3] CDN systems: (i) CDN “X” before the application of trigger T5. (ii) After applying trigger T5 to CDN “X” and re-equilibration of the CDN to state “XII”. Percentages displayed within each plot correspond to the relative change of the respective constituent content upon applying trigger T5. The

changes in the contents of the constituents were evaluated from the respective calibration curves, Figures S5 and S6. subsequent stabilization of one of these constituents resulted in the further dictated (hierarchical) selection of only three upregulated constituents. Figure 10 demonstrates the adaptive hierarchical control over the contents of the constituents of CDNs upon the re-equilibration of CDN “XI” into CDN “XIV”, in the presence of T6. The selected three up-regulated constituents C3D1T6, C2D2-T4 and C1D3 increase in their contents by 204%, 150% and 101%, respectively, while all other constituents decrease in their contents in CDN “XIV”, as compared to the original CDN “X”. As noted earlier, the simultaneous treatment of CDN “X” with the two triggers T4 and T6 yields the composition of CDN “XIV” shown in Figure 10, implying the self-selective adaptation and hierarchical control over the equilibration of CDN “XIV”. In analogy, treatment of CDN “XII” with trigger T6 leads to the stabilization of the constituent C3D1-T6 and the formation of the equilibrated CDN “XV”. Under these conditions, out of the five up-regulated constituents in CDN “XII”, two constituents, C2D1 and C3D3, that share components with the stabilized constituent C3D1-T6, are down-regulated. This results in the dictated selective adaptive and hierarchical self-organized enrichment of three constituents, C3D1, C1D2 and C2D3 out of the nine constituents. Figure S9 depicts the activities of the DNAzyme reporter units associated with constituents upon triggering CDN “XII” with T6. The three constituents C3D1, C1D2 and C2D3 increase in their contents by 264%, 153% and 108%, while the contents of all other constituents decrease in their contents in the resulting CDN “XV” mixture, as compared to the original CDN “X”. These results confirm nicely the dictated hierarchical trigger-controlled selection of a limited set of constituents out of a mixture of dynamically equilibrated constituents. Again, we note that treatment of CDN “X” with two triggers T5 and T6 yields the equilibrated CDN “XV” as the dynamically equilibrated mixture of constituents. As for the [3×2] CDNs, the triggered transitions of CDN “X” to CDNs “XI”, “XII”, “XIII”, “XIV” and “XV” reveal reversibility upon the application of the respective counter triggers. This is exemplified in Figure S10.

Figure 10. Time-dependent fluorescence changes generated by the Mg2+-ion-dependent DNAzyme reporter units associated with the nine constituents of the [3×3] CDN systems, upon the adaptive and hierarchical reconfiguration of CDN state “X” into CDN state “XIV”, using two trigger T4 and T6: (i) CDN “X” before the application of triggers T4 and T6. (ii) After the treatment of CDN “X” with triggers T4 and T6, and reequilibration of CDN “X” to CDN “XIV”.



Figure 11. The electrophoretic separation of the constituents of the CDNs “X”−“XV”. Lanes 1 to 12 correspond to the stained intact constituents associated with CDNs “X”−“XV”: Lane 1−C1D1, Lane 2−C1D2, Lane 3−C1D3, Lane 4−C2D1, Lane 5−C2D2, Lane 6−C2D3, Lane 7−C3D1, Lane 8−C3D2, Lane 9−C3D3, Lane 10−C2D2-T4, Lane 11−C1D2-T5, and Lane 12−C3D1-T6. Lane 13−the separated bands of CDN “X”. Lane 14−the separated constituents of CDN “XI”, generated upon subjecting CDN “X” to trigger T4. Lane 15−the separated constituents of CDN “XII”, generated upon subjecting CDN “X” to trigger T5. Lane 16−the separated constituents of CDN “XIII”, generated upon subjecting CDN “X” to trigger T6. Lane 17− the bands of the separated constituents of CDN “XV”, generated upon the treatment of CDN “XII” with trigger T6. Lane 18− the bands of the separated constituents of CDN “XIV”, generated upon the treatment of CDN “XI” with trigger T6. The activities of the DNAzyme reporters linked to the constituents in different CDNs “X”−“XV” (Figure 8−Figure 10 and Figures S8 and S9), and the calibration curves allowed us to evaluate the concentrations of the constituents in the equilibrated CDNs “X”−“XV”. Table 2 summarizes the concentrations of the constituents in the different CDNs. Further support for the quantitative assessment of the contents of the constituents in different CDNs was obtained from quantitative gel electrophoresis experiments. Figure 11 shows the electrophoretic separation of the constituents associated with the triggered transitions of CDN “X” to CNDs “XI”, “XII” and “XIII”, using triggers T4, T5 and T6, respectively. In addition, the quantitative electrophoretic separation of the constituents corresponding to the hierarchical transition of CDN “XI” to CDN “XIV” using trigger T6, and of CDN “XII” to CDN “XV” using trigger T6, are presented. In these experiments, the page gel consisted of 12% acrylamide/bisacrylamide (19:1) and the constituents were separated using an applied potential of 150 V for 40 hours, at 6 oC. The respective separated bands were compared to the individual bands of the intact constituents. The separated bands were stained with the SYBR Gold, and the intensities of the different bands, corresponding to the respective constituents in the different networks, were quantitatively analyzed using the ImageJ software, by comparing the intensities of the stained separated bands to the intensities of the intact individual stained constituent at a known concentration (1 µM). Table 2 (in brackets) summarizes the equilibrated concentrations of the constituents in the different CDNs, as derived from the electrophoretic experiments. Very good agreement is obtained between the two methods to assess the concentrations of the constituents in the different CDNs. It should be noted that the results presented in Figure 8, Figure 9 and Figure S8 applied one, identical, concentration of the triggers T4, T5 and T6 (1 µM). One would expect, however, that controlled alternative of the triggers concentration would change the equilibrated composition of the resulting CDNs. Thus, the compositions of the resulting CDNs could be tuned by the

Page 8 of 13

concentrations of the triggers. This is exemplified in Figure S11 by probing the effect of the concentration of the trigger T4 on the equilibrated content of the constituents C3D1, Figure S11(A) and C2D1, Figure S11(B). As expected, as the concentration of the trigger T4 increases the constituent C3D1 is up-regulated (C3D1 does not share components with C2D2-T4), whereas the constituent C2D1 is down-regulated as the concentration of T4 is elevated (C2D1 shares components with C2D2-T4). In addition, we would expect that the “strength” of the triggering strand, which stabilizes the respective constituents and stimulates the transitions of CDN “X” to the different CDNs would affect the resulting equilibrated composition of the respective CDNs. This is exemplified in Figure S12, where the “strength” (length) of the triggering strand T4, stimulating the transition of CDN “X” to the different CDNs, is examined. Figure S12 presents the effect of three different triggering strands, e.g., T4, T4-1, T4-2 on the content of the constituents C3D1 and C2D1, upon the triggered transition of CDN “X” to different CDN states. As expected, as the triggering length increases, the stabilization of the constituent C2D2-Ti is enhanced, resulting in the up-regulation of C3D1, Figure S12(A), and downregulation of C2D1, Figure S12(B). Table 2. The concentrations of the nine constituents in the equilibrated [3×3] CDNs in states “X”−“XV” (values determined from the catalytic rates of DNAzyme reporter units associated with constituents, using the appropriate calibration curves, and (in brackets) by staining the separated electrophoretic bands and using the ImageJ software to quantify the concentrations of the constituents, Figure 11) Concentrations (µM) CDN [C1D1] [C1D2] [C1D3] [C2D1] [C2D2] [C2D3] [C3D1] [C3D2] [C3D3] 0.38 (0.37) 0.47 XI (0.45) 0.06 XII (0.07) 0.06 XIIIa (0.10) 0.08 XIV (0.11) XVa 0.10 (0.07) X

0.32 (0.39) 0.05 (0.06) 0.77d (0.77)d 0.41 (-b) 0.07d (-b) 0.81d (0.83)d

(a)

0.41 (0.36) 0.58 (0.48) 0.07 (0.11) 0.50 (0.52) 0.82 (0.77) 0.18 (0.10)

0.35 (0.36) 0.14 (0.08) 0.44 (0.43) 0.18 (0.12) 0.11 (0.11) 0.09 (0.15)

0.33 (0.37) 0.78c (0.80c) 0.15 (0.14) 0.44 (0.52) 0.82c (0.84)c 0.17 (0.15)

0.32 (0.35) 0.10 (0.09) 0.50 (0.54) 0.39 (0.44) 0.07 (0.07) 0.66 (0.71)

0.24 (0.30) 0.36 (0.48) 0.39 (0.43) 0.68e (-b) 0.73e (-b) 0.87e (-b)

0.45 (0.38) 0.09 (0.09) 0.11 (0.13) 0.19 (0.25) 0.08 (0.04) 0.04 (0.05)

0.35 (0.33) 0.44 (0.45) 0.49 (0.50) 0.17 (0.18) 0.16 (0.07) 0.16 (0.13)

Fluorescence data provided in Figures S8 and S9. Concentrations cannot be evaluated due to the overlap of the bands. (c)C2D2 stabilized by trigger T4, [C2D2-T4]. (d)C1D2 stabilized by trigger T5, [C1D2-T5]. (e)C3D1 stabilized by trigger T6, [C3D1-T6]. As stated in the introduction, the major challenge in the CDNs is the design of emerging functions from the triggered adaptive transitions of the CDNs. The successful adaptive and hierarchical transitions of the CDNs across different states that are dictated by cooperatively operating triggers provide a means to control emerging functions of the CDNs. We were able to demonstrate the control over emerging catalytic functions from the CDNs, upon the triggered adaptive transitions between the CDNs. The first system is presented in Figure 12, and it makes use of the sequential equilibrated transitions CDN “X” → CDN “XII” → CDN “XV”. The equilibrated CDN “X” was interacted, in the absence of the fluorophore/quencher-modified substrates, with three ribonucleobase-functionalized hairpin structures H1, H2 and H3, Figure 12A. These hairpin structures act as substrates for the constituents C1D2, C2D3 and C3D1 in respective CDNs. The hairpin structures H1, H2 and H3 include caged engineered sequences. Upon the cleavage of the hairpin substrates by the DNAzyme units associated with the constituents C1D2, C2D3 and (b)


Page 9 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 12. (A) Hierarchical adaptive control over the catalytic functions of the [3×3] CDN systems triggered sequentially by triggers T5 and T6. Subjecting the CDN to T5 yields the CDN “XII”, and the cleavage of hairpins H1, H2 and H3 by the upregulated constituents yields the supramolecular catalytic Mg2+ion-dependent DNAzyme structure P1. The subsequent treatment of CDN, state “XII” with trigger T6 leads CDN in state “XV”, where further hierarchical up-regulation of the constituents leading to the supramolecular catalytic Mg2+-ion-dependent DNAzyme structure P1 proceeds. (B) Time-dependent catalyzed cleavage of the fluorophore/quencher-modified substrate S by the supramolecular complex generated by: (a) The CDN “X” prior to the application of auxiliary triggers. (b) After subjecting CDN “X” to trigger T5 and adaptive equilibration that yields CDN “XII”. (c) After treatment of the CDN “XII” with trigger T6 and its hierarchical adaptive reconfiguration into the CDN “XV”. C3D1, the strand H1-1, H2-1 and H3-1 are formed. The cleaved-off strands include, however, the encoded base-sequence information to assemble into the supramolecular Mg2+-ion-dependent DNAzyme unit P1. The time-dependent fluorescence changes upon the cleavage of the fluorophore/quencher-functionalized substrate S provides the readout signal that corresponds to the catalytic properties of the supramolecular DNAzyme that emerges from the operating network(s). Figure 12B presents that timedependent fluorescence changes that originate from the cleavage of the substrate S by the supramolecular complex P1 generated by the initial CDN “X”, curve (a), after triggering the transition of CDN “X” to CDN “XII”, using trigger T5, curve (b), and after subjecting CDN “XII” to trigger T6 that yields CDN “XV”, curve (c). One may realize low catalytic activity of the supramolecular complex P1 in the presence of CDN “X”, implying low content of the DNAzyme. Using an appropriate calibration curve that relates the activity of P1 to its content, Figure S13, we conclude that the concentration of P1 in CDN “X” corresponds to 0.31 µM. The transition of CDN “X” to “XII” leads to an increased catalytic activity of P1, implying higher content, curve (b). From the

calibration curve, Figure S13, we evaluate a 71% increase in the content of P1, generated by CDN “XII”. The transition of CDN “XII” to CDN “XV” results in a substantially higher activity of P1, curve (c), that corresponds to a 145 % increase of the content of P1 generated by CDN “XV”, as compared to the content of P1 in CDN “X”. That is, a sequential hierarchical control of the catalytic functions of the DNAzyme P1 is observed upon the reconfiguration of CDN “X” in the presence of the appropriate triggers. The low catalytic activity of DNAzyme P1 in the presence of CDN “X” is due to the relatively low concentrations of the constituents C1D2, C2D3 and C3D1. Subjecting CDN “X” to trigger T5 yields CDN “XII” where five constituents are upregulated, among them, the contents of the constituents C1D2, C2D3 and C3D1 increase, and thus the catalytic activity of DNAzyme P1 is enhanced. The subsequent treatment of CDN “XII” with trigger T6 transforms CDN “XII” into CDN “XV”. This process filters further the up-regulated constituents and only C1D2, C2D3 and C3D1 are enriched. The relatively high concentrations of these constituents lead to the 145% enhanced catalytic activity of the DNAzyme P1, as compared to the activity of the DNAzyme in the presence of the parent CDN “X”. A further adaptive and hierarchic control over emerging catalytic functions by CDNs is exemplified in Figure 13. The emerging catalytic functions are reflected by the CDN-driven formation of the hemin/G-quadruplex horseradish peroxidasemimicking DNAzyme. In this system, CDN “X” is subjected to three hairpin structures H4, H5 and H6 that include in their single strand loops ribonucleobase sequences that can bind and cleave by the DNAzyme units associated with C1D3, C2D2 and C3D1. The stem regions of the hairpins H5 and H6 include caged G-rich sequences that provide upon uncaging, G-quadruplex subunits, and the stem region of H4 includes an engineered sequence that upon uncaging bridges the G-quadruplex subunits to cooperatively stabilizes the hemin/G-quadruplex subunits to yield the hemin/G-quadruplex DNAzyme, P2. Treatment of CDN “X” with the three hairpin triggers H4, H5, H6 leads to the cleavage of the respective loop regions and to the separation of the strands H4+ 1, H5-1 and H6-1. These strands self-assemble into a K -ion stabilized G-quadruplex supramolecular complex that is composed of the G-rich strands H5-1 and H6-1 that are cooperatively stabilized by H4-1, Figure 13A. The binding of hemin to the resulting G-quadruplex yields the hemin/Gquadruplex DNAzyme, P2. The latter DNAzyme catalyzes the oxidation of Amplex Red by H2O2 to form the fluorescent Resorufin product. The time-dependent fluorescence changes in the system provide, then, the readout signal for the activity of the DNAzyme. Figure 13B, curve (a) shows the time-dependent fluorescence changes induced by the hemin/G-quadruplex DNAzyme, generated by the equilibrated CDN “X”. Using an appropriate calibration curve that relates the activity of P2 to its content, Figure S14, we conclude that the concentration of P2 in CDN “X” corresponds to 0.48 µM. Treatment of CDN “X” with trigger T4 results in the adaptive formation of the equilibrated CDN “XI” where the constituents C1D1, C2D2, C3D1, C1D3 and C3D3 are up-regulated. Three of these constituents participate in the formation of the hemin/G-quadruplex DNAzyme. Figure 13B, curve (b), shows the activity of the resulting hemin/G-quadruplex of CDN “XI” reflected by the time-dependent fluorescence changes of Resorufin. Evidently, the up-regulation of the constituents C1D3, C2D2 and C3D1, in CDN “XI” leads to a 34% increase in the content of the hemin/G- quadruplex, using the calibration curve, Figure S14. Finally, CDN “XI” was subjected to trigger T6, resulting in the adaptive formation of the equilibrated CDN “XIV”. The T6-induced transition of CDN “XI” to CDN “XIV” results in the further hierarchical up-regulation of the constituents C1D3, C2D2 and C3D1 (on the expense of C1D1



Figure 13. (A) Hierarchical adaptive control over the catalytic functions of the [3×3] CDN network triggered sequentially by triggers T4 and T6. Subjecting the [3×3] CDN to T4 yields the CDN in state “XI”, and the cleavage of hairpins H4, H5 and H6 by the up-regulated constituents yields the supramolecular catalytic structure P2. The subsequent treatment of the CDN, state “XI” with trigger T4 leads CDN in state “XIV”, where further hierarchical up-regulation of the constituents leading to the supramolecular catalytic hemin/G-quadruplex DNAzyme structure P2 proceeds. (B) Time-dependent fluorescence changes induced by the hemin/G-quadruplex DNAzyme generated by: (a) The [3×3] CDN system prior to the application of auxiliary triggers. (b) After subjecting the CDN, state “X”, to trigger T4 and adaptive equilibration to yield the CDN in state “XI”. (c) After treatment of CDN in state “XI” with trigger T6 and its hierarchical adaptive reconfiguration into the CDN in state “XIV” and C3D3 that were down-regulated). These three up-regulated constituents are the key players in CDN “XIV”-stimulated cleavage of the hairpins H4, H5 and H6, and the assembly of the supramolecular hemin/G-quadruplex DNAzyme P2. The effective formation of P2 by the up-regulated constituents leads to a further increase in the time-dependent fluorescence changes of the Resorufin product. We find that the sequential adaptive transitions of CDN “X” to CDN “XIV” results in a substantially higher activity of P2, curve (c), which corresponds to an 81 % increase of the content of P2 generated by CDN “XIV”, as compared to the content of P2 in CDN “X”.

CONCLUSIONS The present study has demonstrated the construction of multiconstituent [3×2] and [3×3] DNA-based constitutional dynamic networks. Besides the enhanced complexity of these networks, as compared to simple two-dimensional four-constituent networks, the multi-components dynamic networks revealed unique functional properties: (a) The multi-component CDN

Page 10 of 13

systemsrepresent a set of intra-communicating [2×2] networks-in [3×3] network system that responds to a variety of external triggers. (b) The external-triggering of the multi-constituent CDNs leads to the formation of a variety of dictated adaptive upregulated/down-regulated CDNs. (c) By subjecting the CDN to two sequential triggers, the adaptive and hierarchical reconfiguration of the multi-constituent CDNs into the selected equilibrated network was demonstrated. In addition, the triggered adaptive and hierarchical transitions of multi-constituent CDNs into dictated selected networks, were applied to control chemical functions by the networks. Specifically, we highlighted control over catalytic activities of DNAzyme by means of the triggered networks. (d) The adaptive and hierarchical performance of the multi-constituent CDNs and their emerging functions demonstrated information transfer and signal propagation features. The present study demonstrated the effective scaling of [2×2] networks into [3×2] and [3×3] networks. These achievements originated from the design flexibility of the nucleic acid constituents and from the availability of the large number of DNAzyme reporter units that provide quantitative readout signals for the concentrations of the constituents in the different CDNs. Realizing these advantages of nucleic acids as functional components of the constituents in the CDNs, we do not foresee difficulties to scale the CDNs to higher [ni×nj] network sizes. In fact, by controlling the triggerable loop sequences and the linkage of additional DNAzyme reporter units, networks of higher multiplicity can be easily envisaged. The availability of many different cofactor-dependent DNAzymes that cleave fluorophore/quencher-functionalized substrates ensures the availability for readout signals of the scaled CDNs. Furthermore, our study has emphasized the tunability of up-regulations and down-regulations of the equilibrated constituents by controlling the concentrations and compositions of the triggers that activate the transitions between CDNs. A future challenging effort would involve, however, the formulation of kinetic schemes that simulate the transitions between CDNs and provide quantitative predictions regarding the compositions of the CDNs under different auxiliary environmental conditions. Indeed, recent efforts toward this goal were recently addressed by us.28 The study has highlighted the possibility to mimic complex natural network by oligonucleotide-engineered dynamically adaptive CDNs. It is, however, important to address the future challenges in the field. Inspired by nature where complex transformations, e.g., cell differentiation, are dominated by successive activation and silencing by gene regulatory networks,29 suggest that mimicking such systems by the triggered inter-substitution of CDNs could lead to interchangeable networks that reveal regulatory emerging functions. Furthermore, the significant progress in designing complex networks was demonstrated, the basic phenomenon addressing the evolution of the basic [2×2] network remains an enigma. We believe that the information encoded in oligonucleotide structures in the form of sequencespecific recognition and catalytic functions paves the way to construct functional units to evolve CDNs of variable complexity.

EXPERIMENTAL SECTION The nucleic acid sequences used in the study include: A1: 5’- GATATCAGCGATCAGTAAACACTTGATTTATTTCT ACAATCAACAAATGACCACCCATGT- 3’; A2: 5’- CTGCTC AGCGATCAGTAAACACCTTCTACCTTTCTCTACTTAACA AATGACCACCCATGTTCCTGA- 3’; A3: 5’- AGCGATCAG TAAACACCTGTCTTATCACACTTACACACAAATGACCAC CCATGTTTCAGT- 3’; B1: 5’- CTGTTCAGCGATGTCATTT GTATCTCTCTGTCTCTTCTCTTATGTTTACTGCACCCATG TTACTCT- 3’; B2: 5’- GTCCTCAGCGATGTCATTTGTCTCT


Page 11 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TTCTCTACTTCTTCTCTTGTTTACTGCACCCATGTTCGTC A- 3’; C1: 5’- GATATCAGCGATCAGTAACCACTTCAACT TCTTCTACAATCAACAAATGACCACCCATGT- 3’; C2: 5’CTGCTCAGCGATCAGTAACCACCATCTACCTTCCACTAC TTAACAAATGACCACCCATGTTCCTGA- 3’; C3: 5’- AGCG ATCAGTAACCACATACCTTATCACACTTACACACAAATG ACCACCCATGTTTCAGT- 3’; D1: 5’- TCCAGCAGCGATGT CATTTGTATCATTCTATCACTTCAATCTTGGTTACTGCAC CCATGTTCGTCA- 3’; D2: 5’- CTGTTCAGCGATGTCATTTG TCTTTATCACTACTTCTTCACTTGGTTACTGCACCCATGT TACTCT- 3’; D3: 5’- GTCCTCAGCGATGTCATTTGTCCTTT CTCTTACACTTCTTTCTGGTTACTGCACCCATGTTGTACG - 3’; T1: 5’- TAGAGAAAGAGGTGATTGTAGAA- 3’; T1': 5’TTCTACAATCACCTCTTTCTCTA- 3’; T2: ACAGAGAGATC GTAAGTAGAGAA; T2': 5’- TTCTCTACTTACGATCTCTCT GT- 3’; T3: 5’- ACAGAGAGATCGTGATTGTAGAA- 3’; T3': 5’-TTCTACAATCACGATCTCTCTGT3’; T4: 5’- AAGTAGTG ATCTAGTGGAAGG- 3’; T5: 5’- GAAGTTGAAGCAGTGAAG AAG- 3’; T6: 5’- GATAAGGTATGCAGATTGAAGTG-3’; H1: 5’- TGCTGTTTCAGAAAAGAGTATrAGGATATCAAAGT GTCTGAAACAGCAGTGAT- 3’; H2: 5’- CCATTCAGCGATT AACTTCAGACACTTATCAGGATrAGGAGGACAAGTGT3’; H3:5’-AGTGATTACTGAATrAGGCTGGAAATCACTG CTGTGTTACACCCATGTTCCTGA- 3’; H4: 5’-CACTTGGT CACTTTTAGAGTATrAGGAGCAGAGTAGTGACCAAGTGT CG- 3’; H5: 5’- GTGGGTGTCACTACTAGCGTACATrAGG ATATCTTTTGACACCC- 3’; H6: 5’- CCCACAAGAAAACTG AATrAGGCTGGAATCGACACTTGTGGGTGGGTGG-3’; sub1 (A1B1, C1D2): 5’-FAM-AGAGTATrAGGATATC-BHQ13’; sub2 (A2B2, C2D1): 5’- ROX- TGACGATrAGGAGCAGBHQ2- 3’ sub3 (A2B1, C2D2): Cy5- AGAGTATrAGGAGCAGBHQ2-3’; sub4 (A1B2, C1D1): 5’Cy5.5TGACGATrAGGATATC-IBRQ- 3’; sub5 (A3B1, C3D2): 5’FAM-ACTGAATrAGGAACAG-BHQ1-3’; sub6 (C2D3) 5’ROX–TCAGGATrAGGAGGAC-BHQ2-3’; sub7 (A3B2, C3D3) 5’- Cy5-ACTGAATrAGGAGGAC-BHQ2-3’; sub8 (C3D1): 5’FAM-ACTGAATrAGGCTGGA-BHQ1-3’; sub9 (C1D3): 5’FAM-CGTACATrAGGATATC-BHQ1-3’; sub10 (P1): 5’- ROXTCAGGATrAGGAATGG-BHQ2-3’; sub1-noFQ (A1B1, C1D2): 5’-AGAGTATrAGGATATC-3’; sub2-noFQ (A2B2, C2D1): 5’TGACGATrAGGAGCAG-3’; sub3-noFQ (A2B1, C2D2): 5’AGAGTATrAGGAGCAG-3’; sub4-noFQ (A1B2, C1D1): 5’TGACGATrAGGATATC-3’; sub5-noFQ (A3B1, C3D2): 5’ACTGAATrAGGAACAG-3’; sub6-noFQ (C2D3): 5’TCAGGATrAGGAGGAC-3’; sub7-noFQ (A3B2, C3D3): 5’ACTGAATrAGGAGGAC-3’; sub8-noFQ (C3D1): 5’ACTGAATrAGGCTGGA-3’; sub9-noFQ (C1D3): 5’CGTACATrAGGATATC-3’ The ribonucleobase cleavage site, rA, in the substrates of the different Mg2+-ion-dependent DNAzymes is indicated in bold, the respective Mg2+-ion-dependent DNAzyme sequences are underlined. Details on the preparation of the CDNs, the quantitative evaluation of the constituents of the CDNs, and details on the quantitative page-gel separation of the constituents associated with the different CDNs are provided in the supporting information. Probing the constituents in the CDNs. Taking [3×3] CDN “X” as an example, 100 µL of the equilibrated mixture of C1D1, C2D1, C3D1, C1D2, C2D2, C3D2, C1D3, C2D3 and C3D3 (CDN “X”, 1 µM) was treated with the corresponding fluorophore/quencher substrate and other substrates without fluorophore/quencher pair. As an example, to probe constituent C1D1, 100 µL of the equilibrated mixture of C1D1, C2D1, C3D1, C1D2, C2D2, C3D2, C1D3, C2D3 and C3D3 was treated with sub4 and sub1-noFQ, sub2-noFQ, sub3-noFQ, sub5-noFQ, sub6-noFQ, sub7-noFQ and

sub8-noFQ, 5 µL of 100 µM each. Subsequently, the timedependent fluorescence change generated from the cleavage of sub4 by the Mg2+-ion-dependent DNAzyme associated with the C1D1 was followed. Using the appropriate calibration curves corresponding to the cleavage rates of the different substrates by the intact constituents with different concentrations (see detailed description in Figure S5 and S6 for [3×3] CDN), the contents of the constituents in the different CDNs were evaluated. The changes in the fluorescence intensities, as a result of the DNAzyme catalyzed cleavage of the respective substrates, ∆F, correspond to the measured fluorescence values, Fi, from which the background fluorescence of the respective fluorophore associated with the substrate, F0, was subtracted. Probing the Catalytic Functions of [3×3] CDNs. For the function of supramolecular Mg2+-ion-dependent DNAzyme (P1), the equilibrated mixtures of CDN “X”, CDN “XII” or CDN “XV” (100 µL, 1 µM) was subjected to three hairpins H1, H2 and H3 (20 µL, 20 µM each), and was allowed to equilibrate at 28 oC. After 12 h, the mixture was treated with sub10. Subsequently, the timedependent fluorescence changes generated from the cleavage of sub10 by the supramolecular Mg2+-ion-dependent DNAzyme (P1), were followed. For the function of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme (P2), the equilibrated mixture of CDN “X”, CDN “XI” or “XIV” (100 µL, 1 µM), was subjected to three hairpins H4, H5 and H6 (20 µL 20 µM each), hemin (2 µM) and K+ (100 mM), and was allowed to equilibrate at 28 oC. After incubation for 12 h, the solution (30 µL) was treated with HEPES buffer (10 mM HEPES, 20 mM MgCl2 and 100 mM KCl), including Amplex Red (66.7 µM) and H2O2 (330 µM), to a total volume of 150 µL, to allow the oxidation of Amplex Red by H2O2 to fluorescent Resorufin product. The catalytic activities were probed by following the time-dependent fluorescence changes.

ASSOCIATED CONTENT Supporting Information Materials and instrumentation, methods and systems, measurements, the quantitative evaluation of the contents of the constituents of the CDNs described in Figure 2 and Figure 7 by gel electrophoresis, calibration curves, and additional results are provided. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *[email protected] Author Contributions §

These authors contributed equally.

Notes The authors declare no competing financial interests.

ACKNOWLEDGMENT This research is supported by The Minerva Center for Biohybrid Complex Systems.

REFERENCES (1) a) Jaenisch, R.; Bird, A. Nat. Genet 2003, 33, 245-254; b) Vogel, C.; Marcotte, E. M. Nat. Rev. Genet. 2012, 13, 227-232. (2) Ma'ayan, A.; Jenkins, S. L.; Neves, S.; Hasseldine, A.; Grace, E.; Dubin-Thaler, B.; Eungdamrong, N. J.; Weng, G.;



Ram, P. T.; Rice, J. J.; Kershenbaum, A.; Stolovitzky, G. A.; Blitzer, R. D.; Iyengar, R. Science 2005, 309, 1078-1083. (3) Bhalla, U. S.; Ram, P. T.; Iyengar, R. Science 2002, 297, 1018-1023. (4) a) Angeli, D.; Ferrell, J. E.; Sontag, E. D. Proc. Natl. Acad. Sci. USA 2004, 101, 1822-1827; b) Atkinson, M. R.; Savageau, M. A.; Myers, J. T.; Ninfa, A. J. Cell 2003, 113, 597-607; c) Yeger-Lotem, E.; Sattath, S.; Kashtan, N.; Itzkovitz, S.; Milo, R.; Pinter, R. Y.; Alon, U.; Margalit, H. Proc. Natl. Acad. Sci. USA 2004, 101, 5934-5939. (5) Davidson, E.; Levin, M. Proc. Natl. Acad. Sci. USA 2005, 102, 4935-4935. (6) a) Lehn, J.-M. Chem. Soc. Rev. 2007, 36, 151-160; b) Rowan, S. J.; Cantrill, S. J.; Cousins, G. R. L.; Sanders, J. K. M.; Stoddart, J. F. Angew. Chem. Int. Ed. 2002, 41, 898-952. (7) a) Belowich, M. E.; Stoddart, J. F. Chem. Soc. Rev. 2012, 41, 2003-2024; b) Hunt, R. A. R.; Otto, S. Chem. Commun. 2011, 47, 847-858. (8) a) Lehn, J.-M. Angew. Chem. Int. Ed. 2015, 54, 3276-3289; b) Corbett, P. T.; Leclaire, J.; Vial, L.; West, K. R.; Wietor, J.-L.; Sanders, J. K. M.; Otto, S. Chem. Rev. 2006, 106, 3652-3711; c) Herrmann, A. Chem. Soc. Rev. 2014, 43, 1899-1933; d) Holub, J.; Vantomme, G.; Lehn, J.-M. J. Am. Chem. Soc. 2016, 138, 1178311791; e) Giuseppone, N.; Schmitt, J.-L.; Lehn, J.-M. Angew. Chem. Int. Ed. 2004, 43, 4902-4906; f) Vantomme, G.; Jiang, S.; Lehn, J.-M. J. Am. Chem. Soc. 2014, 136, 9509-9518. (9) Severin, K. Chem. Eur. J. 2004, 10, 2565-2580. (10) a) Nitschke, J. R. Nature 2009, 462, 736-738; b) Peyralans, J. J. P.; Otto, S. Curr. Opin. Chem. Biol. 2009, 13, 705-713; c) Giuseppone, N. Acc. Chem. Res. 2012, 45, 2178-2188; d) Li, J.; Nowak, P.; Otto, S. J. Am. Chem. Soc. 2013, 135, 9222-9239. (11) Men, G.; Lehn, J.-M. J. Am. Chem. Soc. 2017, 139, 24742483. (12) a) Lee, D. H.; Severin, K.; Yokobayashi, Y.; Ghadiri, M. R. Nature 1997, 390, 591-594; b) Ashkenasy, G.; Jagasia, R.; Yadav, M.; Ghadiri, M. R. Proc. Natl. Acad. Sci. USA 2004, 101, 10872-10877; c) Ashkenasy, G.; Ghadiri, M. R. J. Am. Chem. Soc. 2004, 126, 11140-11141; d) Dadon, Z.; Wagner, N.; Ashkenasy, G. Angew. Chem. Int. Ed. 2008, 47, 6128-6136. (13) a) Padirac, A.; Fujii, T.; Estévez-Torres, A.; Rondelez, Y. J. Am. Chem. Soc. 2013, 135, 14586-14592; b) Gines, G.; Zadorin, A. S.; Galas, J. C.; Fujii, T.; Estevez-Torres, A.; Rondelez, Y. Nat. Nanotech. 2017, 12, 351-359; c) Genot, A. J.; Baccouche, A.; Sieskind, R.; Aubert-Kato, N.; Bredeche, N.; Bartolo, J. F.; Taly, V.; Fujii, T.; Rondelez, Y. Nat. Chem. 2016, 8, 760-767. (14) a) Shan, W.; Yue, L.; Li, Z.-Y.; Zhang, J.; Tian, H.; Willner, I. Angew. Chem. 2018, 130, 8237-8241; b) Wang, S.; Yue, L.; Shpilt, Z.; Cecconello, A.; Kahn, J. S.; Lehn, J.-M.; Willner, I. J. Am. Chem. Soc. 2017, 139, 9662-9671; c) Yue, L.; Wang, S.; Cecconello, A.; Lehn, J.-M.; Willner, I. ACS Nano 2017, 11, 12027-12036. (15) a) Zhang, D. Y.; Turberfield, A. J.; Yurke, B.; Winfree, E. Science 2007, 318, 1121-1125; b) Wang, F.; Liu, X.; Willner, I. Angew. Chem. Int. Ed. 2015, 54, 1098-1129. (16) a) Zhang, D. Y.; Seelig, G. Nat. Chem. 2011, 3, 103-113; b) Wang, F.; Lu, C.-H.; Willner, I. Chem. Rev. 2014, 114, 28812941. (17) Gehring, K.; Leroy, J.-L.; Guéron, M. Nature 1993, 363, 561-565. (18) a) Hu, Y.; Cecconello, A.; Idili, A.; Ricci, F.; Willner, I. Angew. Chem. Int. Ed. 2017, 56, 15210-15233; b) Ranallo, S.; Prévost-Tremblay, C.; Idili, A.; Vallée-Bélisle, A.; Ricci, F. Nat. Commun. 2017, 8, 15150. (19) a) Lu, C.-H.; Qi, X.-J.; Orbach, R.; Yang, H.-H.; MironiHarpaz, I.; Seliktar, D.; Willner, I. Nano Lett. 2013, 13, 12981302; b) Aleman-Garcia, M. A.; Orbach, R.; Willner, I. Chem. Eur. J. 2014, 20, 5619-5624.

Page 12 of 13

(20) a) Asanuma, H.; Ito, T.; Yoshida, T.; Liang, X.; Komiyama, M. Angew. Chem. Int. Ed. 1999, 38, 2393-2395; b) Asanuma, H.; Liang, X.; Yoshida, T.; Komiyama, M. ChemBioChem 2001, 2, 39-44; c) Kamiya, Y.; Asanuma, H. Acc. Chem. Res. 2014, 47, 1663-1672; d) Meng, F.-N.; Li, Z.-Y.; Ying, Y.-L.; Liu, S.-C.; Zhang, J.; Long, Y.-T. Chem. Commun. 2017, 53, 9462-9465. (21) a) Osborne, S. Curr. Opin. Chem. Biol. 1997, 1, 5-9; b) Willner, I.; Zayats, M. Angew. Chem. Int. Ed. 2007, 46, 64086418; c) Goulko, A. A.; Li, F.; Chris Le, X. TrAC Trends Anal. Chem. 2009, 28, 878-892. (22) a) Breaker, R. R.; Joyce, G. F. Chem. Biol. 1994, 1, 223229; b) Joyce, G. F. Angew. Chem. Int. Ed. 2007, 46, 6420-6436; c) Famulok, M.; Hartig, J. S.; Mayer, G. Chem. Rev. 2007, 107, 3715-3743; d) Travascio, P.; Li, Y.; Sen, D. Chem. Biol. 1998, 5, 505-517; e) Travascio, P.; Bennet, A. J.; Wang, D. Y.; Sen, D. Chem. Biol. 1999, 6, 779-787; f) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 21522156. (23) a) Seeman, N. C. Nature 2003, 421, 427-431; b) Lu, C.-H.; Willner, B.; Willner, I. ACS Nano 2013, 7, 8320-8332. (24) a) Teller, C.; Willner, I. Curr. Opin. Biotech. 2010, 21, 376-391; b) Wang, Z.-G.; Elbaz, J.; Willner, I. Nano Lett. 2011, 11, 304-309; c) Beissenhirtz, M. K.; Willner, I. Org. Biomol. Chem. 2006, 4, 3392. (25) a) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 1192-1199; b) Baker, B. R.; Lai, R. Y.; Wood, M. S.; Doctor, E. H.; Heeger, A. J.; Plaxco, K. W. J. Am. Chem. Soc. 2006, 128, 3138-3139; c) Kolpashchikov, D. M. Chem. Rev. 2010, 110, 4709-4723; d) Pelossof, G.; Tel-Vered, R.; Willner, I. Anal. Chem. 2012, 84, 3703-3709. (26) a) Hu, Y.; Kahn, J. S.; Guo, W.; Huang, F.; Fadeev, M.; Harries, D.; Willner, I. J. Am. Chem. Soc. 2016, 138, 1611216119; b) Kahn, J. S.; Hu, Y.; Willner, I. Acc. Chem. Res. 2017, 50, 680-690; c) Lu, C.-H.; Guo, W.; Hu, Y.; Qi, X.-J.; Willner, I. J. Am. Chem. Soc. 2015, 137, 15723-15731; d) Kahn, J. S.; Trifonov, A.; Cecconello, A.; Guo, W.; Fan, C.; Willner, I. Nano Lett. 2015, 15, 7773-7778. (27) a) Zhang, Z.; Balogh, D.; Wang, F.; Willner, I. J. Am. Chem. Soc. 2013, 135, 1934-1940; b) Chen, W.-H.; Yu, X.; Liao, W.-C.; Sohn, Y. S.; Cecconello, A.; Kozell, A.; Nechushtai, R.; Willner, I. Adv. Funct. Mater. 2017, 27, 1702102; c) Chen, W.H.; Liao, W.-C.; Sohn, Y. S.; Fadeev, M.; Cecconello, A.; Nechushtai, R.; Willner, I. Adv. Funct. Mater. 2018, 28, 1705137; d) Chen, W.-H.; Yu, X.; Cecconello, A.; Sohn, Y. S.; Nechushtai, R.; Willner, I. Chem. Sci. 2017, 8, 5769-5780. (28) Yue, L.; Wang, S.; Lilienthal, S.; Wulf, V.; Remacle, F.; Levine, R. D.; Willner, I. J. Am. Chem. Soc. 2018, 140, 8721– 8731. (29) Goode, D. K.; Obier, N.; Vijayabaskar, M. S.; Lie-A-Ling, M.; Lilly, A. J.; Hannah, R.; Lichtinger, M.; Batta, K.; Florkowska, M.; Patel, R.; Challinor, M.; Wallace, K.; Gilmour, J.; Assi, S. A.; Cauchy, P.; Hoogenkamp, M.; Westhead, D. R.; Lacaud, G.; Kouskoff, V.; Göttgens, B.; Bonifer, C. Dev. Cell 2016, 36, 572-587.


Page 13 of 13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC graphic


DNA-Based Multiconstituent Dynamic Networks: Hierarchical Adaptive

Recommend Documents