ARTICLE pubs.acs.org/JAFC
Effects of Auxins on Sorgoleone Accumulation and Genes for Sorgoleone Biosynthesis in Sorghum Roots Md Romij Uddin, Woo Tae Park, Yong Kyoung Kim, Jong Yeong Pyon, and Sang-Un Park* Department of Crop Science, Chungnam National University, 220 Gung-dong, Yuseong-gu, Daejeon 305-764, Korea ABSTRACT: Sorgoleone is a major component of the hydrophobic root exudate of Sorghum bicolor and is of particular interest to plant chemical ecology as well as agriculture. Sorgoleone was evaluated in this study to observe the expression levels of genes involved in its biosynthesis in response to auxins. Sorgoleone content varied widely according to the duration of application and the concentrations of the auxins. When the application time was increased, the sorgoleone content increased accordingly for all concentrations of IBA (1, 3, and 5 mg/L) and at 1 mg/L for both IAA and NAA. In this study, five different sorgoleone biosynthetic genes were observed, namely DES2, DES3, ARS1, ARS2, and OMT3, which are upregulated in response to IAA, IBA, and NAA. Transcript accumulation was apparent for all genes, but particularly for DES2, which increased up to 475-fold and 180-fold following 72 h exposure to NAA and IBA, respectively, compared to no treatment. KEYWORDS: Auxin, gene expression, sorghum root exudates, sorgoleone biosynthesis
’ INTRODUCTION The root hairs of sorghum produce an oily exudate containing the lipid benzoquinone sorgoleone (2-hydroxy-5-methoxy-3[(80 Z,110 Z)-80 , 110 , 140 -pentadecatriene]-p-benzoquinone), which is a potent allelochemical.1,2 Sorgoleone is phytotoxic to broadleaf and grass weeds at concentrations as low as 10 μM in hydroponic assays,3,4 with broadleaf weed species being more susceptible than grass weed species.5 Sorgoleone biosynthesis appears to occur exclusively in root hair cells, which in sorghum appear as cytoplasmically dense cells filled with numerous osmiophilic deposits. These deposits are presumably associated with the rhizosecretion of sorgoleone, which can constitute as much as 85% of the exudate dry weight in some cultivars.610 The cellspecific localization and prolific output of the sorgoleone biosynthetic pathway rendered the use of expressed sequence tag (EST) analysis as the obvious method to isolate genes encoding sorgoleone biosynthetic enzymes.11 Labeling studies performed by Fate and Lynn12 first demonstrated that biosynthesis proceeds through the action of an alkylresorcinol synthase (ARS), a novel type III polyketide synthase whose activity utilizes fatty acyl-CoA starter units.11 Subsequently, both the predicted 5-n-pentadecatrienyl resorcinol as well as a 3-methyl ether derivative of this compound were identified in sorghum root extracts, indicating that dihydroxylation of the resorcinol ring is preceded by O-methylation at the 3-hydroxyl position.1113 Once released into the rhizosphere, the resulting chemically unstable hydroquinone rapidly oxidizes to the bioactive sorgoleone benzoquinone, where it may persist in soil for extended periods.3,6,14 Synthesis of sorgoleone from the available palmitoleoyl-CoA would therefore likely require, at the minimum, the participation of a Δ12 and Δ15 fatty acid desaturase (DES): ARS, a 3-O-methyltransferase (OMT), and cytochrome P450.11 Studies conducted using differentiated tissues to investigate the biochemical relationship between exogenous and endogenous auxin levels have provided interesting findings regarding root-derived, biologically active compounds. Root growth and sorgoleone content varied widely on exposure to different concentrations r 2011 American Chemical Society
of auxins.15 With regard to the effects of auxins on secondary metabolite production, Bais et al.16 noted that, in the presence of low cytokinin levels, high levels of exogenous auxins, specifically IAA and NAA, decrease the ability of Cichorium intybus root cultures to produce coumarin. Lin et al.17 showed that the coniferin content in Linum flavum is increased significantly in the presence of auxins. However, Arroo et al.18 showed that the addition of IAA inhibits the accumulation of secondary metabolites in the hairy roots of Tagetes patula. In contrast, the addition of either IBA or NAA stimulates ajmalicine and ajmaline production in Rauvolfia micrantha hairy root cultures in a hormonefree medium.19 To the best of our knowledge, there has been no previous work investigating gene expression levels in the sorghum root on exposure to auxins. Therefore, this research was conducted to correlate gene expression levels with the biosynthesis of sorgoleone in response to auxin exposure time as part of a time series experiment. Such knowledge would be useful for the future development of a bioherbicide by increasing levels of sorgoleone through molecular manipulation.
’ MATERIALS AND METHODS Plant Material and Growth Conditions. Sorghum seeds (cultivar Chalsusu) with high sorgoleone content5 were used in this study. Seeds were treated with benomyl (a powdery fungicide, 100 g dissolved in 20 L) for 4 h and then rinsed several times in distilled water. Then 25 seeds along with distilled water were placed in sterile Petri dishes (100 mm 40 mm) on the surface of sterile Whatman no. 1 filter paper (diameter, 90 mm). The dishes were then placed in a growth chamber at 25 °C under standard cool-white fluorescent tubes with a flux rate of 550 μmol s1 m2 and a 16 h photoperiod for 5 days. Auxin treatment was applied to 5-day-old sorghum seedlings Received: June 20, 2011 Accepted: November 16, 2011 Revised: September 28, 2011 Published: November 16, 2011 12948
dx.doi.org/10.1021/jf2024402 | J. Agric. Food Chem. 2011, 59, 12948–12953
Journal of Agricultural and Food Chemistry Table 1. Primer Set for qRT-PCR primer name
sequences (50 to 30 )
DES2-qF
ACTACCAGTTCGACCCCACTCC
DES2-qR
CCGCCTTCTCTTCCTGATTTCT
DES3-qF
CTGACCATCACCTCAACGACAC
DES3-qR
CATTGCACCAACTGACTTCACC
ARS1-qF
GGAGTACCACCTCTCCAGCAA
ARS1-qR
CAGTTTGTCGTCCTCCAGACC
ARS2-qF
ATCTTCGTGCTCGATGAGTTG
ARS2-qR
ATTTCCCTCCAGTTCCAGGTT
OMT3-qF
GTTTGTTGGGGGTGACATGTTT
OMT3-qR
CGTCTCCAGAAGCTTGGTGTCT
and were again placed in separate sterile Petri dishes (100 mm 40 mm) on the surface of sterile Whatman no. 1 filter paper (diameter, 90 mm). The dishes were then placed in a growth chamber at 25 °C under standard cool-white fluorescent tubes with a photo flux rate of 550 μmol s1 m2 and a 24 h photoperiod for 72 h. Auxin Treatment. A time series experiment was done to determine the maximum sorgoleone biosynthesis from the root of sorghum by different concentration of auxins. Three different auxins, namely indole3-acetic acid (IAA), indole-3-butyric acid (IBA), and 1-naphthaleneacetic acid (NAA) were tested at different concentrations (0, 1, 3, and 5 mg/L). Auxin was applied to 5-day-old sorghum seedlings. Roots were harvested at 3, 6, 12, 24, 48, and 72 h after auxin application. Root samples were stored in sealed clear polyethylene plastic bags at 80 °C until use. There were four replications and the experiment was repeated twice.
Extraction Procedure and Sorgoleone Analysis by HPLC. Sorgoleone was extracted according to the procedures described by the authors1,8,14 except that methanol was used as a solvent instead of methylene chloride.15 Seedling roots were excised and immersed in methanol (1:20 w/v) for 30 s to extract. The crude extract was filtered and evaporated under vacuum. The dried extract was dissolved in methanol (1 mg/mL), and the solution was filtered through a poly filter (pore size, 0.45 μm). The filtrate was diluted 4-fold with methanol prior to HPLC analysis. HPLC quantification of sorgoleone was performed using the Futecs NS-4000 HPLC system (Futecs Co. Ltd., Daejeon, Korea) with a C18 column (250 mm 4.6 mm, particle size 5 μm; RStech, Daejeon, Korea). The mobile phase was 75% acetonitrile + 25% acidified water. Water was acidified with glacial acetic acid (97.5:2.5 v/v). Sorgoleone was detected at 280 nm with a Waters tunable absorbance detector after injection of 20 μL of the methanol solubilized crude extract sample. The column flow rate was 1 mL/min with a 40 min total run time for each sample. All samples were run in triplicate. The amount of sorgoleone was calculated on the basis of a standard curve obtained from a purified sample. The sorgoleone standard was provided by Franck Dayan, United States Department of Agriculture— Agricultural Research Service (USDA-ARS), Natural Products Utilization Research Unit. Root Sample for Gene Expression. From the auxin treatment, root samples were collected for gene expression. For gene expression, only the most optimal concentrations of IAA1 (1 mg/L), IBA5 (5 mg/L), and NAA1 (1 mg/L) for maximum sorgoleone concentration was selected. RNA Extraction and cDNA Synthase. Total RNA was isolated from a root of Sorghum bicolor using trireagent (MRC, USA) and
ARTICLE
RNeasy Plant Mini Kit (QIAGEN, Valencia, CA, USA). For quantitative real-time polymerase chain reaction (qRT-PCR), 1 μg of total RNA was reverse-transcribed according to the manufacturer’s protocol (ReverTraAce-a, TOYOBO, Japan) using an oligo(dT)20 primer. The cDNA mixtures were used as templates for qRT-PCR. Real-Time Quantitative PCR. For transcription-level analysis by RT-PCR, RNAs from auxin treated sorghum roots were harvested and single-stranded cDNAs were synthesized from the isolated total RNA using the aforementioned protocols. The gene-specific primer sets were designed for RT-PCR (Table 1). Specific primers for DES2 (EF206347), DES3 (EF206348),20 ARS1 (XM_002441794), ARS2 (XM_002449699),21 and OMT3 (EF189708)11 were obtained from NCBI. Ubiquitin were used as control.11 The PCR reactions were carried out in triplicates for 40 cycles on a MiniOpticon (Bio-Rad Laboratories, Hercules, CA, USA) using the QIAGEN Quantitect SYBR Green PCR kit. The PCR reactions were predenatured at 95 °C for 5 min and then subjected to 40 cycles of amplifications with the following thermal cycles: denaturation for 30 s at 95 °C, annealing for 30 s at 55 °C, then extension for 30 s at 72 °C. Fluorescent intensity data were acquired during extension step. The transcript levels were checked using a standard curve. Identical PCR conditions were used for all targets. Statistical Analysis. All data were analyzed using the SAS 9.1 Software (released in 2006; SAS Institute Inc., Cary, NC, USA). Standard deviations were provided to indicate the variations associated with the particular mean values.
’ RESULTS AND DISCUSSION Effect of Auxins on Sorgoleone Biosynthesis. Sorgoleone content varied widely depending on the duration of the application and the concentrations of auxins (Figure 1). When the exposure time was increased, sorgoleone content increased accordingly in all the cases for IAA (1 mg/L); however, for the other two concentrations (IAA at 3 and 5 mg/L), the sorgoleone content increased up to 48 h after treatment and then subsequently started to decline. At 72 h after treatment, auxin IAA at 1 mg/L produced 5.2-fold more sorgoleone than the untreated control at 3 h. As the concentration of IAA increased, the sorgoleone content decreased, where IAA at 1 mg/L produced the highest sorgoleone in all the time, which was slightly more than IAA at 3 mg/L, which in turn was much more than the sorgoleone produced from treatment with IAA at 5 mg/L (Figure 1). Sorgoleone content increased with both the increased time and concentrations of IBA. Here, the increasing trend continued across all the time series and suggests that sorgoleone content may increase even further after 72 h. The sorgoleone content was higher for all exposure times for IBA at 5 mg/L, followed by 3 mg/L and 1 mg/L, respectively. At 72 h after treatment, auxin IBA at 5 mg/L produced 4.5-fold more sorgoleone than the untreated control at 3 h (Figure 1). In a similar way to the other two auxins, NAA also promoted sorgoleone biosynthesis. With an increased exposure time to NAA, sorgoleone content also increased accordingly. However, when the concentration was increased, the sorgoleone content was seen to decrease. The sorgoleone content pattern was similar to the one observed for the auxin IAA. NAA at 1 mg/L promoted the highest sorgoleone content after 72 h of treatment. The sorgoleone content was the lowest when NAA was at 5 mg/L. At 72 h after treatment, auxin NAA at 1 mg/L produced 3.8-fold more sorgoleone than the untreated control at 3 h (Figure 1). Optimal Concentration of Auxins for the Highest Production of Sorgoleone. The maximum amount of sorgoleone was 12949
dx.doi.org/10.1021/jf2024402 |J. Agric. Food Chem. 2011, 59, 12948–12953
Journal of Agricultural and Food Chemistry
ARTICLE
Figure 2. Effect of exposure time of the optimal concentration of IAA, IBA, and NAA on sorgoleone production. Values are presented as mean ( SD (each point is the mean of four replicates with an average of 10 seedlings for each replicate). Error bars represent the standard error of the mean (n = 4). Statistical significance of the differences between treatments was determined using ANOVA followed by paired-group comparisons.
Figure 1. Effect of exposure time of IAA (top), IBA (middle), and NAA (bottom) at different concentrations on sorgoleone pro duction. Values are presented as mean ( SD (each point is the mean of four replicates with an average of 10 seedlings for each replicate). IAA, indole-3-acetic acid; IBA, indole-3-butyric acid; NAA, 1-naphthaleneacetic acid. Error bars represent the standard error of the mean (n = 4). Statistical significance of the differences between treatments was determined using ANOVA followed by paired-group comparisons.
observed on treatment with IAA at 1 mg/L, followed by treatment with IBA at 5 mg/L and NAA at 1 mg/L for 72 h. In all cases, increased exposure to auxin promoted sorgoleone to increase for up to 72 h of treatment (Figure 2). Compared with the control at 3 h, 1 mg/L IAA, 5 mg/L IBA, and 1 mg/L NAA produced 5.2, 4.5, and 3.8 times more sorgoleone, respectively, at 72 h. The control values also increased with time. Therefore, compared with the control at 72 h, the sorgoleone content increased by 3.9, 3.4, and 2.9 times at 3 h for 1 mg/L IAA, 5 mg/L IBA, and 1 mg/L NAA, respectively. When comparing the auxins to each other, IAA at 1 mg/L produced 1.35 and 1.14 times more sorgoleone compared with IBA at 5 mg/L and NAA at 1 mg/L, respectively. During the initial hours of exposure, IBA at 5 mg/L promoted more sorgoleone than the other two auxins. IBA at 5 mg/L produced 1.8 times more, IAA at 1 mg/L produced 1.7 times more, and NAA at 1 mg/L produced 1.2 times more sorgoleone than the control at 3 h Auxins play a critical role in most major growth responses throughout the development of a plant. Auxins are thought to regulate or influence diverse responses on a whole-plant level, such as tropisms, apical dominance and root initiation, and responses on a cellular level, such as cell extension, division, and differentiation. Over the past 20 years, it has been clearly demonstrated that auxins can also exert rapid and specific effects on genes at the molecular level. In this study, auxins exerted a positive effect on sorgoleone production. Auxins govern many biological processes in plants, such as cell enlargement and division, differentiation of vascular tissue, apical dominance, root initiation, and signaling.22 Studies conducted using differentiated tissues to investigate the biochemical relationship between exogenous and endogenous auxin levels have provided interesting findings regarding root-derived biologically active compounds. Researchers investigating the physiological role of exogenously applied auxins in root growth and secondary metabolite production have established that signaling molecules can affect plant tissue stability and secondary 12950
dx.doi.org/10.1021/jf2024402 |J. Agric. Food Chem. 2011, 59, 12948–12953
Journal of Agricultural and Food Chemistry
ARTICLE
Figure 3. Time course of induction of sorgoleone biosynthetic genes following IAA (1 μg/mL), IBA (5 μg/mL), and NAA (1 μg/mL) treatment in the sorghum root. Each value is the mean of 3 replicates ( SD. Error bars represent the standard error of the mean (n = 3). Statistical significance of the differences between treatments was determined using ANOVA followed by paired-group comparisons.
product accumulation either individually or through interactions with phytohormones. Czarnota et al.23 confirmed that sorghum root hairs are physiologically active with a complex network of smooth endoplasmic reticulum and possibly Golgi bodies. Small globules of cytoplasmic exudates were also observed to deposit an oily material between the cell wall and the plasma membrane near the root hair tips. This study confirms that sorgoleone production is related directly to the development of sorghum root hairs.
Inducible Expression of Sorgoleone Biosynthetic Genes in S. bicolor in Response to Auxins. In this study, transcription of
five different sorgoleone biosynthesis genes were monitored. They were DES2, DES3, ARS1, ARS2, and OMT3 and were all sorgoleone biosynthetic genes that are up regulated in response to IAA, IBA, and NAA treatment. IAA (1 mg/L). Transcript accumulation was apparent for most of the genes for up to 12 h IAA treatment (Figure 3), in particular ARS2, which increased up to 8-fold at 6 h; OMT3, which 12951
dx.doi.org/10.1021/jf2024402 |J. Agric. Food Chem. 2011, 59, 12948–12953
Journal of Agricultural and Food Chemistry increased up to 7-fold at 72 h; DES3, which increased up to 5.2-fold at 6 h; ARS1, which increased up to 4.5-fold at 12 h; and DES2, which increased up to 4.1-fold at 3 h compared to no IAA treatment (control). IBA (5 mg/L). Transcript accumulation was apparent for all the genes up to the highest time (72 h) of IBA application; however, it differed significantly among the studied genes. Transcripts of DES2 accumulated to maximum levels at 72 h, where it increased up to 180-fold compared to no IBA treatment. Transcripts of ARS1 and OMT3 accumulated to maximum levels within 3 h and increased up to 88- and 128-fold, respectively, compared to no IBA treatment (Figure 3). Transcripts of DES3 accumulated to maximum levels within 6 h, and increased up to 12-fold compared to no IBA treatment (Figure 3). Transcripts of ARS2 accumulated to maximum level within 12 h, and increased up to 27-fold compared to no IBA treatment (Figure 3). NAA (1 mg/L). Among the auxins, NAA was seen to dramatically change the gene expression in this study. Transcript accumulation was apparent for all genes (Figure 3), particularly DES2, which increased up to 475-fold compared to no NAA treatment (control) at 72 h. The expression levels for ARS1 and ARS2 exceeded 100- and 38-fold, respectively, at 72 h compared to the control. Transcripts of DES3 accumulated to maximum levels (12-fold) within 24 h of treatment. Transcript of OMT3 accumulated to maximum level with in 3 h and increased up to 75-fold compared to the control. Numerous genes that are up- or down-regulated by auxins have been described.2426 In this study, five different sorgoleone biosynthetic genes, namely DES2, DES3, ARS1, ARS2, and OMT3, were observed, all of which are upregulated in response to IAA, IBA, and NAA treatment. Transcript accumulation was apparent for all genes (Figure 3), particularly DES2, which increased up to 475-fold compared to no NAA treatment up to 72 h, an observation that is supported by previous work.27,28 The application of auxins to excised sections or organs (e.g., root, elongating region of hypocotyl, basal region of hypocotyl, and plumule) of intact soybean seedlings results in the accumulation of mRNAs for pGHl-4 to levels that are many-fold greater than those found in untreated organs of seedlings.27 The results from using different auxins for enhanced sorgoleone production, suggests that sorghum roots benefit from auxins by developing more sorgoleone-rich root hairs and transcript accumulation was apparent for all genes, particularly for DES2, which increased up to 475-fold following 72 h of exposure to NAA compared to no treatment. The findings of this study would be useful for the future development of a bioherbicide by increasing levels of sorgoleone through molecular manipulation.
’ AUTHOR INFORMATION Corresponding Author
*Phone: +82-42-821-5730. Fax: +82-42-822-2631. E-mail: supark@ cnu.ac.kr. Address: S. U. Park, Department of Crop Science, College of Agriculture & Life Sciences, Chungnam National University, 79 Daehangno, Yuseong-gu, Daejeon, 305-764, Korea.
’ REFERENCES (1) Netzly, D. H.; Butler, L. G. Roots of sorghum exude hydrophobic droplets containing biologically active components. Crop Sci. 1986, 26, 775–778. (2) Inderjit; Duke, S. O. Ecophysiological aspects of allelopathy. Planta 2003, 217, 529–539.
ARTICLE
(3) Einhellig, F. A.; Souza, I. F. Phytotoxicity of sorgoleone found in grain sorghum root exudates. J. Chem. Ecol. 1992, 18, 1–11. (4) Nimbal, C. I.; Pedersen, J. F.; Yerkes, C. N.; Weston, L. A.; Weller, S. C. Phytotoxicity and distribution of sorgoleone in grain sorghum germplasm. J. Agric. Food Chem. 1996, 44, 1343–1347. (5) Uddin, M. R.; Kim, Y. K.; Park, S. U.; Pyon, J. Y. Herbicidal activity of sorgoleone from grain sorghum root exudates and its contents among sorghum cultivars. Kor. J. Weed Sci. 2009, 29, 229–236. (6) Czarnota, M. A.; Paul, R. N.; Dayan, F. E.; Nimbal, C. I.; Weston, L. A. Mode of action, localization of production, chemical nature, and activity of sorgoleone: a potent PSII inhibitor in Sorghum spp. root exudates. Weed Technol. 2001, 15, 813–825. (7) Bertin, C.; Yang, X.; Weston, L. A. The role of root exudates and allelochemicals in the rhizosphere. Plant Soil 2003, 256, 67–83. (8) Czarnota, M. A.; Rimando, A. M.; Weston, L. A. Evaluation of seven sorghum (Sorghum sp.) accessions. J. Chem. Ecol. 2003a, 29, 2073–2083. (9) Duke, S. O. Weeding with transgenes. Trends Biotechnol. 2003, 21, 192–5. (10) Rimando, A. M.; Dayan, F. E.; Streibig, J. C. PSII inhibitory activity of resorcinolic lipids from Sorghum bicolor. J. Nat. Prod. 2003, 66, 42–45. (11) Baerson, S. R.; Dayan, F. E.; Rimando, A. M.; Nanayakkara, N. P. D.; Liu, C.-J.; Schr€oder, J.; Fishbein, M.; Pan, Z.; Kagan, I. A.; Pratt, L. H.; Cordonnier-Pratt, M.-M.; Duke, S. O. A functional genomics investigation of allelochemical biosynthesis in Sorghum bicolor root hairs. J. Biol. Chem. 2008, 283, 3231–3247. (12) Fate, G. D.; Lynn, D. G. Xenognosin methylation is critical in defining the chemical potential gradient that regulates the spatial distribution in Striga pathogenesis. J. Am. Chem. Soc. 1996, 118, 11369–11376. (13) Dayan, F. E.; Kagan, I. A.; Rimando, A. M. Elucidation of the biosynthetic pathway of the allelochemical sorgoleone using retrobiosynthetic NMR analysis. J. Biol. Chem. 2003, 278, 28607–28611. (14) Netzly, D. H.; Riopel, J. L.; Ejeta, G.; Butler, L. G. Germination stimulants of witchweed (Striga asiatica) from hydrophobic root exudates of sorghum (Sorghum bicolor). Weed Sci. 1988, 36, 441–446. (15) Uddin, M. R.; Park, K. W.; Kim, Y. K.; Park, S. U.; Pyon, J. Y. Enhancing sorgoleone levels in grain sorghum root exudates. J. Chem. Ecol. 2010, 36, 914–922. (16) Bais, H. P.; Sudha, G.; George, J.; Ravishankar, G. A. Influence of exogenous hormones on growth and secondary metabolite production in hairy root cultures of Cichorium intybus L. cv. Lucknow local. In Vitro Cell. Dev. Biol.: Plant 2001, 37, 293–299. (17) Lin, H. W.; Kwok, K. H.; Doran, P. M. Development of Linum flavum hairy root cultures for production of coniferin. Biotechnol. Lett. 2003, 25, 521–525. (18) Arroo, R. R. J.; Develi, A.; Meijers, H.; Van de Westerlo, E.; Kemp, A. P.; Croes, A. F.; Wullems, G. J. Effects of exogenous auxin on root morphology and secondary metabolism in Tagetes patula hairy root cultures. Physiol. Plant 1995, 93, 233–240. (19) Sudha, C. G.; Reddy, B. O.; Ravishankar, G. A.; Seeni, S. Production of ajmalicine and ajmaline in hairy root cultures of Rauvolfia micrantha Hook f., a rare and endemic medicinal plant. Biotechnol. Lett. 2003, 25, 631–636. (20) Pan, Z.; Rimando, A. M.; Baerson, S. R.; Fishbein, M.; Duke, S. O. Functional characterization of desaturases involved in the formation of the terminal double bond of an unusual 16:3Δ9,12,15 fatty acid isolated from Sorghum bicolor root hairs. J. Biol. Chem. 2007, 282, 4326–4335. (21) Cook, D.; Rimando, A. M.; Clemente, T. E.; Schroder, J.; Dayan, F. E.; Nanayakkara, D.; Pan, Z.; Noonan, B. P.; Fishbein, M.; Abe, I.; Duke, S. O.; Baerson, S. R. Alkylresorcinol synthases expressed in Sorghum bicolor root hairs play an essential role in the biosynthesis of the allelopathic benzoquinone sorgoleone. Plant Cell 2010, 22, 867–887. (22) Teale, W. D.; Paponov, I. A.; Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Rev. Mol. Cell Biol. 2006, 7, 847–859. (23) Czarnota, M. A.; Paul, R. N.; Weston, L. A.; Duke, S. O. Anatomy of sorgoleone-secreting root hairs of Sorghum species. Int. J. Plant Sci. 2003b, 164, 861–866. 12952
dx.doi.org/10.1021/jf2024402 |J. Agric. Food Chem. 2011, 59, 12948–12953
Journal of Agricultural and Food Chemistry
ARTICLE
(24) Abel, S.; Theologis, A. Early genes and auxin action. Plant Physiol. 1996, 111, 9–17. (25) Sitbon, F.; Perrot-Rechenmann, C. Expression of auxin regulated genes. Physiol. Plant. 1997, 100, 443–455. (26) Guilfoyle, T. J. Auxin-regulated genes and promoters. In: Biochemistry and Molecular Biology of Plant Hormones; Hooykaas, P. J. J., Hall, M., Libbenga, K.L., Eds.; Elsevier: Leiden, Netherlands, 1999; pp 423459. (27) Hagen, G.; Guilfoyle, T. J. Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol. Biol. 2002, 49, 373–385. (28) Hagen, G.; Kleinschmidt, A.; Guilfoyle, T. J. Auxin-regulated gene expression in intact soybean hypocotyl and excised hypocotyl sections. Planta 1984, 162, 147–153.
12953
dx.doi.org/10.1021/jf2024402 |J. Agric. Food Chem. 2011, 59, 12948–12953
