Article pubs.acs.org/JAFC
Effects of Lactobacillus plantarum NCU116 on Intestine Mucosal Immunity in Immunosuppressed Mice Junhua Xie, Qiang Yu, Shaoping Nie,* Songtao Fan, Tao Xiong, and Mingyong Xie State Key Laboratory of Food Science and Technology, Nanchang University, 235 Nanjing East Road, Nanchang 330047, China ABSTRACT: The effects of Lactobacillus plantarum (L. plantarum) NCU116 isolated from pickled vegetables on intestine mucosal immunity in cyclophosphamide treated mice were investigated. Animals were divided into six groups: normal group (NIM), immunosuppression group (IM), immunosuppression plus L. plantarum NCU116 groups with three different doses (NCU-H, NCU-M, and NCU-L), and plus Bif idobacterium BB12 as positive control group (BB12). Results showed that the thymus indexes of the four treatment groups were significantly higher than that of the IM group (2.02 ± 0.16) (p < 0.05) and close to the index of the NIM group (2.61 ± 0.37) at 10 days. The level of immune factor IL-2 notably increased (IM, 121 ± 9.0) (p < 0.05) and was close to 65% of NIM group’s level (230 ± 10.7). The levels of other immune factors (IFN-γ, IL-10, IL-12p70, and sIgA), the gene expression levels of IL-2 and IFN-γ, and the number of IgA-secreting cells showed similar patterns (p < 0.05). However, the level of immune factor IL-4 remarkably decreased (IM, 128 ± 10.2) (p < 0.05) and was only approximately 50% of the NIM group (154 ± 18.2). The levels of other immune factors (IL-6 and IgE) and the gene expression level of IL-6 at 10 days exhibited similar changes (p < 0.05) but showed a slight recovery at 20 days, accompanied by the altered protein expression levels of T-bet and GATA-3 in the small intestine. These findings suggest that L. plantarum NCU116 enhanced the immunity of the small intestine in the immunosuppressed mice. KEYWORDS: Lactobacillus plantarum NCU116, cyclophosphamide, intestinal mucosal immune, immunomodulation, Th1/Th2 balance
■
INTRODUCTION Immunosuppression is an abnormal immune state which decreases the immune response to antigens and increases the sensitivity to diseases.1 For instance, the human immunodeficiency virus (HIV) epidemic created one of the most important populations of immunocompromised hosts,2 which often leads to a low antibody level or ineffective vaccination in a vaccinated body. In order to control infectious diseases and prevent secondary infection, vaccines and drugs with a high dose have been used for long-term treatment, which often results in a great deal of side-effects. Therefore, the most effective means of preventing and treating immunosuppressive diseases is to study and develop new immunopotentiators.3 Recently, the application of probiotics in immunoregulation has shown some advancements. However, since the expression profiles of cell wall proteins and content of DNA unmethylated cytidine guanine dinucleotide (CpG) varied in different probiotics, different probiotics were found to exhibit various immunomodulatory effects.4 Many studies have reported that Lactobacillus plantarum (L. plantarum) possessed an immunoregulatory function, such as activation of Th1 immune responses,5 enhancement of IgA secretion and prevention of influenza virus infection,6 improvement of the cytokine profile against mite allergy,7 and enhancement of natural killer cell activity.8 L. plantarum NCU116, a newly identified probiotic, was obtained from pickled vegetables in our laboratory.9 We have previously reported that this bacterium exhibited several bioactivities in vitro10,11 and in vivo.12−14 However, the immunoregulatory effects of the L. plantarum NCU116 are unclear and its immunoregulatory mechanism has not been © 2015 American Chemical Society
fully understood yet. Therefore, the present study was to investigate the effects of L. plantarum NCU116 on intestine mucosal immunity in cyclophosphamide (CTX)-induced immunosuppressed mice.
■
MATERIALS AND METHODS
Chemicals. Man-Rogosa-Sharpe (MRS) was purchased from Land Bridge Technology (Beijing, China). CTX (No.07112221) was purchased from Jiangsu Hengrui Medicine Co., Ltd. (Jiangsu, China). Enzyme-Linked Immunosorbent Assay (ELISA)-based cytokine kits were purchased from Cloud-Clone Corp. (Houston, TX, USA). RevertAid First Strand cDNA Synthesis Kit was purchased from Thermo Fisher Scientific (Vilnius, Lithuania). GoTaq qPCR Master Mix was purchased from Promega Biotechnology (Madison, USA). Goat Antimouse IgA alpha chain (FITC) was purchased from Abcam Biotechnology (Cambridge, U.K.). SDS-PAGE Gel preparation kit, Bicinchonininc acid (BCA) assay kit, and Enhanced Chemiluminescence Detection kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Anti-T-bet and anti-GATA-3 antibodies were purchased from Boster Bioengineering (Wuhan, China). Anti-β-actin and HRP-conjugated goat antirabbit IgG secondary antibodies were purchased from ZSGB Biotechnology (Beijing, China). All other reagents used were of analytical grade and purchased from Shanghai Chemicals and Reagents Co. (Shanghai, China). Preparation of Bacterial Strain. L. plantarum NCU116 powder (Provided by State Key Laboratory of Food Science and Technology, Nanchang University) and Bif idobacterium BB12 (Purchased from Received: Revised: Accepted: Published: 10914
September 29, 2015 December 1, 2015 December 10, 2015 December 10, 2015 DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
Article
Journal of Agricultural and Food Chemistry
for RT-qPCR were as follows: β-actin (5′ F: TGGAAATCCTGTGGCATCCAGTAAAC-3′; 5′ R: TAAAACGCAGCTCAGTAACAGTCCG-3′);16 IL-2 (5′ F: CCTGAGCAGGATGGAGAATTACA-3′; 5′ R: TCCAGAACATGCCGCAGAG-3′);17 IL-6 (5′ F: GACAACCACGGCCTTCCCTAC-3′; 5′ R: GGTACTCCAGAAGACCAGAGGA-3′);18 IFN-γ (5′ F: AGCGGCTGACTGAACTCAGATTGTAG-3′; 5′ R: GTCACAGTTTTCAGCTGTATAGGG3′).18 Immunofluorescence Assay for IgA-Secreting Cells. The number of IgA-secreting cells in the lamina propria of the small intestine tissues was determined by direct immunofluorescence assay. After deparaffinization using xylene and rehydration in a decreasing gradient of ethanol, slides were incubated with an a-chain monospecific antibody conjugated with fluorescein isothiocyanate (FITC) for IgA-secreting cells. The results were expressed as the average number of positive cells in two fields of vision (magnification 200×) by using a fluorescent light microscope. Western Blot Analysis. Protein was extracted from small intestinal tissue samples, and protein concentration was determined by the BCA assay kit. Then lysates (20 μg of total protein) were separated on 10% SDS-PAGE gels and transferred to nitrocellulose membranes (Millipore, Bedford, MA, USA). Blots were blocked for 2 h at room temperature in 5% bovine serum albumin (BSA) prepared in Tris-buffered saline containing 0.1% Tween 20 (TBST). They were then incubated overnight at 4 °C with rabbit polyclonal antibodies: anti-T-bet, anti-GATA-3, and anti-β-actin. After being washed three times with TBST (15 min each), the membranes were incubated with secondary HRP-conjugated goat antirabbit IgG for 1 h at room temperature. After a further three 15 min washings, the blots were developed using the Enhanced Chemiluminescence Detection kit by following the manufacturer’s instructions. Densitometry was performed using the software Quantity One 4.0. Statistical Analysis. Results were expressed as mean ± standard deviation (SD), and the data were analyzed with SPSS 20.0 software (SPSS Inc., Chicago, IL, USA). Two-way analysis of variance (ANOVA) with Tukey test was used to compare the differences among various groups. A value of p < 0.05 was considered to be statistically significant.
Chr. Hansen, Denmark) were suspended in sterile saline. In the preexperiment, for the assessment of approximate concentrations of viable bacteria, suitable dilutions of the culture were plated onto MRS broth at 37 °C for 48 h. The concentrations of L. plantarum NCU116 and Bif idobacterium BB12 were found to reach 1011 colony forming units (CFU)/g and 109 CFU/g, respectively. The bacterial strain was diluted in sterile saline to produce suspensions of designated doses for oral administration. Experimental Animals. One hundred and twenty female Specific Pathogen-Free (SPF) BALB/c mice with the body weight of 20.0 ± 2.0 g were obtained from Hunan Slac Jingda Laboratory Animal Co. (Changsha, China, Certificate number: SCXK (Xiang) 2012−0003). Animals were acclimatized to the laboratory condition for 1 week before commencement of the animal experiment. They were housed at an ambient temperature of 23 ± 1 °C, 12/12 h of light-dark cycle with ad libitum food and water. Animals used in this study were cared for in accordance with the Guidelines for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health (NIH Publication 85-23, 1996), and all experimental procedures were approved by the Animal Care Review Committee, Nanchang University. Experimental Design. All mice were randomly divided into six groups as follows: normal control (NIM) group, immunosuppression treated sterile saline (IM) group, immunosuppression treated with L. plantarum NCU116 groups with three different doses (NCU-H, 1010 CFU/mL; NCU-M, 109 CFU/mL; NCU-L, 108 CFU/mL), and immunosuppression treated with 109 CFU/mL Bif idobacterium BB12 (BB12) group. Immunosuppressed mice were injected intraperitoneally with CTX 80 mg/kg/d of body weight in sterile saline for three consecutive days. The body weight was used as a measure of immunosuppression effect.15 All treatments were conducted with 10 mL/kg body weight by oral administration once daily over a 20 d period. The NIM group mice were injected and received an equivalent volume of sterile saline as the immunosuppression group. An equivalent volume of sterile saline was administered to IM group mice in the same way. Analysis of Immune Organ Index. The mice were weighed before being sacrificed. The thymus and spleen were immediately excised surgically and weighed, respectively. The immune organ index was calculated according to the formula: index = the weight of immune organs (mg)/body weight (g). Sampling Procedures. Mice from the treated and control groups were sacrificed at Days 10 and 20. The day when mice received the bacterium was considered as the first day of this experiment. Ten mice per assay at each sampling point were used. The small and large intestine, spleen, and thymus were removed and washed with sterile saline. The tissues were prepared for histological observation using the method described by Sainte-Marie (1962). Serial paraffin sections (4 μm) were made and used for hematoxylin eosin staining, and immunofluorescence assays were used to determine different immunological markers to the IgA-secreting cells in the lamina propria of the small intestine. Measurements of Cytokines by ELISA. The supernatant of the small intestinal tissue homogenate was harvested, and the levels of antibodies sIgA and IgE, and the levels of cytokines IL-2, TNF-α, IFNβ, IFN-γ, IL-12p70, IL-4, IL-6, and IL-10 were measured by ELISAbased cytokine kits, as per the manufacturers’ instructions. The results were expressed as the concentration of cytokines per milliliter of supernatant from intestinal tissue homogenate by standard cytokines provided in the kits. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis of Gene Expression. Total RNA was extracted from the small intestinal tissue, and cDNA was obtained by reverse transcription using the RevertAid First Strand cDNA Synthesis Kit according to the instructions of the manufacturer. The PCR reactions were performed with a 7900HT fast real-time PCR system (Applied Biosystems, Foster City, CA) using GoTaq qPCR Master Mix. Data analysis was carried out using the 2−ΔΔCT method. The housekeeping gene, β-actin, was used for normalization. The sequences of the primers (Gencript China, Ltd., Nanjing, China) used
■
RESULTS
Body Weight. Animal body weight was monitored every 3 days throughout the experiment. As shown in Figure 1, there were no differences in initial body weights on Day −2. Subsequently, all five immunosuppressed mice groups showed a dramatic decrease in body weight following the injection of CTX (p < 0.05). Compared with the IM group, the NCU-H, NCU-M, NCU-L, and BB12 groups exhibited more body weight gain throughout the remaining experimental period. Immune Organ Index. The thymus and spleen index in the IM group were significantly lower than those in the NIM group (p < 0.05, Table 1), while the mice thymus index in the IM group returned to a normal level at Day 20. The thymus indexes in the NCU-H, NCU-M, NCU-L, and BB12 groups were higher than that in the IM group (p < 0.05) and returned to normal levels at both time points, and the spleen indexes in the NCU-H, NCU-L, and BB12 groups were significantly improved as compared with the IM group at Day 10. In addition, the thymus and spleen indexes of the NCU-H, NCUM, NCU-L, and BB12 groups at Day 20 showed no significant differences compared with those at Day 10. Levels of Cytokines in the Small Intestine. As shown in Table 2, compared with the NIM group, CTX injection caused significant reduction in the levels of cytokines (IL-2, TNF-α, IFN-γ, IL-12p70, IL-4, IL-6, and IL-10) and antibodies (sIgA and IgE) in the IM group (p < 0.05, p < 0.01), while the level of cytokine IFN-β had no significant decrease. 10915
DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
Article
Journal of Agricultural and Food Chemistry
compared with the IM group (P < 0.05), and the IL-2 and IFNγ mRNA expressions levels in the BB12 group were similar to those in the NCU-H group at Day 10 (Figure 2A and B). In addition, the levels of IL-2 and IFN-γ mRNA expression did not change or tended to decrease at Day 20, while the IL-6 mRNA expression level tended to increase compared with Day 10 (Figure 2C). Number of IgA-Secreting Cells in the Small Intestine. The number of IgA-secreting cells was significantly decreased in the IM group compared with the NIM group (P < 0.05, P < 0.01). The number of IgA-secreting cells in the NCU-H, NCUM, NCU-L, and BB12 groups significantly increased as compared with the IM group at Day 10 (P < 0.05), and the BB12 group reached values similar to those of the NCU-M and NCU-H groups at 10 and 20 days. In addition, the number of IgA-secreting cells in the IM group slightly increased at Day 20 compared with Day 10, but not those in the NCU-H, NCU-M, NCU-L, and BB12 groups (Figure 3). Protein Expression Levels of GATA-3 andT-bet in the Small Intestine. Western-blotting results showed that the changes in GATA-3 protein levels in the NCU-H, NCU-M, and NCU-L groups were not obvious (Figure 4D). In contrast, the NCU-H, NCU-M, NCU-L, and BB12 groups showed a significant increase in the protein level of T-bet compared with the IM group (p < 0.05, p < 0.01). However, there was no significant change at Day 20 compared with Day 10 (Figure 4C). Furthermore, there was a slight decline of the T-bet/ GATA-3 ratio in the BB12, NCU-H and NCU-M groups at Day 20 evidenced by upregulated transcriptional activity of GATA-3 and downregulated transcriptional activity of T-bet (Figure 4E).
Figure 1. Changes of body weight in the six groups of mice. (●) NIM, non-immunosuppression + saline; (▲) IM, immunosuppression + saline; BB12; (▼) IM + 109 CFU/mL Bif idobacterium BB12; (■) NCU-H, IM + 1010 CFU/mL L. plantarum NCU116; (◆) NCU-M, IM + 109 CFU/mL; L. plantarum NCU116; (★) NCU-L, IM + 108 CFU/mL L. plantarum NCU116. Data are expressed as the mean ± SD (n = 10). *p < 0.05 compared with IM group; #p < 0.05 compared with D-2.
Simultaneously, our results showed that the levels of IL-2, IFN-γ, IL-10, IL-12p70, and sIgA markedly increased in the NCU-H, NCU-M, NCU-L, and BB12 groups at 10 days of treatment in comparison with the IM group (p < 0.05, p < 0.01), and that IL-2 level at Day 20 significantly increased as compared with Day 10 (p < 0.01). In this study, treatments with L. plantarum NCU116 and Bif idobacterium BB12 notably decreased the levels of cytokines IL-4 and IL-6 in CTX-treated immunosuppressed mice at Day 10 (p < 0.05, p < 0.01), while the levels of these two parameters were obviously increased at Day 20 (p < 0.05, p < 0.01). The IFN-β levels of the NCU-H and NCU-M groups significantly increased when compared with the IM group (p < 0.05), while that of the NCU-L group at Day 20 was higher than that at Day 10 (p < 0.05). The levels of antibody IgE in the NCU-M and NCU-L groups were all slightly lower than that in the IM group, but there were no significant differences. mRNA Expression Levels of Cytokines in the Small Intestine. There was a significant decrease in IL-6 mRNA expression levels in the NCU-H, NCU-M, and NCU-L groups at Day 10 of treatment compared with the IM group (P < 0.05), whereas the expression levels of IL-2 and IFN-γ mRNA were increased in the NCU-H, NCU-M, and NCU-L groups
■
DISCUSSION Cancers cause high mortality to humans, which accounts for approximately 1 in 8 deaths globally.19 It is also well-known that most of the anticancer drugs currently used in chemotherapy bring adversity to healthy cells and usually cause sideeffects, such as myelosuppression, immunosuppression, and oxidative stress, which sometimes may be life-threatening.20 For instance, CTX as an alkylating agent has been most widely used in chemotherapy.21 However, CTX can damage the structure of DNA, damage the immune cells, interfere with the proliferation and differentiation of T and B cells, decrease the number of normal T and B cells, and inhibit the cellular and humoral immune responses.3 Therefore, mice treated with CTX were used as an animal model of a weakened immune system to validate the immunoenhancement of L. plantarum NCU116 in this study. The results showed that CTX markedly reduced the body weight and immune organ index, and inhibited the proliferation and differentiation of IgA-secreting cells. In addition, the levels
Table 1. Effects of L. plantarum NCU116 on Thymus and Spleen Index in Miceα Parameters
Times
Thymus index
D10 D20 D10 D20
Spleen index
NIM 2.61 2.63 5.90 5.85
± ± ± ±
0.37* 0.23 0.28* 0.19*
IM 2.02 2.33 4.87 5.14
± ± ± ±
BB12 0.16 0.14 0.35 0.17
2.70 2.75 5.60 5.49
± ± ± ±
0.19* 0.16* 0.28* 0.29
NCU-H 2.46 2.66 5.83 5.47
± ± ± ±
0.16* 0.30* 0.24* 0.21
NCU-M 2.58 2.57 5.22 5.27
± ± ± ±
0.30* 0.30* 0.48 0.36
NCU-L 2.67 2.56 5.90 5.16
± ± ± ±
0.16* 0.21* 0.40* 0.20
α
NIM, nonimmunosuppression + saline; IM, immunosuppression + saline; BB12, IM + 109 CFU/mL Bif idobacterium BB12; NCU-H, IM + 1010 CFU/mL L. plantarum NCU116; NCU-M, IM + 109 CFU/mL L. plantarum NCU116; NCU-L, IM + 108 CFU/mL L. plantarum NCU116. Data are expressed as the mean ± SD (n = 4). *p < 0.05. 10916
DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
Article
Journal of Agricultural and Food Chemistry Table 2. Effect of L. plantarum NCU116 on Levels of Cytokines in Small Intestine in Miceα Parameters IL-2 (pg/mL) IFN-γ (ng/mL) TNF-α (pg/mL) IFN-β (pg/mL) IL-12p70 (pg/mL) IL-4 (pg/mL) IL-6 (pg/mL) IL-10 (pg/mL) sIgA (μg/mL) IgE (μg/mL)
Times
NIM
IM
BB12
NCU-H
NCU-M
NCU-L
D10 D20 D10 D20 D10 D20 D10 D20 D10 D20 D10 D20 D10 D20 D10 D20 D10 D20 D10 D20
230 ± 10.7** 208 ± 13.9* 2.24 ± 0.20** 2.50 ± 0.22** 324 ± 13.1* 317 ± 14.2* 145 ± 11.4 127 ± 11.2 326 ± 31.2** 320 ± 24.7** 154 ± 18.2* 146 ± 14.1 402 ± 29.5** 414 ± 30.2** 395 ± 30.3* 377 ± 24.6* 8.86 ± 0.34* 8.77 ± 0.47* 3.45 ± 0.45** 3.34 ± 0.23**
121 ± 9.00 154 ± 14.3# 0.97 ± 0.07 0.98 ± 0.02 301 ± 25.3 283 ± 28.5 128 ± 12.7 121 ± 12.3 164 ± 13.9 208 ± 11.0 128 ± 10.2 147 ± 12.5 223 ± 10.4 230 ± 20.8 311 ± 24.3 314 ± 18.1 5.23 ± 0.12 6.44 ± 0.14# 2.20 ± 0.21 1.87 ± 0.13
141 ± 10.8* 601 ± 34.1**## 1.45 ± 0.23* 2.24 ± 0.25*# 344 ± 20.9 389 ± 23.1*# 136 ± 12.5 136 ± 17.4 226 ± 26.8* 243 ± 20.4* 107 ± 12.0 211 ± 10.6*## 274 ± 23.4* 229 ± 17.8 406 ± 25.5* 410 ± 38.9* 10.2 ± 0.54** 10.1 ± 0.57* 2.77 ± 0.22* 1.87 ± 0.14#
142 ± 11.9* 269 ± 26.8**## 1.52 ± 0.20* 1.51 ± 0.15* 367 ± 26.1* 377 ± 32.1* 266 ± 17.9* 232 ± 18.9* 216 ± 21.4* 227 ± 20.9 106 ± 10.2* 212 ± 20.8*## 228 ± 25.3 237 ± 23.0 509 ± 56.2** 407 ± 32.1*# 10.6 ± 0.32** 11.4 ± 0.51** 2.33 ± 0.13 2.04 ± 0.17
152 ± 13.9* 233 ± 15.5**## 1.40 ± 0.16* 1.45 ± 0.14* 339 ± 28.2 303 ± 30.0 211 ± 17.3* 205 ± 13.3* 246 ± 20.6* 236 ± 24.9 79.0 ± 8.71* 175 ± 11.5*## 188 ± 13.7* 221 ± 24.1# 419 ± 31.6* 395 ± 29.6* 10.5 ± 0.42** 10.8 ± 0.31** 1.99 ± 0.11 1.73 ± 0.15#
150 ± 10.1* 313 ± 27.5**## 1.34 ± 0.13* 1.45 ± 0.16* 285 ± 25.0 310 ± 33.4 143 ± 12.1 207 ± 1.40*# 219 ± 7.68* 229 ± 24.5 74.4 ± 2.90* 215 ± 17.0*## 130 ± 15.9** 212 ± 13.9## 387 ± 34.2* 408 ± 31.2* 10.6 ± 0.57** 10.6 ± 0.33** 2.09 ± 0.26 1.65 ± 0.11#
α
NIM, nonimmunosuppression + saline; IM, immunosuppression + saline; BB12, IM + 109 CFU/mL Bif idobacterium BB12; NCU-H, IM + 1010 CFU/mL L. plantarum NCU116; NCU-M, IM + 109 CFU/mL L. plantarum NCU116; NCU-L, IM + 108 CFU/mL L. plantarum NCU116. Data are expressed as the mean ± SD (n = 10). *p < 0.05. **p < 0.01 compared with IM group. #p < 0.05. ##p < 0.01 compared with D10.
Figure 2. mRNA expression levels of the cytokines IL-2, IL-6, and IFN-γ in the small intestine. The graph represents the mRNA levels relative to βactin. NIM, non-immunosuppression + saline; IM, immunosuppression + saline; BB12, IM + 109 CFU/mL Bif idobacterium BB12; NCU-H, IM + 1010 CFU/mL L. plantarum NCU116; NCU-M, IM + 109 CFU/mL; L. plantarum NCU116; NCU-L, IM + 108 CFU/mL L. plantarum NCU116. Data are expressed as the mean ± SD (n = 10). *p < 0.05, **p < 0.01 compared with the IM group; #p < 0.05, compared with D10.
groups were prominently greater than those in the IM group at 10 days and 20 days, and the spleen index was close to the normal level at 10 days (Table 1). These results indicated that L. plantarum NCU116 and Bif idobacterium BB12 could resist the effect of immunosuppression on the development of immune organs. As the body’s largest immune organ, intestinal mucosa are endowed with powerful defense mechanisms that degrade and repel most foreign materials.26,27 Meanwhile, a large and highly specialized innate and adaptive mucosal immune system protects the mucosal surfaces against potential damages from the environment. The innate immune system is mainly formed by NK cells, dendritic cells (DC), granulocytes, as well as macrophages and their secreted products, such as nitric oxide and various cytokines.4 Some previous studies have shown that Bif idobacterium BB12 can increase the levels of intestinal cytokines and antibodies.29−31 A study in mice with mite allergy
of the cytokines and immunoglobulins, and the mRNA expression levels of cytokines IL-2 and IL-6 and of IFN-γ genes were decreased by CTX. Moreover, CTX impaired the expression levels of T-bet and GATA-3, the two key regulatory proteins involved in the Th1/Th2 cell differention. These data are consistent with previous reports.15,20,22,23 Results from our study clearly indicated that the immune functions of mice were significantly inhibited by CTX, and the immunosuppressive model was successfully established. Thymus and spleen are important immune organs in the body, which are the growth and proliferation places of immunological cells. The development status of the immune organs directly impacts the host immune function, and immune organ index has been used to reflect the development of immune organs. It was reported that some lactic acid bacteria significantly improved the immune organ index.24,25 Our observation showed that the thymus indexes in four treatment 10917
DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
Article
Journal of Agricultural and Food Chemistry
infectious diseases.28 Our results suggest that the consumption of L. plantarum NCU116 and Bifidobacterium BB12 led to an increase in the number of IgA-secreting cells and promoted the secretion of antibody sIgA (Table 2 and Figure 3). Another study also showed that oral administration of L. plantarum improved the antiviral infection ability by promoting the antibody sIgA secretion.5 It is well-known that Th1/Th2 are two distinct subsets of T lymphocytes. Following antigen recognition, the activated Th cells are divided into Th1 and Th2 according to the function and their difference in secretion of cytokines: Th1 cells secrete IL-2, IFN-γ, and TNF-a, which mainly enhance the cellular immune response, whereas Th2 cells secrete IL-4, IL-6, and IL10, which mainly enhance the humoral immune response.32 The function of Th1/Th2 is at a kinetic equilibrium state, in order to maintain normal cellular and humoral immune function. Some studies have reported considerable influence of Lactobacillus on the Th1/Th2 immune responses.33 The current study showed that L. plantarum NCU116 promoted the secretion of Th1 immune response cytokines IL-2, IFN-γ, and IL-12p70, and upregulated the mRNA expression levels of IL-2 and IFN-γ. In addition, the L. plantarum NCU116 also induced production of IL-10, which is a suppressor of IL-12.34 However, the levels of Th2 immune response cytokines IL-4 and IL-6 were decreased in L. plantarum NCU116-fed mice (Table 2 and Figure 2). These results may suggest an increase in the Th1 immune response, which represses Th2 polarization. However, excessive Th1 immune response is considered to induce various immune disorders, such as inflammatory bowel disease.35 Interestingly, there was no significant difference observed for the Th1 immune response cytokines IFN-γ, IL-12p70, and TNF-α when supplemented with L. plantarum NCU116 for 20 days compared with 10 days, although the contents of some cytokines were slightly decreased. In contrast, the Th2 immune
Figure 3. Effect of administration of L. plantarum NCU116 on the number of IgA-secreting cells in the small intestine. Positive cells were counted in histological sections from the small intestine in six different groups. NIM, non-immunosuppression + saline; IM, immunosuppression + saline; BB12, IM + 109 CFU/mL Bif idobacterium BB12; NCU-H, IM + 1010 CFU/mL L. plantarum NCU116; NCU-M, IM + 109 CFU/mL; L. plantarum NCU116; NCU-L, IM + 108 CFU/mL L. plantarum NCU116. Data are expressed as the mean ± SD (n = 10). *p < 0.05, **p < 0.01 compared with the IM group.
suggested that L. plantarum triggered the release of IL-10 and IL-12 p70 by DC.7 In this study, it should be noted that the contents of cytokines (IL-2, IFN-γ, IL-10, and IL-12p70) in four treatment groups supplemented with L. plantarum NCU116 and Bif idobacterium BB12 significantly increased as compared with those in the IM group (Table 2). The adaptive immune system was mediated by T and B lymphocytes with specific antibodies and a series of immune factors to resist
Figure 4. Western blot analysis of T-bet and GATA-3. Total protein extracts were prepared and then analyzed by Western blotting with anti-T-bet, anti-GATA-3, and anti-β-actin. Ten days after treatment (A) and 20 days after treatment (B). The bar graph represents the relative intensities of the protein bands of T-bet (C), GATA-3, #(IM, D20) (D), and T-bet/GATA-3 (E) quantified by densitometry using Quantity one 4.0 software. NIM, non-immunosuppression + saline; IM, immunosuppression + saline; BB12, IM + 109 CFU/mL Bif idobacterium BB12; NCU-H, IM + 1010 CFU/mL L. plantarum NCU116; NCU-M, IM + 109 CFU/mL; L. plantarum NCU116; NCU-L, IM + 108 CFU/mL L. plantarum NCU116. Data are expressed as the mean ± SD (n = 10). *p < 0.05, **p < 0.01 compared with IM group; #p < 0.05, compared with D10. 10918
DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
Article
Journal of Agricultural and Food Chemistry Notes
response cytokines IL-4 and IL-6 showed a small increase at 20 days (Table 2 and Figure 2). These results indicate that L. plantarum NCU116 may maintain normal immune function by regulating the Th1/Th2 balance. sIgA and IgE are the major immunoglobulins in intestinal humoral immune response,36,37 and they have many kinds of immunological activities, such as antibacteria, antivirus, and antitumor effects. Th cells with their cytokines have significant regulatory effects on the synthesis of sIgA and IgE. In this study, L. plantarum NCU116 and Bif idobacterium BB12 obviously increased the formation of sIgA, not IgE, in the small intestine. The content of the sIgA was not significantly increased at Day 20 (Table 2). Our results were consistent with a previous study that oral administration of L. plantarum significantly inhibited IgE production and enhanced the Th1 response.38 T-bet, a Th1-specific T box transcriptional factor, is the master regulator that controls the initiation of Th1 development. In contrast, GATA-3, a member of the GATA family of zinc finger proteins is considered to act as a pivotal Th2-specific transcription factor that induces Th2 development.39 So it is suggested that T-bet/GATA-3 ratio could be used as a surrogate marker for Th1/Th2 profile assessment.40 We assessed the expression levels of these proteins in the small intestine. Results showed that T-bet/GATA-3 ratio was increased strikingly in L. plantarum NCU116 and Bif idobacterium BB12 treated groups at 10 days. But the treatment of L. plantarum NCU116 slightly reduced T-bet/GATA-3 ratio at 20 days (Figure 4). Our study has clearly demonstrated that L. plantarum NCU116 can regulate the Th1/Th2 balance. Previous studies have suggested that L. plantarum can regulate the Th1/Th2 balance to a Th1-dominant state in vitro and in vivo.5,34 But the L. plantarum isolated from Kimchi was reported to repress the Th1 immune response.41 Other studies showed that Lactobacilli enhanced immunity in mice in dose and strain dependent manners. Thus, different Lactobacilli strains and dosages may cause different immune responses.4 However, the molecular mechanism by which L. plantarum NCU116 regulates the Th1/Th2 balance is still unclear. Zheng et al reported that Bif idobacterium attenuated colitis by increasing the immune response of regulatory T cells (Treg), which had a special regulatory function of inhibiting the activities of the other T cell subsets.42 Our results showed that the presence of L. plantarum NCU116 early in immunosuppressed mice skewed the immune system towards a Th1 immune response. But there was no significant increase in the intensity of Th1 immune response, and Th2 immune response intensity was slightly increased under by oral administration of L. plantarum NCU116 in 20 days. The above imply that the Th1/Th2 balance may be adjusted by regulating the Th17/ Treg balance. In conclusion, the present study has demonstrated that L. plantarum NCU116 improved the immunity and regulated the Th1/Th2 balance, similar to the effects of Bif idobacterium BB12. Our results also suggest that L. plantarum NCU116 is a potent immunomodulating agent, and may be applied to antineoplastic immunotherapy in combination with chemotherapeutic agents.
■
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
■
REFERENCES
The authors are grateful for financial support from the National High Technology Research and Development Key Program of China (863 Key Program, 2011AA100904) and the Program for New Century Excellent Talents in University (NCET-120749).
(1) Yan, Z. G.; Du, Y. J.; Zhao, Q. Y.; Fan, R. F.; Guo, W. L.; Ma, R. D.; Wang, X. J.; Zhu, R. L. Mucosal immune responses against live newcastle disease vaccine in immunosuppressed chickens. Pak Vet J. 2011, 31, 280−286. (2) Patel, D. M.; Riedel, D. J. Fever in immunocompromised hosts. Emerg Med. Clin N Am. 2013, 31, 1059−1071. (3) Fan, Y.; Lu, Y.; Wang, D.; Liu, J.; Song, X.; Zhang, W.; Zhao, X.; Nguyen, T. L.; Hu, Y. Effect of epimedium polysaccharide-propolis flavone immunopotentiator on immunosuppression induced by cyclophosphamide in chickens. Cell. Immunol. 2013, 281, 37−43. (4) Tsai, Y. T.; Cheng, P. C.; Pan, T. M. The immunomodulatory effects of lactic acid bacteria for improving immune functions and benefits. Appl. Microbiol. Biotechnol. 2012, 96, 853−862. (5) Kawashima, T.; Hayashi, K.; Kosaka, A.; Kawashima, M.; Igarashi, T.; Tsutsui, H.; Tsuji, N. M.; Nishimura, I.; Hayashi, T.; Obata, A. Lactobacillus plantarum strain YU from fermented foods activates Th1 and protective immune responses. Int. Immunopharmacol. 2011, 11, 2017−2024. (6) Kikuchi, Y.; Kunitoh-Asari, A.; Hayakawa, K.; Imai, S.; Kasuya, K.; Abe, K.; Adachi, Y.; Fukudome, S.; Takahashi, Y.; Hachimura, S. Oral administration of Lactobacillus plantarum strain AYA enhances IgA secretion and provides survival protection against influenza virus infection in mice. PLoS One 2014, 9, 1−9. (7) Rigaux, P.; Daniel, C.; Hisbergues, M.; Muraille, E.; Hols, P.; Pot, B.; Pestel, J.; Jacquet, A. Immunomodulatory properties of Lactobacillus plantarum and its use as a recombinant vaccine against mite allergy. Allergy 2009, 64, 406−414. (8) Rizzo, A.; Losacco, A.; Carratelli, C. R.; Domenico, M. D.; Bevilacqua, N. Lactobacillus plantarum reduces Streptococcus pyogenes virulence by modulating the IL-17, IL-23 and Toll-like receptor 2/4 expressions in human epithelial cells. Int. Immunopharmacol. 2013, 17, 453−461. (9) Xiong, T.; Song, S. H.; Huang, X. H.; Feng, C.; Liu, G. Q.; Huang, J. Q.; Xie, M. Y. Screening and identification of functional Lactobacillus specific for vegetable fermentation. J. Food Sci. 2013, 78, M84−M89. (10) Xiong, T.; Guan, Q. Q.; Song, S. H.; Hao, M. Y.; Xie, M. Y. Dynamic changes of lactic acid bacteria flora during Chinese sauerkraut fermentation. Food Control 2012, 26, 178−181. (11) Xiong, T.; Huang, X. H.; Huang, J. Q.; Song, S. H.; Feng, C.; Xie, M. Y. High-density cultivation of Lactobacillus plantarum NCU116 in an ammonium and glucose fed-batch system. Afr J. Biotechnol 2011, 10, 7518−7525. (12) Li, C.; Ding, Q.; Nie, S. P.; Zhang, Y. S.; Xiong, T.; Xie, M. Y. Carrot juice fermented with Lactobacillus plantarum NCU116 ameliorates type 2 diabetes in rats. J. Agric. Food Chem. 2014, 62, 11884−11891. (13) Li, C.; Nie, S. P.; Zhu, K. X.; Ding, Q.; Li, C.; Xiong, T.; Xie, M. Y. Lactobacillus plantarum NCU116 improves liver function, oxidative stress and lipid metabolism in rats with high fat diet induced nonalcoholic fatty liver disease. Food Funct. 2014, 5, 3216−3223. (14) Li, C.; Nie, S. P.; Zhu, K. X.; Xiong, T.; Li, C.; Gong, J.; Xie, M. Y. Effect of Lactobacillus plantarum NCU116 on loperamide-induced constipation in mice. Int. J. Food Sci. Nutr. 2015, 1−6. (15) Gronbaek, H.; Skjaerbaek, C.; Orskov, H.; Flyvbjerg, A. Effect of immunosuppression on kidney and serum insulin-like growth factor-I
AUTHOR INFORMATION
Corresponding Author
*Tel & Fax: +86-791-88304452. E-mail address: spnie@ncu. edu.cn. 10919
DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
Article
Journal of Agricultural and Food Chemistry
(34) Won, T. J.; Kim, B.; Song, D. S.; Lim, Y. T.; Oh, E. S.; Lee do, I.; Park, E. S.; Min, H.; Park, S. Y.; Hwang, K. W. Modulation of Th1/ Th2 balance by Lactobacillus strains isolated from Kimchi via stimulation of macrophage cell line J774A.1 in vitro. J. Food Sci. 2011, 76, H55−H61. (35) Sventoraityte, J.; Zvirbliene, A.; Kiudelis, G.; Zalinkevicius, R.; Zvirbliene, A.; Praskevicius, A.; Kupcinskas, L.; Tamosiunas, V. Immune system alterations in patients with inflammatory bowel disease during remission. Medicina 2008, 44, 27−33. (36) Becker, Y. Respiratory syncytial virus (RSV) evades the human adaptive immune system by skewing the Th1/Th2 cytokine balance toward increased levels of Th2 cytokines and IgE, markers of allergy - a review. Virus Genes 2006, 33, 235−252. (37) Hiramatsu, Y.; Hosono, A.; Konno, T.; Nakanishi, Y.; Muto, M.; Suyama, A.; Hachimura, S.; Sato, R.; Takahashi, K.; Kaminogawa, S. Orally administered Bif idobacterium triggers immune responses following capture by CD11c(+) cells in Peyer’s patches and cecal patches. Cytotechnology 2011, 63, 307−317. (38) Enomoto, M.; Noguchi, S.; Hattori, M.; Sugiyama, H.; Suzuki, Y.; Hanaoka, A.; Okada, S.; Yoshida, T. Oral Administration of Lactobacillus plantarum NRIC0380 suppresses IgE production and induces CD4(+)CD25(+)Foxp3(+) cells in vivo. Biosci., Biotechnol., Biochem. 2009, 73, 457−460. (39) Yao, R. X.; Lin, Y.; Li, Q. Q.; Zhou, X. M.; Pan, X. H.; Bao, Y. H.; He, M. Q.; Zhu, B. L.; Guo, W. J.; Lin, X. J.; Jin, L. M. Downregulation of T-bet/GATA-3 ratio induced by IL-11 treatment is responsible for Th1/Th2 balance restoration in human immune thrombocytopenic purpura (ITP). J. Thromb. Thrombolysis 2014, 38, 183−189. (40) Chakir, H.; Wang, H. P.; Lefebvre, D. E.; Webb, J.; Scott, F. W. T-bet/GATA-3 ratio as a measure of the Th1/Th2 cytokine profile in mixed cell populations: predominant role of GATA-3. J. Immunol. Methods 2003, 278, 157−169. (41) Hong, Y. F.; Kim, H.; Kim, H. R.; Gim, M. G.; Chung, D. K. Different immune regulatory potential of Lactobacillus plantarum and Lactobacillus sakei isolated from Kimchi. J. Microbiol. Biotechnol. 2014, 24, 1629−1635. (42) Zheng, B.; van Bergenhenegouwen, J.; Overbeek, S.; van de Kant, H. J.; Garssen, J.; Folkerts, G.; Vos, P.; Morgan, M. E.; Kraneveld, A. D. Bif idobacterium breve attenuates murine dextran sodium sulfate-induced colitis and increases regulatory T cell responses. PLoS One 2014, 9, 1−11.
(IGF-I), IGF binding proteins, and renal growth following unilateral nephrectomy in rats. Metab., Clin. Exp. 1998, 47, 817−823. (16) Monk, J. M.; Richard, C. L.; Woodward, B. A non-inflammatory form of immune competence prevails in acute pre-pubescent malnutrition: new evidence based on critical mRNA transcripts in the mouse. Br. J. Nutr. 2012, 107, 1249−1253. (17) Giulietti, A.; Overbergh, L.; Valckx, D.; Decallonne, B.; Bouillon, R.; Mathieu, C. An overview of real-time quantitative PCR: Applications to quantify cytokine gene expression. Methods 2001, 25, 386−401. (18) Tsai, Y. T.; Cheng, P. C.; Pan, T. M. Immunomodulating activity of Lactobacillus paracasei subsp. paracasei NTU 101 in enterohemorrhagic Escherichia coli O157H7 - infected mice. J. Agric. Food Chem. 2010, 58, 11265−11272. (19) Harford, J. B. Viral infections and human cancers: the legacy of Denis Burkitt. Br. J. Haematol. 2012, 156, 709−718. (20) Yu, Q.; Nie, S. P.; Wang, J. Q.; Liu, X. Z.; Yin, P. F.; Huang, D. F.; Li, W. J.; Gong, D. M.; Xie, M. Y. Chemoprotective effects of Ganoderma atrum polysaccharide in cyclophosphamide-induced mice. Int. J. Biol. Macromol. 2014, 64, 395−401. (21) Pass, G. J.; Carrie, D.; Boylan, N.; Lorimore, S.; Wright, E.; Houston, B.; Henderson, C. J.; Wolf, C. R. Role of hepatic cytochrome P450s in the pharmacokinetics and toxicity of cyclophosphamide: Studies with the hepatic cytochrome P450 reductase null mouse. Cancer Res. 2005, 65, 4211−4217. (22) Huang, G. C.; Wu, L. S.; Chen, L. G.; Yang, L. L.; Wang, C. C. Immuno-enhancement effects of Huang Qi Liu Yi Tang in a murine model of cyclophosphamide-induced leucopenia. J. Ethnopharmacol. 2007, 109, 229−235. (23) Wang, H.; Wang, M. Y.; Chen, J.; Tang, Y.; Dou, J.; Yu, J.; Xi, T.; Zhou, C. L. A polysaccharide from Strongylocentrotus nudus eggs protects against myelosuppression and immunosuppression in cyclophosphamide-treated mice. Int. Immunopharmacol. 2011, 11, 1946− 1953. (24) Li, S. P.; Zhao, X. J.; Wang, J. Y. Synergy of Astragalus polysaccharides and probiotics (Lactobacillus and Bacillus cereus) on immunity and intestinal microbiota in chicks. Poult. Sci. 2009, 88, 519−525. (25) Slawinska, A.; Siwek, M.; Zylinska, J.; Bardowski, J.; Brzezinska, J.; Gulewicz, K. A.; Nowak, M.; Urbanowski, M.; Plowiec, A.; Bednarczyk, M. Influence of Synbiotics Delivered in ovo on Immune Organs Development and Structure. Folia Biol. 2014, 62, 277−285. (26) Luo, Q.; Cui, H.; Peng, X.; Fang, J.; Zuo, Z.; Liu, J.; Wu, B.; Deng, Y. The association between cytokines and intestinal mucosal immunity among broilers fed on diets supplemented with fluorine. Biol. Trace Elem. Res. 2013, 152, 212−218. (27) Holmgren, J.; Czerkinsky, C. Mucosal immunity and vaccines. Nat. Med. 2005, 11, S45−S53. (28) Irie, T.; Watarai, S.; Kodama, H. Humoral immune response of carp (Cyprinus carpio) induced by oral immunization with liposomeentrapped antigen. Dev. Comp. Immunol. 2003, 27, 413−421. (29) Holscher, H. D.; Czerkies, L. A.; Cekola, P.; Litov, R.; Benbow, M.; Santema, S.; Alexander, D. D.; Perez, V.; Sun, S. M.; Saavedra, J. M.; Tappenden, K. A. Bif idobacterium lactis Bb12 enhances intestinal antibody response in formula-fed infants: a randomized, double-blind, controlled trial. JPEN, J. Parenter. Enteral Nutr. 2012, 36, 106s−117s. (30) Roller, M.; Femia, A. P.; Caderni, G.; Rechkemmer, G.; Watzl, B. Intestinal immunity of rats with colon cancer is modulated by oligofructose-enriched inulin combined with Lactobacillus rhamnosus and Bifidobacterium lactis. Br. J. Nutr. 2004, 92, 931−938. (31) Ruiz, P. A.; Hoffmann, M.; Szcesny, S.; Blaut, M.; Haller, D. Innate mechanisms for Bif idobacterium lactis to activate transient proinflammatory host responses in intestinal epithelial cells after the colonization of germ-free rats. Immunology 2005, 115, 441−450. (32) Kidd, P. Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease. Altern Med. Rev. 2003, 8, 223−246. (33) Borchers, A. T.; Keen, C. L.; Gershwin, M. E. The influence of yogurt/Lactobacillus on the innate and acquired immune response. Clin. Rev. Allergy Immunol. 2002, 22, 207−230. 10920
DOI: 10.1021/acs.jafc.5b04757 J. Agric. Food Chem. 2015, 63, 10914−10920
