Efficient Surface Patterning of Oligonucleotides Inside a Glass

of oligonucleotides was accomplished onto the inner wall of fused-silica capillary tubes as well as on the surface of glass slides through oxime b...
0 downloads 0 Views 107KB Size
Download PDF
Bioconjugate Chem. 2007, 18, 671−676

671

Efficient Surface Patterning of Oligonucleotides Inside a Glass Capillary through Oxime Bond Formation Nabil Dendane,#,† Antoine Hoang,# Ludovic Guillard,† Eric Defrancq,†,* Franc¸ oise Vinet,# and Pascal Dumy† De´partement de Chimie Mole´culaire - UMR CNRS 5250, ICMG FR2607, Universite´ Joseph Fourier, BP 53, 38041 Grenoble Cedex 9, France, and LETI-CEA, 17 rue des Martyrs, 38054 Grenoble Cedex 9, France. Received August 16, 2006; Revised Manuscript Received December 5, 2006

The efficient surface patterning of oligonucleotides was accomplished onto the inner wall of fused-silica capillary tubes as well as on the surface of glass slides through oxime bond formation. The robustness of the method was demonstrated by achieving the surface immobilization of up to three different oligonucleotide sequences inside the same capillary tube. The method involves the preparation of surfaces grafted with reactive aminooxy functionalities masked with the photocleavable protecting group, 2-(2-nitrophenyl) propyloxycarbonyl group (NPPOC). Briefly, NPPOC-aminooxy silane 1 was prepared and used to silanize the glass surfaces. The NPPOC group was cleaved under brief irradiation to unmask the reactive aminooxy group on surfaces. These reactive aminooxy groups were allowed to react with aldehyde-containing oligonucleotides to achieve an efficient surface immobilization. The advantage associated with the present approach is that it combines the high-coupling efficiency of oxime bond formation with the convenience associated with the use of photolabile groups. The present strategy thus offers an alternative approach for the immobilization of biomolecules in the microchannels of “labs on a chip” devices.

INTRODUCTION The miniaturization of biological assays represents an intensive domain of research especially for the design of highthroughput screening systems. In this context, the microarrays of biomolecules such as DNA, carbohydrates, and peptides have emerged as versatile tools with diverse applications in the areas of genetic analysis, molecular diagnostics, and drug discovery. Similarly, there is a significant interest in the design of microfluidic systems with an objective to achieve integration of synthesis, purification, and analysis steps on a chip. The “lab on a chip” device along with the microarrays technologies would indeed revolutionize the diagnostic field by permitting more rapid, economical, and multiparametric analysis with minimum volumes of samples (1, 2). The critical step in the preparation of microarrays and/or “lab on a chip” device is the control of surface chemistry. One challenging task is to carry out the surface immobilization of biomolecules (DNA, proteins) without affecting their intrinsic properties. Two major strategies are being currently used for the patterning of biomolecules on planar arrays. The first approach involves surface synthesis (in situ synthesis) whereas the second approach implicates the deposition of prefabricated biomolecules on the surface. The in-situ synthesis, pioneered by Fodor and Coll (3) for the preparation of DNA arrays, takes advantage of the photolithography technique for the photochemical addressing of the oligonucleotides on the surface and provides high-density arrays. While very promising, the method suffers from the fact that only short-length oligonucleotide sequences can be synthesized on the surface and the costs incurred are relatively high. Moreover, the procedure becomes arduous when used for the preparation of other microarrays (carbohydrates and peptides for example). On the other hand, * Corresponding author. Fax: [email protected]. † University J. Fourier. # LETI-CEA.

+33(0)4.76.51.49.46, E-mail:

the deposition technology involves the attachment (covalent or noncovalent) of prefabricated biomolecules to the surface (4). This approach utilizes “spotting techniques” and benefits from the fact that automated robots can be used to immobilize biomolecules on the surface. The major advantage is the fact that biomolecules prepared by chemical or enzymatic methods can be fully purified and characterized prior to spotting. This spotting technology is limited to low complexity arrays only but allows more flexibility. The surface immobilization is mostly achieved by chemical reaction between surface-bound reactive groups and prefunctionalized biomolecules. A large number of combinations of surface/biomolecule functions have been used for this purpose and mostly include maleimide/thiol (5), “click chemistry” involving alkyne/azide (6, 7), hydrazide/aldehyde (8, 9), etc. The patterning of biomolecules inside the microchannels used in the design of “lab on a chip” is more complicated due to the closed geometry of this format. To our knowledge, only two methods have been reported to date. The first method involves the photogeneration of surface-bound aldehyde groups for the immobilization of proteins via the formation of a Schiff base (10). The second method is based on the photo-cross-linking of surface-bound benzophenone derivatives with biomolecules via C-H insertion (11). Consequently, the design and development of alternative chemical approaches for surface immobilization of biomolecules inside the closed space (microchannels) have assumed significant research interest. The paper describes a new method that allows an efficient immobilization of oligonucleotides (as an example of biomolecules) onto the surface of inner wall of fused-silica capillary tubes as well as of glass slides by utilizing the oxime chemistry. The present approach involves the grafting of aminooxy functionalities protected with a photolabile group on the surface. The photolabile group is then removed by irradiation thereby generating reactive aminooxy functions at predefined positions. This is followed by the deposition of the biomolecule functionalized with an aldehyde group, which reacts with the

10.1021/bc060254v CCC: $37.00 © 2007 American Chemical Society Published on Web 03/10/2007

672 Bioconjugate Chem., Vol. 18, No. 3, 2007

aminooxy functions and thus gets immobilized onto the surfaces due to the formation of oxime bond. In order to prove the concept, we have used oligonucleotides as biomolecule and we have first studied all the steps required for the immobilization of oligonucleotides on a planar format. The sensitivity of the arrays prepared by this method for detecting the target sequence was evaluated, and a reasonably high sensitivity of detection (1 nM) was achieved. The potential utility of the present approach for the surface functionalization and immobilization inside the microchannel for “lab on a chip” devices has been further demonstrated by carrying out surface immobilization of three different oligonucleotides sequences onto the inner wall of a same capillary tube and simultaneously monitoring the three hybridization events.

EXPERIMENTAL PROCEDURES Materials and Methods. All solvents and reagents used were of highest purity available. The complementary labeled oligonucleotides were purchased from MWG Biotech and the hybridization solution from Sigma. Flexible fused-silica capillaries with UV-transparent coating (interior diameter: 100 µm) were obtained from Polymicro Technologies (Phoenix, AZ). The oligonucleotides were characterized by ESI mass spectra on an Esquire 3000 (Bruker) spectrometer. The analysis was performed in negative mode using 50% aqueous acetonitrile as eluent. The oligonucleotides were dissolved in 50% aqueous acetonitrile containing 2% of NEt3. 1H, 29Si, and 13C NMR spectra were recorded on Bruker AC 200 and Avance 300 spectrometers. The irradiation experiment on capillaries were performed on an Olympus inverted microscope model IX60, equipped with a 100 W mercury lamp and a 365 nm interference filter. The patterning was performed by irradiation of the focus zone. Hybridization experiments were carried out using a Gentac Scanner (Genomic Solution). The excitation and emission wavelengths employed for different probes are as follows: Fluorescein (λExc. ) 494 nm, λEm. ) 518 nm), Cy3 (λExc. ) 550 nm, λEm. ) 570 nm), Cy5 (λExc. ) 649 nm, λEm. ) 670 nm), Texas Red (λExc. ) 595 nm, λEm. ) 615 nm). Synthesis. The 5′-aldehyde oligonucleotides were prepared as previously reported (12). The oligonucleotide sequences employed in the present work are 5′-d-XTTTTTGATAAACCCACTCTA-3′ (Seq1), 5′-d-XTTTTTTGATCATGTTGTTGCTTG-3′ (Seq2), 5′-d-XTTTTTTCGGATACCCAAGGA3′ (Seq3) respectively, where X represents the 5′-aldehyde linker. Compound 2. A solution of N-hydroxyphthalimide (3.50 g, 21 mmol) and potassium carbonate (8 g, 41 mmol) in DMF (250 mL) was heated for 1 h at 50 °C under argon. 11Bromoundecene (5.0 g, 21 mmol) was added, and the reaction mixture was stirred for 3 h at 50 °C. Then the reaction mixture was filtered, and the filtrate was evaporated under vacuum. The residue so obtained was redissolved in CH2Cl2 and successively washed with 0.1 N aq NaOH and brine. The organic layer was dried over Na2SO4 and evaporated to give compound 2 as a white powder (6.45 g, 97%). Mp 38-40 °C; 1H NMR (CDCl3) δ 1.20-1.50 (m, 12H; 6CH2), 1.78 (m, 2H; CH2CH2O), 2.02 (m, 2H; CH2CHdCH2), 4.18 (t, 2H; CH2O), 4.95 (m, 2H; CH2d CH), 5.79 (m, 1H; CH2dCH), 7.70-7.85 (m, 4H; Ar-H); 13C NMR (CDCl3) δ 25.66 (CH2), 28.27 (CH2), 29.03 (CH2), 29.20 (CH2), 29.39 (CH2), 29.49 (CH2), 29.52 (CH2), 33.90 (CH2), 78.72 (CH2), 114.22 (CH2), 123.56 (CH), 129.14 (Cquat), 134.52 (CH), 139.30 (Cquat), 163.75 (Cquat); MS (ESI): Mcalcd ) 315 (C19H25NO3), found (m/z): 338 (M + Na)+; Anal. calcd C 72.36 H 7.99 N 4.45, found C 72.21 H 8.13 N 4.40. Compound 3. Compound 2 (3 g, 9.5 mmol) was dissolved in CH2Cl2 (30 mL), and hydrazine hydrate (0,966 g, 19.3 mmol) was added. The solution was refluxed for 2 h and then filtered.

Dendane et al.

The filtrate was evaporated under vacuum. The crude product was purified by silica gel column chromatography using EtOAc/ cyclohexane as eluent (1/2, v/v) to obtain 3 as white oil (1.65 g, 94%). 1H NMR (CDCl3) δ 1.20-1.40 (m, 12H; 6CH2), 1.56 (m, 2H; CH2), 2.03 (m, 2H; CH2), 3.65 (t, 2H; CH2O), 4.905.02 (m, 2H; CHdCH2), 5.74-5.87 (m, 1H; CHdCH2); 13C (CDCl3) δ 26.11 (CH2), 28.51 (CH2), 29.02 (CH2), 29.20 (CH2), 29.51 (CH2), 29.58 (CH2), 29.61 (CH2), 33.89 (CH2), 76.26 (CH2), 114.20 (CH2), 139.25 (CH); MS (ESI): Mcalcd ) 185 (C11H23NO), found (m/z): 186 (M + H)+. Compound 4. A solution of 2-(2-nitrophenyl)propyl chloroformate (740 mg, 3 mmol) in CH2Cl2 (3 mL) was added dropwise to the solution of compound 3 (470 mg, 2.54 mmol) in pyridine (2 mL). The solution was stirred for 2 h in darkness and filtered, and the filtrate was evaporated under vacuum. The residue so obtained was redissolved in CH2Cl2, and the organic layer was washed successively with 10% aq sodium carbonate, 1 N aq HCl, and brine. The organic layer was dried (Na2SO4) and evaporated under vacuum. The crude product was purified by silica gel column chromatography using EtOAc/cyclohexane (1/4, v/v) as eluent to obtain compound 4 as an orange oil (873 mg, 87%). 1H NMR (CDCl3) δ 1.20-1.40 (m, 12H; 6CH2), 1.35 (d, 3H; CH3), 1.56 (m, 2H; CH2), 2.03 (m, 2H; CH2), 3.693,78 (m, 3H; CH + CH2O), 4.21-4.35 (m, 2H; CH2OCO), 4.90-5.01 (m, 2H; CHdCH2), 5.74-5.87 (m, 1H; CHdCH2), 7.34-7.56 (m, 4H, Ar-H); 13C NMR (CDCl3) δ 17.64 (CH3), 25.86 (CH2), 27.96 (CH2), 29.01 (CH2), 29.19 (CH2), 29.49 (CH2), 33.37 (CH), 33.89 (CH2), 69.35 (CH2), 77.14 (CH2), 114.22 (CH2), 124.20 (CH), 127.57 (CH), 128.21 (CH), 132.74 (CH), 137.14 (Cquat), 139.28 (CH), 150.66 (Cquat), 157.28 (Cquat); MS (ESI): Mcalcd ) 392 (C21H32N2O5), found (m/z): 415 (M + Na)+; Anal. calcd C 64.27 H 8.22 N 7.14, found C 64.16 H 8.48 N 6.88. Compound 1. Karstedt catalyst (0.1 M platinum(0)-1,3divinyl-1,1,3,3-tetramethyldisiloxane complex dissolved in poly(dimethylsiloxane), 15 µL, 0.02 equiv) was added to a solution of compound 4 (663 mg, 1.69 mmol) in triethoxysilane (1.5 mL). The reaction mixture was stirred for 4 h at 60 °C. The solvent was evaporated next under vacuum to obtain compound 1. This was used in next step without further purification. 1H NMR (200 MHz, CDCl3) δ 0.6 (m, 2H; CH2-Si), 1.10-1.30 (m, 16H; CH3 + CH2), 1.35 (d, 3H; CH3), 1.56 (m, 2H; CH2), 3.65-3.90 (m, 9H; CH + 4CH2O), 4.28 (m, 2H; CH2OCO), 7.20 (br s, 1H; NH), 7.35-7.75 (m, 4H, Ar-H); 13C NMR (75 MHz, CDCl3) δ 10.9 (CH2), 18.0 (CH3), 18.8 (CH3), 23.2 (CH2), 23.3 (CH2), 26.3 (CH2), 28.4 (CH2), 29.8 (CH2), 29.9 (CH2), 30.0 (CH2), 30.1 (CH2), 33.8 (CH), 58.8 (CH2O), 69.8 (CH2O), 77.6 (CH2), 124.6 (CH), 128.0 (CH), 128.6 (CH), 132.2 (CH), 137.0 (Cquat), 150.1 (Cquat), 157.1 (Cquat); 29Si NMR (59 MHz, CDCl3) δ -21.7. IR (NaCl): 3279 (br), 2975, 2926, 2855, 1752, 1728, 1528, 1082 cm-1. MS (ESI): Mcalcd ) 556 (C27H48N2O8Si), found (m/z): 579 (M + Na)+, 595 (M + K)+. Anal. calcd C 58.25 H 8.69 N 5.03, found C 58.62 H 8.57 N 5.05. Functionalization and Oligonucleotide Immobilization on Glass Surfaces. Step 1. Hydratation of the Surface: The glass slides were dipped in an aq ethanolic solution of NaOH (1 g NaOH, 4 mL H2O, 3 mL EtOH) for 1 h and washed successively with ultrapure H2O, 0.2 N aq HCl, and H2O again. The glass slides were then dried under nitrogen. Step 2. Silanization with 1: The glass slides were dipped in a 5 mM solution of compound 1 in toluene/NEt3 (97/3, v/v) for overnight storage at room temperature. The slides were washed with toluene followed by EtOH and finally dried under nitrogen. The glass slides were then cured at 110 °C for 3 h. Step 3. Photodeprotection: An aq pyridine solution (from 5% to 50%) was deposited on the glass slides, and a mask

Efficient Surface Patterning of Oligonucleotides

(containing holes of diameter: 80 µm) was applied on the surface. Irradiation for different time span was carried out by using a mercury lamp (100 W, 24 mW/cm2). After removal of the mask, the glass slides were washed with H2O and dried under nitrogen. Step 4. Immobilization: The glass slides were dipped in a solution of 0.4 M ammonium acetate buffer containing oligonucleotide-5′-aldehyde (Seq1, 2-20 µM) for different time durations (30 s-12 h). The glass slides were then successively washed with H2O, 1% aq SDS solution, and H2O and finally dried under nitrogen. Step 5. Hybridization: The glass slides were dipped in the hybridization solution of Cy3 labeled complementary oligonucleotide at different concentrations (0.1-100 nM) for 1 h at 39 °C. The glass slides were washed with 2X SSC buffer and dried under nitrogen. The glass slides were then scanned on a Gentac Scanner (Genomic Solution). Functionalization and Oligonucleotide Immobilization on Glass Surfaces Inside the Capillary Tubes. Step 1. Hydratation of the Capillary Tube: The capillary tube was filled with an aq ethanolic solution of NaOH (1 g NaOH, 4 mL H2O, 3 mL EtOH) for 1 h and washed successively with ultrapure H2O, 0.2 N aq HCl, and H2O. The capillary tube was then dried under nitrogen. Step 2. Silanization with 1: The capillary tube was filled with a 10 mM solution of compound 1 in trichloroethylene and incubated for overnight at room temperature. The capillary was then washed with trichloroethylene followed by EtOH and dried under nitrogen. Finally, the capillary tube was cured at 110 °C for 3 h. Step 3. Photodeprotection: The capillary tube was filled with a 5% aq pyridine solution and was mounted on the microscope stage. Irradiation for different time span was carried out by using a mercury lamp (100 W, 24 mW/cm2). The irradiations were focused at different positions on the capillary. Each irradiation thus corresponded to a separate spot on the capillary array. The capillary was then washed with H2O and dried under nitrogen. Step 4. Immobilization: The capillary was filled with a 0.4 M ammonium acetate buffer solution containing oligonucleotide5′-aldehyde (Seq1, 20 µM) for 2 min. A constant reagent flow (0.1-10 µL min-1) was applied by using a syringe pump. The capillary was successively washed with H2O, 1% aq SDS solution, and H2O and finally dried under nitrogen. Step 5. Hybridization: The capillary was filled with the hybridization solution of Cy3 labeled complementary oligonucleotide at different concentrations (10-100 nM) for 1 h at 39 °C. A constant flow of hybridization solution (0.1-10 µL.min-1) was maintened by using a syringe pump. The capillary was washed with 2X SSC buffer and then scanned by using a four-color microarray GeneTAC Scanner (Genomic Solutions). The same procedure as described above was further applied for surface immobilization of three different oligonucleotides inside the same capillary tube (multiple functionalization) by using oligonucleotides Seq1, Seq2, and Seq3. Each immobilization corresponded to a separate spot inside the capillary. The complementary sequences for Seq1, Seq2, and Seq3 were labeled with Fluorescein, Cy5, and Texas Red, respectively. These three complementary sequences were used as a mixture in the present case to carry out hybridization experiments. Specificity of Immobilization Chemistry. In order to investigate the site specificity of the approach, two control experiments were performed: the first one consisted of quenching the aminooxy group liberated during the photodeprotection, the second involved the use during the immobilization step of oligonucleotides, which do not contain the complementary aldehyde reactive group. The first control was carried out

Bioconjugate Chem., Vol. 18, No. 3, 2007 673

in a capillary tube as follows: the first three steps of the functionalization were carried out as before and the capillary tube was then washed with an acetone aqueous solution for 20 min. In this case, the liberated aminooxy functions on the glass surface should be quenched by the acetone by oxime bond formation. Subsequently, the oligonucleotide immobilization and hybridization steps were performed as before and the capillary tube was subjected to laser scanning. For the second control, the immobilization step was carried out by using a 0.4 M ammonium acetate buffer solution containing oligonucleotide5′-diol (20 µM) for 2 min. Hybridization was then performed using the complementary labeled strand as usual, and the capillary tube was scanned by using a four-color microarray GeneTAC Scanner (Genomic Solutions). Characterization of the Glass Surfaces. Contact Angle (θ) Measurements: The measurements of the contact angle θ of the NPPOC-modified glass surfaces were performed on a Digidrop (GBX) apparatus by using water and diiodomethane solvents. The analysis was done several times by using a series of different slides, and average values of 79° and 42° were found for water and diiodomethane, respectively. By comparison, the contact angle θ of unmodified glass slides was found to be less than 10° using water. Multireflexion IR (MIR method): 2920 (υCH), 1725 (υCO), 1550 (υNO2) cm-1. The measurements were carried out using a homemade setup placed in the sample compartment of a FTIR Bruker IFS55 spectrometer. Atomic Force Microscopy: The measurements were carried out on an AFM PicoPlus system (Molecular Imaging) by using acoustic mode (MAC mode). A roughness (rms) of 4 nm was found. Ellipsometry: Ellipsometric measurements were performed using an imaging ellipsometer EP3-SE from Nanofilm Technology GmbH (Germany). Vase experiments were performed ex situ under air conditions at 20 different wavelengths ranging from 366.3 to 1001.9 nm and at variable angles of incidence ranging from 50° to 80° by steps of 2°. Optical modeling was performed using the EP3View software from Nanofilm Technology GmbH. A four-layer model, Si/SiO2/Silane/ambient air, was used to fit the data. The optical properties of the bare silicon wafer were previously measured using a three-layer model, Si/ SiO2/ambient air.

RESULTS AND DISCUSSION An alternative approach for surface patterning of biomolecules was envisioned. The key features of the present approach were the preparation of surfaces grafted with the aminooxy functionality masked with a photocleavable protecting group and surface immobilization of aldehyde-containing oligonucleotides through the formation of oxime bonds. The possibility of a photolabile protecting group was explored because it is more convenient to use. The photolabile group can easily be removed by simple irradiation with light and thus excludes exhaustive deprotection chemistries from the protocol and subsequently associated side-reactions. The oxime bond formation was selected for the surface immobilization because it has been successfully utilized for the preparation of oligonucleotide (1214), peptide (15), and carbohydrates conjugates (16). The advantages associated with the use of oxime bonds are that the reaction is chemoselective and proceeds with high coupling efficiency without any additive. This bond is stable over a large range of pH. Last but not the least, these linkages have been used earlier for the preparation of oligonucleotides (17, 18) and carbohydrates arrays (19). It was therefore expected that the present approach would combine the high coupling efficiency of the oxime bond formation with the convenience associated with the use of photolabile protecting groups and will thus aid in achieving an efficient surface patterning.

674 Bioconjugate Chem., Vol. 18, No. 3, 2007

Dendane et al.

Scheme 1

The most documented photolabile-protecting group for an amine functionality is undoubtedly the nitroveratryloxycarbonyl group (NVOC). However, the NVOC photocleavage leads to the formation of an aldehyde byproduct that can react with the liberated aminooxy function. Hence, the NVOC was not found to be suitable for the present purpose. It was therefore decided to use the 2-(2-nitrophenyl)propyloxycarbonyl group (NPPOC) instead of NVOC to mask the aminooxy moieties. The NPPOC group has been used earlier for the protection of amines and alcohols for the preparation of peptides and DNA microarrays by in situ synthesis approach (20, 21). It is cleaved under illumination faster than the corresponding NVOC-protected compounds. More importantly, the photocleavage of the NPPOC group leads to an alkene that cannot react with the aminooxy moiety. Thus, NPPOC was thought suitable for the present investigation. 1. Synthesis of the Triethoxysilane Derivative 1. The triethoxysilane derivative 1 was prepared from commercially available 11-bromo-1-undecene in a few simple steps (Scheme 1). The aminooxy group was introduced first by using the dicarboximide derivative in basic conditions, followed by the cleavage of the protecting group with hydrazine. The free aminooxy functionality was protected next by using the photolabile NPPOC chloride derivative. Hydrosilylation was finally carried out using triethoxysilane in presence of Ka¨rstedt’s catalyst to obtain silane 1. The derivatives 1-4, prepared herein, were characterized by satisfactory 1H and 13C NMR and mass spectrometry data. 2. Oligonucleotide Surface Immobilization on Glass Slides. The glass slides were used as a model surface to carefully investigate and standardize the procedure involved in oligonucleotide immobilization before employing it for closed surfaces inside the capillary tubes. The crucial steps involved in the process and evaluated herein were the silanization of surfaces with 1, the photocleavage of the NPPOC to unmask the aminooxy functionalities, and the immobilization of the aldehyde-containing oligonucleotides and their hybridization with the complementary sequences. The glass slides were pretreated with sodium hydroxide before silanization. The silane 1 was then chemisorbed from a toluene/ NEt3 solution (97/3) onto the glass slides for overnight storage at room temperature. The silanization step was followed by a curing at 110 °C for 3 h to stabilize the silane layer. This silane coating was found to be stable at least for several months. The characterization of the modified surface was achieved using different techniques. The presence of carbamate function of NPPOC group was detected on the glass slide by multireflexion IR (MIR method). A strong signal for the carbonyl band of the carbamate at 1725 cm-1 was observed. Contact angle θ was measured for the modified glass slides using water, and the hydrophobic diiodomethane and θ values of 79° and 42° were found, respectively. On the other hand, the θ value of unmodified glass surfaces was found to be less than 10° using water.

These measurements thereby strongly reflect the large increase in the hydrophobicity of the surfaces modified with NPPOC. Last, the thickness of the modified silane layer was evaluated at 5-6 nm by ellipsometry study and the roughness of this silane’s layer on the surface was measured at about 4 nm by AFM method (see the Supporting Information). Following silanization, three crucial steps were performed next to demonstrate the efficiency of the present approach. This included the photocleavage of the protecting group, coupling reaction with oligonucleotide-5′-aldehyde and hybridization with the complementary fluorescent probe. The photocleavage reaction on the glass slide was carried out by irradiation at 365 nm through a mask containing holes with a diameter of 80 µm. The time of irradiation (2-20 s) and solvents (water, water/ pyridine, water/ammonia) were varied. It was found that presence of base is required for the photolysis to proceed, as the process in water alone was sluggish. The immobilization of the prefunctionalized oligonucleotides was achieved by dipping the glass slide in a 0.4 M ammonium acetate buffer solution (30 s-12 h) containing the oligonucleotide-5′-aldehyde (Seq1) at different concentrations (2-20 µM). The pH of the buffer was adjusted to 4.6 because slightly acidic conditions are known to be conductive for the formation of oxime bonds. As a matter of fact, the use of water alone resulted in lower immobilization efficiencies. Finally, the ability of the surfacebound oligonucleotide arrays to hybridize with the complementary sequence was investigated. The complementary sequences were labeled with Cy3. After hybridization and subsequent washings, the glass slides were scanned under a fluorescent scanner. The signal intensity obtained in this manner directly reflected the efficiency of the method. When the glass slides were irradiated through the mask, a pattern of fluorescent and nonfluorescent areas with the shape of the mask were revealed (Figure 1 shows a representative scanned image from the hybridization experiments). Of the several conditions tested, the best results were achieved using the following conditions: irradiation at 365 nm for 5 s in a 5% aqueous pyridine solution, deposition using a 20 µM solution of aldehydic oligonucleotide in 0.4 M ammonium acetate buffer for 2 min. These conditions mentioned herein represent the best compromise obtained between the times of irradiation and coupling and the quantity of oligonucleotide-5′-aldehyde to be used. The crucial issue of sensitivity was also evaluated. The concentration of the Cy3labeled complementary sequence was varied (0.1-100 nM) by using the conditions described earlier (Figure 1B). The sensitivity of detection was found to be reasonably high at 1 nM (with a ratio signal/noise S/N close to 6). 3. Oligonucleotide Surface Immobilization Inside the Capillary Tubes. The strategy developed herein was employed for the surface immobilization of oligonucleotides onto the inner wall of capillary tube. The surface immobilization of biomolecules inside the tube is more challenging, and this study has great significance because it may have potential utility in the

Bioconjugate Chem., Vol. 18, No. 3, 2007 675

Efficient Surface Patterning of Oligonucleotides

Figure 1. Scanned images of the oligonucleotide arrayed glass slides. The arraying was carrying out by irradiation through a mask (hole diameter: 80 µm) at 365 nm for 5 s in a 5% aqueous pyridine solution, followed by the deposition of a 20 µM solution of aldehydic oligonucleotide (Seq1) in 0.4 M ammonium acetate buffer for 2 min. Hybridization was carried out at 39 °C for 1 h using a solution of Cy3labeled complementary oligonucleotide sequence at different concentrations (0.1-100 nM). A. concentration of the complementary sequence is 100 nM. B. concentration of the complementary sequence is 1 nM. The fluorescence intensities are color-coded, varying from blue (low) to green, yellow, red, and then white (saturation); the gain of the detector was kept constant for comparison of the fluorescence intensity.

design of “labs on a chip”. Besides, the microfluidic capillary format offers a number of advantages over the planar format, including smaller sample volume and higher surface-to-volume ratio. The glass capillary tube was silanized with 1 by adapting the procedure described above. Trichloroethylene was used instead of toluene, as the latter caused the degradation of the fused-capillary. The photocleavage of NPPOC was carried out by irradiation at 365 nm for varying time periods on an inverted microscope equipped with a mercury lamp (100 W) and a 365 nm interference filter. The length of the irradiated zone was adjusted at 150 µm by a slit aperture. In this way, irradiation to liberate the surface-bound aminooxy group was performed only at the preselected portions of the tube. The surface immobilization was carried out by dipping the extremity of the capillary tube in a 0.4 M ammonium acetate buffer solution containing the oligonucleotide-5′-aldehyde (Seq1). The capillary tube containing the surface-immobilized oligonucleotides was then dipped in the hybridization solution containing the Cy3-labeled complementary sequence for Seq1. After several washings with SSC buffer to remove the unhybridized complementary sequences, the capillary tubes were scanned using a fluorescent scanner (Figure 2A). The results from hybridization experiments clearly showed the fluorescence spot localized at the irradiated portion of the capillary tube. The photodeprotection was found to be rapid, as an irradiation time of 2 s was sufficient to give measurable response. It was noted that prolonged irradiation times resulted in some enlargement of the zone compared to the size of the irradiated zone due to light scattering. Two control experiments were performed by using a quencher (acetone) of the aminooxy group liberated during the photodeprotection as well as by using for the immobilization step an oligonucleotide, which does not contain the complementary aldehyde reactive group for oxime bond formation. In these two cases, no significant signal was clearly observed at the irradiated position, thus demonstrating the specificity of the method. Thus, siteselective immobilization of DNA was accomplished even in the closed environment of a capillary tube. The efficiency and robustness of the process developed herein was next investigated by achieving sequential surface immobilization of three different oligonucleotide sequences inside the same capillary tube. A set of three different aldehydecontaining oligonucleotide sequences, Seq1, Seq2, and Seq3, respectively, were arrayed inside the same capillary tube by repeating the protocol described in the present work. Briefly, the capillary tube was silanized with 1. The silanized tube was

Figure 2. Scanned images of the oligonucleotides arrayed capillary tube. A. Irradiation at 365 nm for various time periods in a 5% aqueous pyridine solution, deposition of a 20 µM solution of aldehydic oligonucleotide (Seq1) in 0.4 M ammonium acetate buffer for 2 min and hybridization with the complementary strand labeled with Cy3. B. Multiple deposition of the three oligonucleotides Seq1, Seq2, and Seq3 and hybridization with the mixture of corresponding complementary sequences labeled with Fluorescein, Cy5, and Texas Red, respectively. The fluorescence is color-coded: blue for fluorescein, yellow for Cy5, and red for Texas Red.

irradiated at certain preselected positions, and this was followed by the surface immobilization of the Seq1 oligonucleotide sequence. After subsequent washing to remove free oligonucleotides, the process was repeated at certain other preselected positions of the same capillary tube to carry out surface immobilization of oligonucleotide sequences Seq2 and Seq3, respectively. Thus, the surface immobilization of three different oligonucleotides was accomplished inside the same capillary tube. Then a mixture of the three oligonucleotide sequences complementary to Seq1, Seq2, and Seq3 was run through the arrayed capillary tube. The three sequences complementary to Seq1, Seq2, and Seq3 were labeled with Fluorescein, Cy5, and Texas Red, respectively. The complementary sequences labeled with different fluorescent probes were used to facilitate the simultaneous detection of three hybridization events inside the same capillary tube. The tube was next scanned at different wavelengths corresponding to the three labels on the complementary strand (Figure 2B). The results showed that the complementary labeled sequences were able to hybridize with their targets, as evident from the probe-specific fluorescence emission at predetermined immobilization sites inside the capillary tube (Figure 2B, also see the Supporting Information). These hybridization experiments thus unambiguously demonstrated the selective surface immobilization of different oligonucleotides Seq1, Seq2, and Seq3 at the predefined position inside the tube. No side reactions were observed during the repetitive flow of aldehyde-containing oligonucleotide through the capillary tube.

CONCLUSION Thus, an efficient protocol for surface patterning of oligonucleotides was developed. The efficiency of the present method was demonstrated by carrying out the surface immobilization of oligonucleotides on surfaces of glass slides and inside the capillary tubes. The robustness of the process was further demonstrated by achieving the surface immobilization of up to three different oligonucleotide sequences at predetermined positions inside the same capillary tube. The present method reported herein is simple and convenient. It involves the preparation of surfaces grafted with aminooxy moieties masked with a photocleavable protecting group. A short irradiation at

676 Bioconjugate Chem., Vol. 18, No. 3, 2007

365 nm cleaves the photocleavable protecting group thereby unmasking the aminooxy functions at preselected positions on the surface. Deposition of aldehyde-containing oligonucleotides on surfaces results in the formation of oxime bonds between aldehyde functionality of the oligonucleotide and the surfacebound aminooxy moieties, thereby leading to an efficient surface immobilization of oligonucleotides. Since the oxime ligation has been used for the preparation of oligonucleotide, peptide, and carbohydrate bioconjugates, it should be possible to extend the present strategy to the preparation of carbohydrate and peptide arrays. Finally, the immobilization protocol reported herein could also be explored as an efficient and alternative approach to design “lab on a chip” devices.

ACKNOWLEDGMENT This work was supported by the “Centre National de la Recherche Scientifique” (CNRS) and the “Commissariat a` l’Energie Atomique” (CEA). We are grateful to NanoBio program for the facilities of the Synthesis and Surface Characterization platforms. We thank Dr. Y. Singh for careful reading of this manuscript and Prof. P. Labbe´ for help with the surface characterization. Supporting Information Available: Experimental details. This material is available free of charge via the Internet at http:// pubs.acs.org.

LITERATURE CITED (1) Ismagilov, R. F. (2003) Integrated microfluidic systems. Angew. Chem., Int. Ed. 42, 4130-4132. (2) Kumar, A., Goel, G., Fehrenbach, E., Puniya, A. K., and Singh, K. (2005) Microarrays: the technology, analysis and application. Eng. Life Sci. 5, 215-222. (3) Fodor, S. P. A., Read, J. L., Pirrung, M. C., Stryer, L., Lu, A. T., and Solas, D. (1991) Light-directed, spatially addressable parallel chemical synthesis. Science 251, 767-773. (4) Thibault, C., Le, Berre, V., Casimirius, S., Tre´visiol, E., Franc¸ ois, J., and Vieu, C. (2005) Direct microcontact printing of oligonucleotides for biochip applications. J. Nanobiotechnol. 3, 1-12. (5) Brun, M. A., Disney, M. D., and. Seeberger, P. H. (2006) Miniaturization of microwave-assisted carbohydrate functionalization to create oligosaccharide microarrays. ChemBioChem 7, 421-424. (6) Sun, X.-L., Stabler, C. L., Cazalis, C. S., and Chaikof, E. L. (2006) Carbohydrate and protein immobilization onto solid surfaces by sequential diels-alder and azide-alkyne cycloadditions. Bioconjugate Chem. 17, 52-57.

Dendane et al. (7) Duckworth, B. P., Xu, J., Taton, T. A., Guo, A., and Mark D. Distefano, M. D. (2006) Site-specific, covalent attachment of proteins to a solid surface. Bioconjugate Chem. 17, 967-974. (8) Olivier, C., Hot, D., Huot, L., Ollivier, N., El-Mahdi, O., Gouyette, C., Huynh-Dinh, T., Gras-Masse, H., Lemoine, Y., and Melnyk, O. (2003) R-Oxo semicarbazone peptide or oligodeoxynucleotide microarrays. Bioconjugate Chem. 14, 430-439. (9) Lee, M.-R., and Shin, I. (2005) Facile preparation of carbohydrate microarrays by site-specific, covalent immobilization of unmodified carbohydrates on hydrazide-coated glass slides. Org. Lett. 7, 42694272. (10) Ligler, F. S., Breimer, M., Golden, J. P., Nivens, D. A., Dodson, J. P., Green, T. M., Haders, D. P., and Sadik, O. A. (2002) Integrating waveguide biosensor. Anal. Chem. 74, 713-719. (11) Balakirev, M. Y., Porte, S., Vernaz-Gris, M., Berger, M., Arie´, J.-P., Fouque´, B., and Chatelain, F. (2005) Photochemical patterning of biological molecules inside a glass capillary. Anal. Chem. 77, 5474-5479. (12) Forget, D., Boturyn, D., Defrancq, E., Lhomme, J., and Dumy, P. (2001) Highly efficient synthesis of peptide-oligonucleotide conjugates: chemoselective oxime and thiazolidine formation. Chem. Eur. J. 7, 3976-3984. (13) Katajisto, J., Virta, P., and Lo¨nnberg, H. (2004) Solid-phase synthesis of multiantennary oligonucleotide glycoconjugates utilizing on-support oximation. Bioconjugate Chem. 15, 890-896. (14) Zatsepin, T. S., Stetsenko, D. A., Gait, M. J., and Oretskaya, T. S. (2005) Use of carbonyl group addition-elimination reactions for synthesis of nucleic acid conjugates. Bioconjugate Chem. 16, 471489. (15) Rose, K. (1994) Facile synthesis of homogeneous artificial protein. J. Am. Chem. Soc. 116, 30-33. (16) Hang, H. C., and Bertozzi, C. R. (2001) Chemoselective approaches to glycoprotein assembly. Acc. Chem. Res. 34, 727-736. (17) Boncheva, M., Scheibler, L., Lincoln, P., Vogel, H., and Akerman, B. (1999) Design of oligonucleotide arrays at interfaces. Langmuir 15, 4317-4320. (18) Defrancq, E., Hoang, A., Vinet, F., and Dumy, P. (2003) Oxime bond formation for the covalent attachment of oligonucleotides on glass support. Bioorg. Med. Chem. Lett. 13, 2683-2686. (19) Tully, S. E., Rawat, M., and Hsieh-Wilson, L. C. (2006) Discovery of a TNFR antagonist using chondroitin sulfate microarrays. J. Am. Chem. Soc. 128, 7740-7741. (20) Bhushan, K. R. (2006) Light-directed maskless synthesis of peptide arrays using photolabile amino acid monomers. Org. Biomol. Chem. 4, 1857-1859. (21) Beier, M., and Hoheisel, J. D. (2000) Production by quantitative photolithographic synthesis of individually quality checked DNA microarrays. Nucleic Acids Res. 28, e11. BC060254V