Electrophoretic Deposition of Bioadaptive Drug Delivery Coatings on

Subscriber access provided by WEBSTER UNIV

Applications of Polymer, Composite, and Coating Materials

Electrophoretic deposition of bio-adaptive drug delivery coatings on magnesium alloy for bone repair Hongfei Qi, Svenja Heise, Juncen Zhou, Katharina Schuhladen, Yuyun Yang, Ning Cui, Rongxin Dong, Sannakaisa Virtanen, Qiang Chen, Aldo R. Boccaccini, and Tingli Lu ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b01227 • Publication Date (Web): 04 Feb 2019 Downloaded from http://pubs.acs.org on February 4, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Electrophoretic deposition of bio-adaptive drug delivery coatings on magnesium alloy for bone repair Hongfei Qi1, Svenja Heise2, Juncen Zhou3, Katharina Schuhladen2, Yuyun Yang4, Ning Cui1, Rongxin Dong1, Sannakaisa Virtanen3, Qiang Chen5*, Aldo R. Boccaccini2*, Tingli Lu1*

1Key

Laboratory for Space Bioscience and Biotechnology, School of Life Sciences, Northwestern Polytechnical University, 127 West Youyi Road, 710072 Xi'an, China

2Institute

of Biomaterials, Department of Materials Science and Engineering, University of Erlangen-Nuremberg, Cauerstraße 6, 91058 Erlangen, Germany

3Chair

for Surface Science and Corrosion, Department of Materials Science and Engineering,

University of Erlangen-Nuremberg, Martensstraße 5-7, 91058 Erlangen, Germany

4Institute

of Surface/Interface Science and Technology, Department of Material Science and

Chemical Engineering, Harbin Engineering University, 145 Nantong Street, 150001 Harbin, China

5State

Key Laboratory of Solidification Processing, School of Materials Science and Engineering, Northwestern Polytechnical University, 127 West Youyi Road, 710072 Xi'an, China

1

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract

Biodegradable polymer coatings on magnesium alloys are attractive, as they can provide corrosion resistance as well as additional functions for biomedical applications, e.g. drug delivery. A gelatin nanospheres/chitosan (GNs/CTS) composite coating on WE43 substrate was fabricated by electrophoretic deposition (EPD) with simvastatin (SIM) loaded into the GNs. Apart from a sustained drug release over 28 days, the anti-corrosion behavior of the coated WE43 substrates was investigated by electrochemical tests. Both the degradation and corrosion rates of the coated substrate were significantly minimized in contrast with bare WE43. The cytocompatibility of the coated samples was analyzed in both quantitative and qualitative ways. Additionally, the osteogenic differentiation of MC3T3-E1 cells on SIM-containing coatings was assessed by the measuring the expression of osteogenic genes and related proteins, alkaline phosphatase (ALP) activity, and extracellular matrix mineralization, showing that the SIM-loaded composite coating could up-regulate the expression of osteogenic genes and related proteins, promote ALP activity and enhance extracellular matrix mineralization. In summary, the SIM-loaded GNs/CTS composite coatings were able to enhance the corrosion resistance of the WE43 and to promote osteogenic activity, thus demonstrating a promising coating system for modifying the surface of magnesium alloys targeted for orthopedic applications.

Key words: Magnesium alloy, gelatin nanospheres, electrophoretic deposition, drug delivery coating, simvastatin, osteogenic differentiation

2


Page 2 of 40

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction Metallic materials, including stainless steels, titanium, Co-based and titanium alloys, have been used during many years in orthopedic surgery.1 A limitation of these materials is their elastic modulus, which does not match well with the modulus of natural bone, thus leading to stress shielding.2-3 Moreover, the lack of osteoconductivity of metallic materials is not beneficial for bone healing.4 In contrast to the above metallic materials, magnesium (Mg) and Mg alloys are gaining increasing research interest, both as bone regeneration implants and fixation devices, owing to their attractive merits, including biodegradability, an elastic modulus closer to that of natural bone when compared to other metals, as well as their suitable mechanical properties.1-3,5-7 Since magnesium is an important element in human tissues, Mg ions released from the degradation of Mg alloys are not considered to be harmful.2,8 However, the main problem regarding the application of Mg alloys in the biomedical area is the excessive corrosion and the accompanied fast hydrogen evolution rate.8 A too fast degradation of Mg can lead to an accumulation of large amounts of hydrogen as subcutaneous gas cavities,6-7 and also to a reduction of mechanical integrity before the healing of bone.2,7 Hence, relatively slower corrosion rates are required for Mg alloys to become promising biomaterials.5 The corrosion resistance can be ameliorated by deposition of bio-adaptive coatings on Mg alloys, which can act as barriers or protection layers against corrosion.2-4,8-9 Surface modifications of implanted materials play an essential role in bone healing, as well as the incorporation of osteogenic drugs that can improve the efficiency of bone regeneration. Surface modification by bioactive coatings is a convenient approach to protect Mg alloys against corrosion and to enhance bio-adaptability conjointly.8

3



A suitable method for the fabrication of bio-adaptive coatings is electrophoretic deposition (EPD), which has been used in our previous work.10-11 Advantages of EPD include the rapid, convenient progress, mild conditions, and the ability to obtain homogeneous coatings by tuning the parameters.10,12 We used chitosan and gelatin to fabricate a composite coating, with both components being nontoxic, biocompatible and biodegradable, whereby also the degradation products do not cause toxicity.7,13 Chitosan (CTS), a cationic natural polymer, is positively charged in acidic electrophoretic solution, thus will migrate towards the cathode and deposit. Furthermore, gelatin type B nanospheres are positively charged in acidic electrophoretic solution, and hence they can migrate together with chitosan molecules toward the cathode for deposition. Gelatin nanospheres can be used as carriers for numerous types of biologically active molecules, like growth factors, antibiotics, and other therapeutic drugs.11,14 They exhibit high encapsulation efficiency and exceptional drug loading capability, and they can provide a sustained release for a long period, as demonstrated in our previous study.11 Simvastatin (SIM) is a lipid-lowering medication in clinics.15-16 SIM has been used to explore its effects on osteogenesis in recent years by some researchers.13,17 It has been reported that SIM could promote formation of new bone.18 SIM has also been proved to promote the differentiation of osteoblasts and mineralization of MC3T3-E1 extracellular matrix.19 However, the systemic usage of statins can lead to serious side effects.15,20 Local delivery can avoid these and also protect the drug against degradation before arriving at the injured sites.16 The purpose of this research was to fabricate a bio-adaptive coating system by EPD technique on WE43 Mg alloy with the aim to decelerate the corrosion process of the metal and to promote osteogenic differentiation at the same time. To this end, after loading SIM into the gelatin 4


Page 4 of 40

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nanospheres, they were mixed with the chitosan solution for EPD coatings. The microstructure and hydrophilicity of the composite coatings were investigated by scanning electron microscopy (SEM) and contact angle measurements. The release kinetics of SIM from the coatings was studied in vitro. In addition, the coating influence on the corrosion process was analyzed with electrochemical impedance spectroscopy (EIS) and electrochemical polarization curves, and the degradation of samples was studied by immersion in PBS for 28 d. MC3T3-E1 cell attachment on the coatings was observed by SEM. The potential osteogenic effects of SIM release from composite coatings were investigated by osteogenic gene expression and related markers, such as alkaline phosphatase (ALP) activity and mineralization, considering the potential applications of the coatings on metallic implant surfaces promoting osteogenic differentiation.

2. Materials and Methods 2.1 Materials Magnesium alloy substrates (φ14 mm× 2-4 mm) were cut from WE43 alloy rods (Zhongtian Metal Materials Co., Ltd., Dongguan, China). Gelatin B (225 Bloom) and chitosan (≥75% deacetylated) were commercially available (Sigma-Aldrich, St Louis, USA). Simvastatin was bought from Shanghai Yuanye Biological Technology CO., Ltd (Shanghai, China). Glutaraldehyde (GA, 25 wt% solution in water) was obtained from Acros Organics. Glacial acetic acid, ethanol absolute, as well as other analytical reagents, were purchased from Sinopharm Chemical Reagent Co., Ltd (ShangHai, China). Alpha modified Minimum Essential Medium (α-MEM), Dulbecco’s Modified Eagle’s Medium (DMEM) and trypsin were purchased from HyClone. Fetal bovine serum (FBS) was purchased 5



from Gibco. Phosphate buffer solution (PBS), β-sodium glycerophosphate, L-ascorbic acid, dimethyl sulfoxide (DMSO), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT), and cetylpyridinium chloride were obtained from Beijing Solarbio Science & Technology Co., Ltd (Beijing, China). Primers for the housekeeping gene, GAPDH, and RUNX-2, COL-1, OCN were synthesized from Wuhan Servicebio Technology Co., Ltd (Wuhan, China). Antibiotics (penicillin/streptomycin) were purchased from TRANSGEN BIOTECH. Alizarin red S (ARS) was obtained from Tianjin Kemiou Chemical Reagent Co., Ltd (Tianjin, China). 2.2 Sample preparation 2.2.1 Preparation of GNs, SIM-loaded GNs GNs were fabricated by a two-step desolvation technique, which has been described previously.11 SIM was incorporated into lyophilized GNs by a diffusional method.21 In brief, a high concentration (10 mg/mL) of SIM was dropped on the lyophilized GNs and incubated at 4 °C overnight for complete swelling. 2.2.2 Preparation of Mg alloy samples The surfaces of the Mg alloy substrates were prepared by grinding using SiC paper up to 1200 grit and by polishing with 1 μm diamond abrasive paste (Buehler GmbH, Germany). After rinsing with ethanol in an ultrasonic bath and blow-drying,22-23 the ground samples were immersed in DMEM and stirred during 24 h at ambient temperature for pretreatment.24-25 2.3 Preparation and characterization of EPD coating The solution for EPD was prepared according to the following steps: the composition of CTS solution was chitosan (1 mg/mL), 1 vol% acetic acid, 79 vol% ethanol and 20 vol% water.22 4

6


Page 6 of 40

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mg/mL GNs or SIM-loaded GNs were dispersed homogeneously in CTS solution by magnetic stirring and sonication. The DMEM-pretreated Mg alloy samples were used as the cathode for deposition. Two stainless steel (316 L) plates (0.5 mm in thickness, Baoji Titanium Industry Co., Ltd, Shaanxi, China) were used as anode or counter electrode, with 10 mm distance from each side of the sample. EPD was performed by connecting the three electrodes to a constant current of 10 mA for a few seconds (50 ~ 90 s). After the deposition process, the samples were air-dried overnight. The surfaces of untreated and DMEM-pretreated Mg alloy substrates, the surfaces and cross-sections of coatings were characterized by SEM (Super 55, Zeiss, Germany; NovaTM Nano SEM450, FEI, America) after sputtering with Au (ETD-2000, Elaborate Technology Development Ltd., Beijing, China). The samples hydrophilicity was determined using a contact angle instrument (JCY-1, FANGRUI, China). Five drops of 2 μL deionized water were dropped on the surface. The contact angle was analyzed according to the droplet pictures after attaining equilibrium.23 SIM was detected using Fourier Transform Infrared Spectroscopy (FTIR, TENSOR II, BRUKER, Germany). The SIM or the coatings mixed with KBr at a weight ratio of 1:200 were ground and compacted to for tablets for FTIR measurements. 2.4 Drug loading capacity, efficiency and in vitro release of SIM The drug loading capacity and efficiency of GNs and coatings were measured through the EPD solution before and after the EPD process. The prepared EPD solution was treated by centrifugation at 10, 000 RCF (reactive centrifugal force) for 10 min, and unloaded SIM was detected in the supernatant. After EPD, the solution was centrifuged again, and the SIM unloaded

7



into the coating remained in the supernatant. The loading capacity and efficiency of the drug were determined as follows: drug in GNs (μg) mass of GNs in EPD solution (mg) drug in GNs (μg) Drug loading efficiency of GNs (%) = × 100% drug fed initially (μg)

Drug loading capacity of GNs (μg/mg) =

Drug loading capacity of coating(μg/mg) weight of coating (mg) × 80% ÷ mass of GNs in EPD solution (mg) × drug in GNs (μg) = weight of coating (mg) The Mg alloy samples with SIM-loaded coatings were put into 24-well plates. 2 mL PBS (pH 7.4) was added into each well, then the well plate was sealed by parafilm and incubated at 37 °C on a rotating plate. 2 mL of the PBS was collected at 4, 8 h, 1, 3, 5, 7, 10, 14, 17, 21, 24, 28 d and 2 mL of fresh PBS was added. The medium released was detected using an ultraviolet spectrophotometer (F-2300, HITACHI, Japan).15,17 2.5 Electrochemistry tests and in vitro degradation The electrochemical experiments were performed using an electrochemical workstation (IM6eX, Zahner-Elektrik GmbH & Co. KG, Kronach) with a 3-electrode system including a Pt plate as counter electrode, an Ag/AgCl electrode with 3 M KCl as the reference electrode, and the samples, including bare WE43, DMEM-pretreated and GNs/CTS coated Mg alloy, as the working electrode. The electrolyte used in electrochemical tests was the DMEM medium. Before starting, substrates were immersed in DMEM medium for 1 h to stabilize the open circuit potential (OCP). EIS tests were carried out in a frequency interval from 100 kHz to 10 mHz at OCP values, with AC amplitude of 10 mV. Subsequently, potentiodynamic polarization tests were performed with a scan rate of 2 mV/s from −300 mV relative to OCP up to -1.0 V. The polarization curves were evaluated by means of Tafel plots.

8


Page 8 of 40

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For the in vitro degradation tests, samples were incubated in PBS for 28 days at 37 °C, in 5% CO2. The variations in Mg2+ concentration and PBS pH were measured by atomic absorption spectrometer (ZEEnit 700 P, Analytik Jena AG, Germany) and a pH meter (PB-10, Sartorius), respectively.26 2.6 Cell culture and seeding Mouse pre-osteoblast cells (MC3T3-E1) (passage to 19) were used for cell experiments. The normal culture medium was α-MEM containing 10% FBS, 100 μg/mL of streptomycin and 100 Units/mL of penicillin.27 To induce osteogenic differentiation, 10 mM β-sodium glycerophosphate and 50 μg/mL ascorbic acid were added to normal cell culture medium, naming osteogenic induction medium. The medium was changed every second day.28 Except for the blank and pure SIM group, four different sample types were analyzed: the bare, DMEM-pretreated, GNs/CTS coated, and SIM-loaded GNs/CTS coated Mg alloys. All samples were transferred into 24-well plates and disinfected with 75% ethanol. The cells were seeded at a density of 1×104 cells/well. To evaluate osteogenic genes expression and related proteins, cells were cultured with substrates in 6-well plates, and the cell density was 2×105 cells/well. 2.7 Cell viability and morphology Cell viability was quantitatively analyzed using the MTT assay. Since Mg-based alloys could have an influence on tetrazolium-salt-based assays,29 additionally to the four mentioned sample groups, another four groups without cells were also tested as sample blanks. Except for the four sample groups, the blank control group was cell seeded in the well-plate without any sample. After culturing in normal culture medium for 2 and 4 d, the medium was removed. Serum free medium containing 10% MTT (5 mg/mL) was added and incubated at 37 °C in the dark for 4 h. 9



After removing the MTT medium, the formed formazan was dissolved by DMSO. The absorbance was measured at 490 nm using a Multi-Mode Microplate Reader (Synergy HT, Bio-Tek, Winooski, VT, USA). Cell viability of four kinds of samples was displayed by optical density (OD) values of samples deducted by that of the sample blanks. For the analysis of cell adhesion on the samples after culturing for 2 and 4 d, samples were rinsed with PBS, and the cells were fixed with 2.5 % glutaraldehyde solution at 4 °C for 1 h. Then the substrates were dehydrated successively in a gradient concentration of ethanol solutions (30%, 50%, 70%, 80%, 90%, 95%, 100%).12,30 The cell morphology was assessed by SEM after sputtering with gold. 2.8 Expression of osteogenic genes and related proteins Osteogenic expression of relevant genes (RUNX2, COL-1, and OCN) was evaluated by quantitative real-time PCR. After incubating the samples with MC3T3-E1 cells in osteogenic induction medium for 7 and 14 days, the total RNA was extracted using RNAiso Plus (9108, TaKaRa, Japan). After extraction, a PrimeScriptTM RT MasterMix (RR036A, TaKaRa, Japan) was used for the reverse transcription from RNA to complementary DNA (cDNA). The cDNA was amplified by the real-time PCR system (CFX 96 Touch, Bio-rad, USA) with primers listed in Table 1. Fluorescence detection was carried out during the last step of amplification, following by the melting period. Ct values were normalized with that of the internal gene GAPDH, and the expression values were evaluated using the 2-ΔΔCt method.12,28 Table 1. Primers used in real-time PCR. Gene

Forward primer sequence (5′-3′)

Reverse primer sequence (5′-3′)

GAPDH

TGCACCACCAACTGCTTAG

GGATGCAGGGATGATGTTC 10


Page 10 of 40

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RUNX2

TGCACCTACCAGCCTCACCATAC

GACAGCGACTTCATTCGACTTCC

COL-1

GAAGGCAACAGTCGATTCACC

GACTGTCTTGCCCCAAGTTCC

OCN

AGGACCATCTTTCTGCTCACT

GCGTTTGTAGGCGGTCTTCA

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RUNX2, runt-related transcription factor 2; COL-1, collagen type 1; OCN, osteocalcin. The expression of COL-1 and OCN (osteogenic related proteins) was evaluated by western blot assay. Briefly, MC3T3-E1 cells were incubated in 6-well plates with 6 groups: blank, Mg alloy, DMEM-pretreated, GNs/CTS coating, SIM-loaded coating, and the pure SIM. After cultivation for 14 d, the cells were rinsed by PBS and lysed by RIPA supplemented with Phosphorylated protease inhibitor. For detection of COL-1 and OCN, an equal volume of protein from every sample was subjected to 10% SDS-PAGE and transferred to Poly (vinylidene fluoride) membranes (PVDF, Millipore, USA).15 After incubation with 5% nonfat milk, 0.05% Tween-20 in TBS (TBST) for 1 h, the membranes were incubated with appropriate primary antibody against COL-1 (1:1000, mouse; Proteintech, China), OCN (1:1000, rabbit; ABclonal, China) and Actin (1:1000, mouse; Servicebio, China) at 4 °C overnight.28 The membranes were rinsed by TBST and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000, goat anti-mouse, Servicebio, China) at ambient temperature for 30 min. Then the membranes were visualized using the ECL kit (Servicebio, China) and exposed (AX-II, Yuehua, China). The intensities of protein bands were analyzed by Quantity One software, and the Actin used as internal control. 2.9 ALP activity

11



ALP is an early marker during osteogenic differentiation.31 After incubation in osteogenic induction medium for 7 and 14 days, the medium was removed. MC3T3-E1 cells were rinsed by PBS for three times. The cells were then lysed with 0.1% Triton X-100 at 4 °C for 1 h. The lysate was centrifuged at 4 °C (12000 RCF, 10 min), and the supernatant was detected by an ALP kit (Beyotime, China).32 For qualitative analysis, the cells were firstly fixed with 4% paraformaldehyde at 4 °C for 1 h and they were then washed by PBS for two times. The cells on the samples were then stained with BCIP/NBT Alkaline Phosphatase Color Development Kit (Beyotime, China) at room temperature for 24 h, and rinsed with PBS two times.15 The results were imaged employing a digital camera (Canon, EOS550D, Japan). 2.10 Extracellular matrix (ECM) mineralization The extracellular matrix mineralization was evaluated by ARS staining. After 18 days' cultivation in osteogenic induction medium, the samples were washed thrice with PBS. The cells were fixed with 4% paraformaldehyde and stained with 0.15% ARS at 37 °C for 1 h. After washing with PBS thoroughly, the mineralized nodules on the samples were photographed. The Ca and P elements mapping was obtained by energy dispersive spectroscopy (EDS, Oxford). For quantification, cetylpyridinium chloride was included to dissolve the mineralized nodules. Then the extract was transferred to a 96-well plate, and the OD value was recorded at 570 nm .11 2.11 Statistical analysis The data is represented as mean ± standard deviation (SD). Statistical analysis was performed by one-way analysis of variance (ANOVA) or two-way ANOVA followed by Bonferroni post hoc tests. The criteria for statistical significance were set at p < 0.05. 12


Page 12 of 40

Page 13 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. Results and discussion 3.1 Characterization of EPD coating In this study, surface morphologies of the bare, the DMEM-pretreated, the GNs/CTS coated and SIM-loaded coating coated Mg alloys were first observed using SEM. Figure 1a shows the surface of the Mg alloy substrate after polishing. In order to allow the deposition of a coating, the Mg alloy was immersed in DMEM for pretreatment before the EPD process.22 Figure 1b shows the DMEM-pretreated Mg alloy surface, which exhibited cracks. Figure 1c and d shows the surface of the DMEM-pretreated substrates after coating. The coatings were crack-free, and the GNs were visible in the surface of the two coatings. From Figure 1c and 1d, the diameter of GNs and SIM-loaded GNs were determined to be: 221.3 ± 35.42 nm and 224.9 ± 39.15 nm, respectively. Figure 1e to 1h shows the cross-sections of GNs/CTS coating (Figure 1e, f) and SIM-loaded coating (Figure 1g, h) at different magnifications. From Figure 1e and 1g, the thickness of GNs/CTS coating and SIM-loaded coating were 49.2 ± 8.99 μm and 46.1 ± 5.44 μm, respectively. GNs were dispersed inside the coating as observed in Figure 1f and 1h.

13



Figure 1. SEM micrographs showing the surface of bare WE43 substrate (a), DMEM-pretreated WE43 substrate (b), GNs/CTS coating (c) and SIM-loaded coating (d), the cross-section of GNs/CTS coating (e, f) and SIM-loaded coating (g, h) at different magnifications.

For cell adhesion and growth, a contact angle range from 35° to 80° is suitable. Whatever the cell types, the optimum is around 55°.33 Representative photographs of contact angle measurements on different samples could be seen in Figure 2a, and the comparison was shown in Figure 2b. The contact angle of the bare Mg alloy substrate was about 90°, while that of the DMEM-pretreated Mg alloy was about 27°, which were both out of the desired range. Both the composite coatings with or without SIM exhibited a contact angle nearing the optimum 55°.34 The DMEM-pretreatment significantly decreased the contact angle of the bare Mg alloy, showing hydrophilic behavior.22 However, both coatings increased the contact angle again. Although it is well known that chitosan is hydrophilic as it contains numerous amino and hydroxyl groups, the contact angle of chitosan-coated surfaces has been reported to be 76.4 ± 5.1°.35 Thus, the increase in contact angle after coating could be owing to the existence of chitosan. The GNs/CTS coatings became more hydrophilic than the chitosan coating, which could be attributed to the hydrophilicity of water-swollen GNs.10 FTIR was performed to prove the existence of SIM in the SIM-loaded coating. Figure 2c shows the FTIR spectra of the GNs/CTS coating, SIM-loaded coating and pure SIM. The peak at 865 cm-1 for C-H vibration present in SIM was also present in the spectrum of the SIM-loaded coating, while this peak was not present in the spectrum of the GNs/CTS coating. The drug loading capacity and efficiency of GNs and the coating were calculated through the equations given in Section 2.4. The drug loading capacity and efficiency of GNs loaded with SIM 14


Page 14 of 40

Page 15 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were 24.54 ± 0.17 μg/mg and 78.5 ± 1.68 %, respectively. The drug loading capacity of the coating was 20.45 ± 1.39 μg/mg. It was expected that GNs loaded with SIM could release the drug in a sustained manner for a long time. The long-term SIM released from SIM-loaded coating is shown in Figure 2d. A burst release could be observed during the first day, while the sustained release lasted at least 28 days. The total released amount of SIM from the coatings was approximately 95 μg. The results indicated that the GNs might be promising carriers for high loading and controlled release.

Figure 2. Representative photographs of water contact angle of the bare Mg alloy (a1), the DMEM-pretreated Mg alloy (a2), GNs/CTS coating (a3) and SIM-loaded coating (a4). Statistical graph of the contact angles (b), *** p

Electrophoretic Deposition of Bioadaptive Drug Delivery Coatings on

Recommend Documents