Energy-Transfer Cassette Labeling for Capillary ... - ACS Publications

Energy-transfer (ET) dye-labeled primers significantly improve fluorescent DNA detection because they permit excitation at a single common wavelength ...
0 downloads 0 Views 328KB Size
Download PDF
Bioconjugate Chem. 2001, 12, 493−500

493

Energy-Transfer Cassette Labeling for Capillary Array Electrophoresis Short Tandem Repeat DNA Fragment Sizing Lorenzo Berti,† Igor L. Medintz,† Jennifer Tom, and Richard A. Mathies* Department of Chemistry, University of California, Berkeley, California 94720. Received December 8, 2000

Energy-transfer (ET) dye-labeled primers significantly improve fluorescent DNA detection because they permit excitation at a single common wavelength and they produce well separated and intense acceptor dye emission. Recently, a new ET cassette technology was developed [Berti, L. et al. (2001) Anal. Biochem. 292, 188-197] that can be used to label any PCR, sequencing, or other primer of interest. In this report we examine the utility of this ET cassette technology by labeling seven different short tandem repeat (STR) specific primers with each of the four ET cassettes and analyzing the PCR products generated on a MegaBACE-1000 capillary array electrophoresis system. More than 60 amplicons were generated and successfully analyzed with the ET cassette-labeled primers. Both forward and reverse primers were labeled for multiplex PCR amplification and analysis. Single base pair resolution was achieved with all four ET cassettes. This ET cassette-primer labeling procedure is ideally suited for creating four-color fluorescent ET primers for STR and other DNA assays where large numbers of different loci are analyzed including sequencing, genetic identification, gene mapping, loss of heterozygosity testing, and linkage analysis.

INTRODUCTION

Microsatellite DNA or short tandem repeat (STR) sequences have proven invaluable in many aspects of genomic analysis. The power of these microsatellite loci is derived from their high degree of polymorphism and genome-wide distribution (Edwards et al., 1991). There are more than 5200 mapped microsatellite loci available for human genomic studies (Dib et al., 1996). Microsatellite loci are important for gene discovery and genome mapping, genome wide searches for disease markers and susceptibility genes, parentage testing and forensic identification, clinical diagnosis, evolutionary studies, loss of heterozygosity testing associated with cancer diagnosis, and linkage analysis (March, 1999; Reed et al., 1994; Cornelis et al., 1998; Ober et al., 1998; Davies et al., 1994; Edwards et al., 1991; Wiegand et al., 2000; Chakraborty et al., 1999; Caskey et al., 1992; Medintz et al., 2000a). The intrinsic nature of short tandem repeat DNA sequences dictates that their analysis is heavily reliant on electrophoretic sizing separations. STR analysis usually consists of a locus-specific PCR amplification followed by electrophoretic separation of the products (Mansfield et al., 1996; Cornelis et al., 1998; Medintz et al., 2000a). In order for STR-based genetic assays to be highly informative, large numbers of microsatellite loci have to be screened in thousands of individuals (Cornelis et al., 1998; Ober et al., 1998; Davies et al., 1994; March, 1999), and each study will require multicolor fluorescently labeled locus-specific primers. A steady progression of improved slab gel and capillary array electrophoresis (CAE) instruments have been developed that can increase the amount of information gathered from these loci (Kheterpal and Mathies, 1999; Meldrum 2000) including the MegaBACE-1000 CAE system and the ABI 3700 (Fox, * Corresponding author: 307 Lewis Hall, Department of Chemistry, University of California, Berkeley, CA 94720, phone: (510)-642-4192, fax: (510)-642-3599, e-mail: rich@ zinc.cchem.berkeley.edu. † Equal contributors.

1999; Meldrum, 2000). Analyses on these instruments have relied, at least in part, on energy-transfer (ET) dyelabeling technology. In comparison to single dye-labeled primers, ET labeling offers the advantages of excitation at a single common wavelength with distinctive and intense acceptor dye emission and matched electrophoretic mobilities of the labeled targets (Hung et al., 1997; Ju et al., 1995; 1996a). ET labeling is particularly well suited to multicolor fluorescence assays such as STR analysis requiring coanalysis of analyte and standard (Mansfield et al., 1998). Our original ET primer constructs introduced the donor and acceptor dyes onto a modified primer, or spacer, after automated oligonucleotide synthesis, resulting in a lengthy synthetic procedure (Ju et al., 1995; Ju et al., 1996a). An ET cassette synthetic scheme allowing the attachment of an ET label to any primer has been developed (Ju et al., 1996b). However, this early procedure required synthesis of the cassette on the 5′ end of the primer during automated synthesis and postsynthetic dye conjugation. A convenient and simple synthetic method for ET labeling any primer of interest would be valuable. Recently, an approach was developed (Berti et al., 2001) for easily tagging any primer sequence or other target of interest with a reactive fluorescent ET cassette label. A schematic representation of such an ET cassettelabeled primer is presented in Figure 1A. In our construct, the ET cassette-labeled primer consists of three parts: the ET cassette itself, the primer, and the disulfide linker joining the two. The chemical structure of the reactive ET cassette is presented in Figure 1B. The cassette consists of a sugar-phosphate spacer with a 6-FAM (6-carboxyfluorescein) donor at the 3′-end, an acceptor dye linked to a modified T-base at the 5′-end of the spacer, and a mixed disulfide group for coupling to the 5′-end of a thiol-modified primer. The coupling reaction is a two-step process (see Figure 1C) consisting

10.1021/bc000155w CCC: $20.00 © 2001 American Chemical Society Published on Web 06/13/2001

494 Bioconjugate Chem., Vol. 12, No. 4, 2001

Berti et al.

Figure 1. A. Schematic representation of an ET-cassette labeled primer. R ) 1′,2′-dideoxyribose monomer. B. Chemical structure of an ET cassette. C. Schematic of the two-step ET cassette primer conjugation.

of primer deprotection followed by conjugation with the ET cassette. By quantitative coupling to a thiol-activated M13-target primer through disulfide exchange, a fourcolor set of ET cassette-labeled M13-primers have been constructed and used for both PCR and DNA sequencing analysis. The acceptor dye emission intensities of primers produced in this manner are comparable to commercially available ET primers (Berti et al., 2001). In this report we labeled seven STR specific primers in each of four colors with our ET cassettes and analyzed the amplicons generated from these primers on a MegaBACE-1000 CAE system. Amplicons from a primer set where either the forward or reverse primer was labeled were generated as well as amplicons from multiplex amplification mixtures. Single basepair (bp) resolution is easily achieved with amplicons generated from four-color ET cassette labeled STR primers. This study illustrates that this ET-cassette labeling technology is particularly well suited to microsatellite analysis and other fluorescent DNA assays where large numbers of custom-labeled ET primers are required.

MATERIALS AND METHODS

DNA. Purified K562 cell line DNA was purchased from Promega Corp. (Madison, WI). Universal CEPH (Centre d′Etude du Polymorphisme Humain) Donor DNA, catalog number NA10859, was purchased from the Coriell Cell Repository (Camden, NJ). A genomic DNA sample containing the previously characterized THO1 9.3/10 alleles was generously provided by G. Sensabaugh, School of Public Health, U. C. Berkeley (Wang et al., 1995; 1996). ET Cassette Synthesis. Briefly, starting with a 6-FAM-labeled controlled-pore glass (CPG) column on an Applied Biosystems (Foster City, CA) 392 DNA Synthesizer, the 1′,2′-dideoxyribose monomers, amino modified T-base, and a monomethoxytrityl (MMT)-protected 5′amino-modifier group were added sequentially through standard phosphoramidite chemistry. Cassettes with both seven and eight 1′,2′-dideoxyribose monomer spacings were synthesized for this study. The 6-FAM-labeled cassette precursor was cleaved from the CPG support by NH4OH treatment. The trifluoroacetamide protecting

Energy-Transfer Cassettes for DNA Fragment Sizing

Bioconjugate Chem., Vol. 12, No. 4, 2001 495

Table 1. Primer Sequencesa primer name

chromosomal location

CSFIPOforward

5q33.3-q34

CSFIPOreverse

5q33.3-q34

D7S820 D13S317 THO1

7q11.21-q22 13q22-q31 11p15.5

TPOX

2p25.1-pter

vWAreverse

12p12-pter

a

locus definition human c-fms protooncogene for CSF-1 receptor gene human c-fms protooncogene for CSF-1 receptor gene NAb NA human tyrosine hydroxylase gene human thyroid peroxidase gene human von Willebrand factor gene

repeat sequence

labeled sequence 5′-3′

PCR reverse primer sequence 5′-3′

AGAT

AACCTGAGTCTGCCAAGGACTAGC

TTCCACACACCACTGGCCATCTTC

AGAT

TTCCACACACCACTGGCCATCTTC

AACCTGAGTCTGCCAAGGACTAGC

AGAT AGAT AATG

TGTCATAGTTTAGAACGAACTAACG ACAGAAGTATGGGATGTGGA GTGGGCTGAAAAGCTCCCGATTAT

CTGAGGTATCAAAAACTCAGAGG GCCCAAAAAGACAGACAGAA ATTCAAAGGGTATCTGGGCTCTGG

AATG

ACTGGCACAGAACAGGCACTTAGG

GGAGGAACTGGGAACCACACAGGT

AGAT

GGACAGATGATAAATACATAGGATG GAAAGCCCTAGTGGATGATAAGAATAAT GATGG

Ober et al., 1998; www.cstl.nist.gov. b NA: Not available.

group on the amino-modified T-base was also removed by this NH4OH treatment. Succinimidyl ester derivatives of the acceptor dyes were then conjugated with the amino modified T-base. The acceptor dyes 6-carboxyrhodamine110 (R110, emission maximum at ∼525 nm), 6-carboxyrhodamine-6G (R6G, emission maximum at ∼555 nm), carboxytetramethylrhodamine (TAMRA, emission maximum at ∼572 nm), and 6-carboxy-X-rhodamine (ROX, emission maximum at ∼620 nm) were obtained from Molecular Probes (Eugene, OR). The donor 6-FAM dye has an emission maximum at ∼497 nm. Unreacted dyes were removed by size exclusion chromatography on PD10 cartridges (Amersham/Pharmacia Biotech, Piscataway, NJ), and then the MMT-5′-aminomodifier group was deprotected with aqueous acetic acid treatment. A sulfosuccinimidyl 6-[3′-(2-pyridyldithio)propionamido]hexanoate (Sulfo-LC-SPDP) linker (Pierce, Rockford, IL) was then coupled to the amino-functionalized ET cassette, and the activated cassette was purified by reverse phase HPLC. A particular ET cassette is described by the abbreviation D-Sn-A, where D is the donor, A is the acceptor, and Sn indicates the number of sugar phosphate monomers constituting the spacer (Ju et al., 1995). The ET cassettes with R110 and TAMRA as the acceptor dyes utilized a spacer with eight sugar phosphates (S-8) while cassettes with R6G and ROX as the acceptors utilized seven sugar phosphate spacers (S-7). In this cassette format the modified T to which the acceptor dye is attached will function as part of the spacer. Therefore, the spacings for the cassettes used in this study are functionally nine and eight units, respectively. The donor-acceptor dye pairings and the sugar phosphate spacers in our current cassettes are similar to those found in commercially available M13 ET labeled primers. The donor-acceptor dye pairs and spacings were selected to maximize the acceptor emission intensity while minimizing the relative donor emission. ET Cassette-Primer Conjugation. Primer sequences are presented in Table 1. Modified primers for ET cassette conjugation were purchased from Operon Technologies (Alameda, CA) with a 5′-protected thiol (C6 S-S modification) and the trityl protection groups already removed. Additional primers were obtained from GIBCO BRL (Gaithersburg, MD). The thiol primer, protected as a disulfide, was deprotected by incubating in a 0.17 M phosphate buffer pH 8.0 solution containing 0.04 M dithiothreitol (DTT) for 16 h at 37 °C in a MJ Research PTC-100 Programmable Thermal Cycler (Watertown, MA). The thiol-deprotected primers can be stored for prolonged periods of time in this same solution at -20 °C. Just prior to coupling, the thiol-deprotected primers were purified using a PD-10 cartridge. A typical primer-ET cassette coupling reaction was performed as

follows: equimolar amounts (∼1 nmol) of activated ET cassette and purified thiol-deprotected primer are mixed together in a 0.5 µL Eppendorf tube, dried down in a vacuum centrifuge, and reconstituted in 20 µL of 20 mM phosphate buffer containing 1 mM EDTA pH 7.5 and incubated at 45 °C overnight in the thermal cycler. The ET cassette-conjugated primers were then purified by reverse phase HPLC and quantitated by UV spectroscopy. ET cassette-labeled primers were stored in 1X TE at -20 °C. PCR Amplification. Fifty nanograms of genomic DNA was utilized for each PCR reaction along with 15 pmol of both the ET cassette label and appropriate reverse primer. Reactions utilized Qiagen PCR Master Mix (Valencia, CA). Reaction conditions used were as described for specific STR loci (Promega, 1998) on the MJ Research Thermal Cycler. Successful PCR was verified by agarose gel electrophoresis. Sample Preparation and Sizing Standards. PCR amplicons were desalted using the Qiagen PCR Purification Kit. Samples were resolubilized in 50 µL of 0.5X TE buffer. Approximately 1 µL of sample was then mixed with 5 µL of 75% deionized formamide containing dyelabeled sizing markers at a concentration of 10 fM. The TET (tetrachlorofluorescein, emission maximum at ∼538 nm) Mapmarker Sizing Standard consisting of 20 fragments (70, 80, 90, 100, 120, 140, 160, 180, 190, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, and 400 bp) was obtained from Bio Ventures Inc. (Murfreesboro, TN). The ET-400-R sizing standard obtained from Amersham/ Pharmacia consists of 20 fragments (60, 90, 100, 120, 150, 160, 170, 190, 200, 220, 250, 270, 290, 300, 310, 330, 350, 360, 380, and 400 bp) labeled in an energy transfer format with FAM as the donor dye and ROX as the acceptor dye. Samples were placed in a 96-well microtiter injection plate and centrifuged for 5 s to remove air bubbles. Less than 10 min before injection, the samples were denatured at 95 °C for at least 5 min and immediately placed on ice. Capillary Array Electrophoresis. A MegaBACE1000 capillary array electrophoresis system (Molecular Dynamics, Sunnyvale, CA) was utilized for sizing separations (Fox, 1999; Medintz et al., 2000a; Meldrum, 2000). This CAE system contains 96 capillaries, each with a 40 cm length (Bashkin et al., 1996a,b). Long Read linear polyacrylamide matrix, LPA, containing 7 M urea in a Tris/Taps buffer, was obtained from Amersham/Pharmacia Biotech. The matrix was introduced into the capillaries at 400 psi for 200 s followed by pre-electrophoresis for 5 min at 10 kilovolts (kV). Denatured samples were introduced into the capillaries by electrokinetic injection for 45 s at 3 kV and then electrophoresed at 10 kV for 75 min. Fresh matrix was introduced into

496 Bioconjugate Chem., Vol. 12, No. 4, 2001

Berti et al.

Table 2. Comparison of Predicted and Observed Allele Sizes Using ET Cassette-Labeled STR Primers locus

alleles

CSFIPO 9/10 (forward) CSFIPO 9/10 (reverse) D7S820 9/11 D13S317 8/8 THO1 9.3/9.3 TPOX 8/9 vWA 16/16 a

determined size (bp)a predictedc avg of determined/ std deviation of foursize (bp) FAM-8-R110 FAM-7-R6G FAM-8-TAMRA FAM-7-ROX predicted size (bp)b color sizing values 303/307

316.8/321.1

315.6/321.2

316.5/320.5

317.5/321.5

13.6/14.1

0.79/0.42

303/307

318.1/321.3

317.4/321.5

318.3/322.4

317.3/321.4

14.8/14.7

0.50/0.50

210/218 169 198 232/236 151

223.5/231/6 188.4 210.3 244.8/248.7 163.5

222.7/231.6 188.5 209.7 243.8/247.9 163.1

224.6/232.8 187.8 210.3 244.9/248.9 163.8

222.9/231.1 187.6 209.7 244.1/248.1 163.4

13.4/13.8 18.1 12.0 12.4/12.4 12.5

0.85/0.72 0.44 0.35 0.53/0.48 0.29

Size of each allele in each color averaged from two capillaries. b Average size of all four colors. c www.cstl.nist.gov; Ober et al., 1998.

the capillaries between each run. The instrument was set up to run in sequencing mode with the 488 nm laser only used for fluorescent excitation. Four-channel fluorescent detection was performed with the following emission wavelength detection ranges: Channel 1, 555 ( 10 nm; Channel 2, 520 ( 10 nm; Channel 3, g 610 nm; and Channel 4, 580 ( 10 nm. Data Analysis. Data were analyzed with Genetic Profiler Software Version 1.1 (Molecular Dynamics, Sunnyvale, CA). The raw signal data files were imported into the Genetic Profiler program where they underwent background subtraction using a spectral separation or cross-talk matrix. Unknown samples were sized against the DNA sizing ladders included in each capillary using a third-order local algorithm (Medintz et al., 2000a; Wedemayer et al., 2001). RESULTS

Evaluation of ET Cassette-Labeled STR Amplicons. All the primers utilized in this study were successfully labeled in parallel with the four different ET cassettes. Amplicons were generated from the K562 DNA and the CEPH control DNA and were genotyped on the MegaBACE-1000 CAE instrument. Figure 2 presents the electropherograms generated by genotyping all the FAM7-ROX-primer derived alleles amplified from the CEPH control DNA. As can be seen, each of the amplicons is clearly identified and genotyped even though the amount of PCR product utilized for these separations represents only 1/50th of the total amount of purified PCR amplicon. Furthermore, these strong signals are obtained in the ROX channel, which has the reddest absorption (∼595 nm) and emission (∼620 nm); without using ET-labeling the ROX emission would be more than 10-fold weaker (Medintz et al., 2000b;2001). The spacings between determined allele sizes corresponds to 4-bp increments as predicted for the TPOX, THO1, D7S820, and vWA loci. The difference between labeling either the forward or reverse primer for the CSF1PO locus is only 0.2 bp. This very slight (0.06%) difference is achieved even though the DNA strands that are labeled and separated are distinct in sequence. Since ET cassette-primer labeling results in the addition of the ET cassette to a modified primer, a slight difference in predicted versus determined fragment size is expected. The approximate sizes of the cassettes were predicted by taking the molecular weight of the cassette and dividing by the average molecular weight of a nucleotide (330 g/mol). Using this method, the predicted size of an S-8 cassette should range from 9.5 bp for the FAM-8-TAM cassette to 9.8 bp for the FAM-8-ROX primer. Use of an S-7 cassette will drop these predicted sizes into the 8.5 to 8.8 bp range. To determine the actual effect of ET cassette conjugation on fragment sizes,

amplicons were generated from the K562 genomic DNA. The predicted sizes of the alleles generated from K562 DNA with the corresponding unlabeled primers have been characterized (Promega Corp, 1998; www.cstl.nist.gov). Table 2 presents a comparison of the predicted K562 allele sizes at the seven loci with those determined using all 4 ET cassette-labeled primers. On average, the ET labeled alleles were increased in size by 12.0 to 18.1 bp for the THO1 9.3 allele and the D13S317 8 allele, respectively. The standard deviations of the fourcolor sizing values for each allele ranged from 0.29 for the vWA 16 allele to 0.85 for the 9 allele at the D7S820 locus. Multiplex Amplification. To explore the utility of ET cassette-labeled primers for multiplex coamplification and analysis, three separate amplicons were generated in a single reaction. Using K562 DNA, amplicons were generated with the THO1 FAM-8-TAM, TPOX FAM-7R110, and CSF1PO reverse FAM-8-R6G labeled primers. Figure 3 presents the separation and genotyping of this triplex analysis against the ET-400-R sizing ladder. All the expected amplicons were generated, and their sizing did not differ from values presented in Table 2. Single Base-Pair Resolution. The original characterization of these disulfide ET cassettes showed through four-color sequencing of M13 DNA that single base-pair resolution is easily achieved (Berti et al., 2001). A similar test in the context of STR analysis was performed using a THO1 9.3/10 allele-containing sample that was genotyped with all four ET labels. The THO1 9.3 allele represents a common variant that differs from the 10 allele by only a single base, instead of the usual 4 bp repeat (Promega 1998; Wang et al., 1995; 1996). Figure 4 presents the genotyping of this sample with all ET cassette labeled THO1 primers. Single bp resolution between the two alleles is achieved for all four colors. The interallele size difference in every case is no more than 1/10th of a bp, or 0.04%. Effects of S-7 and S-8 Sugar Phosphate Spacers. To determine the effects of cassettes containing different number of sugar phosphate spacers on electrophoretic separations, the CEPH sample was genotyped at the THO1 locus with FAM-7-TAM and FAM-8-TAM ET cassette labeled primers. The expected size differences for these two cassettes should be around 1 bp. Figure 5 presents the separation of the alleles generated in this experiment. The 4 bp difference between alleles is stillmaintained while the difference caused by the change in spacer number is less than 1 bp. Similar results were obtained with K562 DNA for the same primers as well as for the D7S8 primer labeled with FAM-7-R110 and FAM-8-R110 cassettes (data not shown).

Energy-Transfer Cassettes for DNA Fragment Sizing

Bioconjugate Chem., Vol. 12, No. 4, 2001 497

Figure 2. Panels A-G present electropherograms generated by genotyping all the FAM-7-ROX primer derived alleles amplified from the CEPH control DNA. Samples (red traces) were separated against the TET Mapmarker Sizing Standard (green traces) on the MegaBACE-1000 CAE system, and resulting data were analyzed using Genetic Profiler Version 1.1 software. The allele sizes as determined are displayed above the peaks. Peak signal strength range is 600-10000 fluorescence units. DISCUSSION

This study was performed to explore the feasibility of using ET cassette labeling to tag any primer of interest in a multicolor fluorescent format. To accomplish this we

labeled seven different STR specific primers, each with four different ET cassette labels, and genotyped amplicons generated from these primers. Our ET cassette labeling methodology has numerous advantages. One can tag any primer of interest with any of the multicolor ET

498 Bioconjugate Chem., Vol. 12, No. 4, 2001

Berti et al.

Figure 3. Four-color electropherogram demonstrating multiplex coamplification and analysis. Three separate amplicons were generated in a single reaction using K562 DNA and the THO1 FAM-8-TAM, TPOX FAM-7-R110, and CSF1PO reverse FAM-8-R6G labeled primers. The THO1 (black), TPOX (blue), and CSF1PO (green) alleles were separated and sized against the ET-400-R Sizing Standard (red). Allele sizes are indicated above the peaks.

Figure 4. Genotyping of the 9.3/10 allele containing sample with all 4 ET cassette-labeled THO1 primers. The small peak just to the left of the first allele represents a PCR stutter artifact common in STR DNA typing of these loci (Medintz et al., 2000a; Promega, 1998). The red (ET-400-R) or green (TET Mapmarker) peaks at 200 and 220 bp are generated from the sizing standard. Cassettes used for labeling are indicated and the determined sizes are presented above the peaks.

cassette labels. Primers destined for ET cassette labeling can be obtained commercially with a 5′ protected thiol modifier; the primer can be deprotected in one step and stored for subsequent tagging. This ET cassette labeling technology is easily adapted to 96 well parallel robotic preparation formats, and both the primer deprotection

and ET cassette labeling reactions can be performed with a PCR thermal cycler. Due to the high sensitivity obtained when using ET cassette labels, only small amounts of labeled amplicons are needed for actual analysis. This means that primer concentrations and reaction volumes can be substantially reduced.

Energy-Transfer Cassettes for DNA Fragment Sizing

Figure 5. Effect of S-7 and S-8 sugar phosphate spacers on the mobility shift. The CEPH sample was genotyped at the THO1 locus with primers that had been labeled with either the FAM-7-TAM (A) or the FAM-8-TAM (B) cassettes. Alleles appear in black against the TET sizing markers in green at 190 and 200 bp.

To demonstrate multiplex analysis we evaluated the amplicons generated from ET cassette-labeled primers on a MegaBACE-1000 CAE system. All primers were labeled in all four colors and alleles from K562 and the CEPH control DNA were successfully generated by PCR and analyzed for all seven primers. The addition of the ET cassettes to these primers was expected to increase the sizes of amplicons by approximately 8-10 bp. The results presented in Table 2 show that the actual average fragment size for each of the seven loci increases by 12.0 to 18.1 bp. However, the standard deviation between each of the four cassette labels for each primer is very small (0.29 to 0.85 bp). This indicates that the addition of any one of the ET cassettes to a primer will result in a very small sizing difference as compared to another ET cassette for that same primer. The effect of the ET cassette on predicted versus determined fragment sizes can be ascribed to the increased mass and bulk of the cassette, the difference in charge, as well as conformational influences. The fact that the TET Mapmarker has a single fluorescent label directly attached to each DNA strand as well as the noncassette structure of the ET400-R ladder also have to be taken into account. These structural differences will influence electrophoretic migration rates and cause relative mobility differences. Additionally, the sizing markers are all present as singlestranded DNA fragments while the amplicon sample consists of both the labeled and unlabeled complementary DNA strand. Although the samples are denatured prior to analysis, this may still influence electrophoretic migration. However, these mobility shift effects can be easily corrected by labeling all the fragments in the separation with ET cassettes or through the use of mobility shift correction software. The 4 bp incremental size difference between STR alleles is strictly maintained in this ET format (see Table 2 and Figures 2-5). Furthermore labeling either the forward or reverse primer does not alter sizing differences as evidenced by the 0.2 bp difference in amplicon size at the CSF1PO locus (Figure 2). This small difference is achieved even though the analyzed strands are distinct

Bioconjugate Chem., Vol. 12, No. 4, 2001 499

in sequence. Finally, primers labeled in this manner are functional for multiplex coamplification and analysis. This is demonstrated through a triplex amplification and four-color genotyping analysis (Figure 3). Moreover, single bp resolution is easily achievable when using these primers (Figure 4). An added benefit of this labeling format is the flexibility to choose ET cassettes with different numbers of dideoxyribose monomer spacers. This becomes important when analysis requires differentiating amplicons that migrate very close to one another (Hung et al., 1997). By utilizing cassettes with varying spacers to label different primers, coeluting amplicons can be forced to migrate separately. Adjustment of cassette monomer spacing will allow adjustment in the differences between predicted vs electrophoretic size of fragments. Additionally, varying the number of spacers in an ET pair can substantially increase or decrease the relative fluorescent emission of the acceptor dye (Hung et al., 1998). For instance, cassettes can be constructed that have very high acceptor dye emissions, ideal for sequencing, or very low donor spectral cross-talk, ideal for multiplex fragment sizing/ genotyping analysis. ET cassette primer labeling is not limited to STR analysis. This labeling format can be used in any other assay where fluorescent tagging of analyte is required. This includes microarray hybridization formats, allele specific amplification, as well as protein and cell labeling (Meldrum, 2000; Medintz et al., 2000b,2001). Additionally, the ability to label any sequencing primer in a fourcolor ET cassette format will facilitate custom sequencing methods and plasmid vector formats beyond those containing the M13 sequence. In summary, these experiments have successfully demonstrated the wide applicability of our ET cassette labeling method and the ease with which the ET cassette labeling technology can be used for fluorescent tagging of any DNA oligonucleotide target. This ET cassette labeling technology will increase, expand, and diversify fluorescent DNA analysis. ACKNOWLEDGMENT

We thank Melanie Mahtani, Kristin Pirkola, and David Shen at Amersham-Pharmacia Biotech for assistance in using the Molecular Dynamics MegaBACE1000 CAE system and for providing the Genetic Profiler software. The authors also thank G. Sensabaugh for providing genotyping samples. I.M. is supported by NIH Program Project grant P01 CA77664 in collaboration with Johns Hopkins University. Support for L.B. is provided by Amersham-Pharmacia Biotech, by NIH grant HG01399, and the Director, Office of Science, Office of Biological and Environmental Research of the U.S. Department of Energy under contract DE FG91ER61125. LITERATURE CITED (1) Bashkin, J., Marsh, J., Barker, D., and Johnston, R. (1996a) DNA sequencing by capillary electrophoresis with a hydroxyethylcellulose sieving buffer. Appl. Theor. Electrophor. 6, 2328 (For more information on the instrument used, see http:// www.mdyn.com). (2) Bashkin, J., Bartosiewicz, M., Roach, D., Leong, J., Barker, D., and Johnston, R. (1996b) Implementation of a capillary array electrophoresis instrument. J. Cap. Electrophoresis 3, 61-68. (3) Berti, L., Xie, J., Medintz, I. L., Glazer, A. N., and Mathies, R. A. (2001) Energy Transfer Cassettes for Facile Labeling of Sequencing and PCR Primers. Anal. Biochem. 292, 188197.

500 Bioconjugate Chem., Vol. 12, No. 4, 2001 (4) Caskey, C. T., Pizzuti, A., Fu, Y.-H., Fenwick, R. G., and Nelson, D. L. (1992) Triplet repeat mutations in human disease. Science 256, 784-789. (5) Chakraborty, R., Stivers, D. N., Su, B., Zhong, Y., and Budowle, B. (1999) The utility of short tandem repeat loci beyond human identification: implications for development of new DNA typing systems. Electrophoresis 20, 1682-1696. (6) Cornelis, F., Faure, S., Martinez, M., Prud’Homme, J. F., Fritz, P., Dib, C., Alves, H., Barrera, P., DeVries, N., Balsa, A., PascualSalcedo, D., Maenaut, K., Westhovens, R., Migliorini, P., Tran, T. H., Delaye, A., Prince, N., Lefevre, C., Thomas, G., Poirier, M., et al. (1998) New susceptibility locus for rheumatoid arthritis suggested by a genome-wide linkage study. Proc. Natl. Acad. Sci. U.S.A. 95, 10746-10750. (7) Davies, J. L., Kawaguchi, Y., Bennet, S. T., Copeman, J. B., Cordell, H. J., Pritchard, L. E., Reed, P. W., Gough, S. C. L., Jenkins, S. C., Palmer, S. M., Balfour, K. M., Rowe, B. R., Farrall, M., and Todd, J. A. (1994) A genome-wide search for human type 1 diabetes susceptibility genes. Nature 371, 130136. (8) Dib, C., Faure, S., Fizames, C., Samson, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S., Hazan, J., Seboun, E., Lathrop, M., Gyapay, G., Morissette, J., and Weissenbach, J. (1996) A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380, A1-A138. (9) Edwards, A., Civitello, A., Hammond, H. A., and Caskey, C. T. (1991) DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am. J. Hum. Genet. 49, 746756. (10) Fox, S. (1999) MegaBACE impacts genome analysis. Genet. Eng. News. 19, 37. (11) Hung, S.-C., Mathies R. A., and Glazer A. N. (1997) Optimization of spectroscopic and electrophoretic properties of energy transfer primers. Anal. Biochem. 252, 72-88. (12) Ju, J., Ruan, C., Fuller, C. W., Glazer, A. N., and Mathies, R. A. (1995) Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis. Proc. Natl. Acad. Sci. U.S.A. 92, 4347-4351. (13) Ju, J., Glazer A. N., and Mathies, R. A. (1996a) Energy transfer primers: A new fluorescence labeling paradigm for DNA sequencing and analysis. Nature Med. 2, 246-249. (14) Ju, J., Glazer, A. N., and Mathies, R. A. (1996b) Cassette labeling for facile construction of energy transfer fluorescent primers. Nucleic Acids Res. 24, 1144-1148. (15) Kheterpal, I. and Mathies, R. A. (1999) Capillary array electrophoresis DNA sequencing. Anal. Chem. 71, 31A-37A. (16) Mansfield, E. S., Vainer, M., Enad, S., Barker, D. L., Harris, D., Rappaport, E., and Fortina, P. (1996) Sensitivity, reproducibility and accuracy in short tandem repeat genotyping using capillary array electrophoresis. Genome Res. 6, 893-903. (17) Mansfield, E. S., Robertson, J. M., Vainer, M., Isenberg, A. R., Frazier, R. R., Ferguson, K., Chow, ST., Harris, D. W., Barker, D. L., Gill, P. D., Budowle, B., and McCord, B. R. (1998) Analysis of multiplexed short tandem repeat (STR) systems using capillary array electrophoresis. Electrophoresis 19, 101-107.

Berti et al. (18) March, R. E. (1999) Gene mapping by linkage and association analysis. Mol. Biotechnol. 13, 113-122. (19) Medintz, I. L., Lee, C.-C. R., Wong, W. W., Pirkola, K., Sidransky, D., and Mathies, R. A. (2000a) Loss of heterozygosity assay for molecular detection of cancer using energytransfer primers and capillary array electrophoresis. Genome Res. 10, 1211-1218. (20) Medintz I., Wong W. W., Sensabaugh, G. F., and Mathies, R. A. (2000b) High-speed single nucleotide polymorphism typing of a hereditary haemochromatosis mutation with capillary array electrophoresis. Electrophoresis 21, 23522358. (21) Medintz I., Wong W. W., Berti L., Shiow L., Tom J., Scherer J., Sensabaugh, G. F., and Mathies, R. A. (2001) High performance multiplex SNP analysis of 3 Haemochromatosis related mutations with capillary array electrophoresis microplates. Genome Res. 11, 413-421. (22) Meldrum, D. 2000. Automation for genomics, part two: sequencers, microarrays, and future trends. Genome Res. 10, 1288-1303. (23) Molecular Dynamics. (2000) MegaBACE 1000 Instrument Operators Guide, Version 2.0. Molecular Dynamics, Sunnyvale, CA. (24) Ober, C., Cox, N. J., Abney, M., DiRienzo, A., Lander, E., Changyaleket, B., Gidley, H., Kurtz, B., Lee, J., Nance, M., Pettersson, A., Prescot, J., Richardson, A., Schlenker, E., Summerhill, E., Willadsen, S., and Parry, R. (1998) Genomewide search for asthma susceptibility loci in a founder population. The collaborative study on the genetics of asthma. Hum. Mol. Genet. 7, 1393-1398. (25) Promega Corp. (1998) Promega Technical Manual, Geneprint Fluorescent STR systems. Promega, Madison, WI. (26) Reed, P. W., Davies, J. L., Copeman, J. B., Bennet, S. T., Palmer, S. M., Pritchard, L. E., Gough, S. C. L., Kawaguchi, Y., Cordell, H. J., Balfour, K. M., Jenkins, S. C., Powell, E. E., Vignal, A., and Todd, J. A. (1994) Chromosome-specific microsatellite sets for fluorescence-based, semi-automated genome mapping. Nature Genet. 7, 390-395. (27) Wang, Y., Wallin, J. M., Ju, J., Sensabaugh, G. F., and Mathies, R. A. (1996) High-resolution capillary array electrophoretic sizing of multiplexed short tandem repeat loci using energy-transfer fluorescent primers. Electrophoresis 17, 1485-1490. (28) Wang, Y., Ju, J., Carpenter, B. A., Atherton, J. M., Sensabaugh, G. F., and Mathies, R. A. (1995) Rapid sizing of short tandem repeat alleles using capillary array electrophoresis and energy-transfer fluorescent primers. Anal. Chem. 67, 1197-1203. (29) Wedemayer, G., Medintz I., Wong W. W., Scherer J. R., and Mathies, R. A. (2001) Analysis of capillary electrophoresis microchip genotyping data with Genetic Profiler software. BioTechniques 30, 122-128. (30) Wiegand, P., Meyer, E., and Brinkmann, B. (2000). Microsatellite structures in the context of human evolution. Electrophoresis 21, 889-895.

BC000155W