Engineering Copper Hyperaccumulation in Plants by Expressing a

Article pubs.acs.org/est

Engineering Copper Hyperaccumulation in Plants by Expressing a Prokaryotic copC Gene Ignacio D. Rodríguez-Llorente,† Alejandro Lafuente,† Bouchra Doukkali, Miguel A. Caviedes, and Eloisa Pajuelo* Departamento de Microbiología, Facultad de Farmacia, Universidad de Sevilla, 41012-Sevilla, Spain S Supporting Information *

ABSTRACT: In this work, engineering Cu-hyperaccumulation in plants was approached. First, the copC gene from Pseudomonas sp. Az13, encoding a periplasmic Cu-binding protein, was expressed in Arabidopsis thaliana driven by the CaMV35S promoter (transgenic lines 35S-copC). 35S-copC lines showed up to 5-fold increased Cu accumulation in roots (up to 2000 μg Cu. g−1) and shoots (up to 400 μg Cu. g−1), compared to untransformed plants, over the limits established for Cu-hyperaccumulators. 35S lines showed enhanced Cu sensitivity. Second, copC was engineered under the control of the cab1 (chlorophyll a/b binding protein 1) promoter, in order to drive copC expression to the shoots (transgenic lines cab1-copC). cab1-copC lines showed increased Cu translocation factors (twice that of wild-type plants) and also displayed enhanced Cu sensitivity. Finally, subcellular targeting the CopC protein to plant vacuoles was addressed by expressing a modified copC gene containing specific vacuole sorting determinants (transgenic lines 35S-copC-V). Unexpectedly, increased Cu-accumulation was not achieved neither in roots nor in shootswhen compared to 35S-copC lines. Conversely, 35S-copC-V lines did display greatly enhanced Cu-hypersensitivity. Our results demonstrate the feasibility of obtaining Cu-hyperaccumulators by engineering a prokaryotic Cu-binding protein, but they highlight the difficulty of altering the exquisite Cu homeostasis in plants.

■

INTRODUCTION Copper has a dual effect on plant cells: it is an essential element, cofactor of many enzymatic reactions; and it is involved in physiological processes such as photosynthesis, mitochondrial respiration, superoxide scavenging, cell wall metabolism, ethylene perception, and development of reproductive organs.1,2 However, Cu is also one of the most toxic heavy metalsmedian toxic concentration around 2.0 μM in solution.3 Cu is at the top of the Irving-Williams series and tightly binds to polypeptides. Moreover, the redox couple Cu(I)/Cu(II) causes severe oxidative damage by producing harmful reactive oxygen species (ROS). To conciliate both aspects, plants have developed finely regulated homeostatic networks controlling Cu import, distribution to target proteins, and detoxification.4,5 At low Cu concentrations, the family of copper transporters COPT1COPT6 (highly specific for Cu(I)) are involved in the highaffinity Cu uptake by roots. FRO metalloreductases seem to be involved in the reduction of Cu(II) to Cu(I) at the plant plasma membrane.6 Cu is then bound to metallochaperones, including ATX1, CCH, and CCS1, which mediate Cu delivery to specific proteins.4 In the case of Cu deficiency, plants can mobilize vacuolar Cu reserves through the Cu transporter at the tonoplast, COPT5.7,8 Under severe Cu deficiency, higher plants prioritize Cu delivery to plastocyanin and dispensable copper proteins are substituted by other metalloproteins assuming an identical role (for instance, Cu/ZnSOD by FeSOD, laccases, and plantacyanin).9 In fact, the expression of both COPT and © 2012 American Chemical Society

Cu/ZnSOD is regulated by a transcription factor of the SQUAMOSA family (SPL7), which is a master regulator in response to low Cu that recognizes a GTAC core motif in the promoters.10,11 By contrast, if a Cu excess in the cytoplasm occurs, Cu(I) effluxeither to the apoplast or to storage compartmentsis mediated by P-type ATPases, such as HMA5.12 Other P-type ATPases are RAN1, mediating Cu delivery to ethylene receptors,13 and PAA1 and PAA2, mediating Cu delivery to chloroplasts and tylacoids, respectively.14 At the same time, Cu binding peptides such as phytochelatins, and preferably metallothioneins, bind excess copper.15 Furthermore, besides its role as electron transport in photosynthesis, plastocyanin PC2 acts as a sink in buffering excess Cu.16 This fine regulation leads to an oscillation of Cu concentration in the cytoplasm, coupled to the circadian clock.1 Concerning Gram-negative bacteria, Cu resistance in Pseudomonas is determined by the copRZABCD operon. Within this operon, copC encodes a periplasmic Cu-binding protein. The protein of Pseudomonas putida was postulated to display a 1:1 (polypeptide:Cu atoms) stoichiometry.17 More recent studies with crystallized protein from Pseudomonas syringae pathovar. tomato demonstrated a structure of β-barrel with two highly specific Cu binding sites at the ends, one for Cu(I) and Received: Revised: Accepted: Published: 12088

March 2, 2012 August 29, 2012 September 28, 2012 September 28, 2012 dx.doi.org/10.1021/es300842s | Environ. Sci. Technol. 2012, 46, 12088−12097

Environmental Science & Technology

Article

the other one for Cu(II).18,19 Within the protein, the ligands that coordinate Cu ions have been identified. The Cu(I) site shows a tetrahedral geometry and it is formed by two−three of the four methionines (Met-40, Met-43, Met-46, and Met-51) plus His48. The Cu(II) binding site has a tetragonal geometry, involving His1 and His91, together with Asp89 and Glu27. A water molecule in the apical position confers stability to this site.18,19 In the periplasm oxidizing environment, only when the protein is fully loaded with Cu(I)/Cu(II) are the Cu species stable. If only the Cu(I) site is occupied, Cu(I) is rapidly oxidized to Cu(II), just in the presence of oxygen. The availability of an unoccupied site of higher affinity induces an intermolecular transfer of either Cu(I) or Cu (II), while buffering the concentrations of cupric ion to subpicomolar levels.19 This peculiar biochemistry, and the fact that CopC can interact with the rest of the proteins codified by the operon, confers to the CopC protein the structural liability to transfer Cu (with or without redox switch) in the periplasm of Gramnegative bacteria. The presence of Cu-binding periplasm proteins (CopC and CopA, codified by the same operon) allows the accumulation of copper in the periplasm of Curesistant Gram-negative bacteria. In some Pseudomonas strains, Cu accumulation occurs in such large amounts (up to 12%) that colonies turn blue.20 In the past two decades, phytoremediation has emerged as a suitable green biotechnology to clean up contaminated environments.21 Concerning metals, the two main phytoremediation techniques are phytoextraction (using (hyper)accumulator plants)22 and phytostabilization (using metal excluders).23 Few plant species able to hyperaccumulate Cu have been described, such as the moss Scopelophila cataractae,24 and the higher plants Ipomoea alpine,25 Commelia communis,26 Elsholtzia splendens,27 and, more recently, Crassula helmsii, able to accumulate up to 9000 μg Cu.g−1.28 In contrast to other hyperaccumulators, which preferably accumulate metals in shoots, most of these plants are characterized by a preferential accumulation of Cu in roots. Transgenic plants expressing bacterial genes have been successfully developed for phytoremediation.29,30 Increased arsenic accumulation was achieved by expressing a prokaryotic arsenate reductase and a plant γ-glutamylcysteine synthetase.31 Also, mercury volatilization was achieved by expressing modified bacterial merA and merB genes (although these genes were optimized for plants).32 The aim of this work was expressing the copC gene from Pseudomonas sp. Az13 in A. thaliana under the control of a constitutive promoter in order to increase Cu accumulation in the plant. Furthermore, tissue-specific expression of copC and subcellular targeting of the CopC protein were approached.

of pCambia1390 (pCambia-copC). copC was placed under the control of the CaMV35S promoter by mobilizing a 35S promoter fragment from pPZPY112 35 to pCambia-copC plasmid as a HindIII-BamHI fragment (pCambia-35S- copC, SI Figure S2). To direct the expression of copC to green tissues, the gene was placed under the control of the cab1 (chlorophyll a/b binding protein) gene promoter, which is a light-inducible and organ-specific promoter.36,37 The cab1 promoter sequence was amplified from Arabidopsis thaliana genomic DNA using primers CABF1 (forward, 5′-GGAAGCTTCTCCTCAATCACACTCCTATAG-3′) and CABR2 (reverse, 5′-GGGGATCCAGGTTGAGTAGTGCAGCAC-3′). The PCR product (1120 bp), flanked by HindIII and BamHI restriction sites (underlined in the primers), was cloned into the corresponding sites of the pCambia-copC (pCambia- cab -copC, SI Figure S2). To target the CopC protein to the vacuole, specific vacuole sorting determinants were added both at the N- and C-termini of the protein. The sequence NPIRL was added at the Nterminus of the protein38 and the sequence EIPDIATVV at the C-terminus.39 Amplification of copC was performed using primers FEcopV (forward, 5′-GGGAATTCATGAATCCAATTAGACTTTTGCTCCTCAGCAGTC-3′) and RBcopV (reverse, 5′-CCAGATCTTCAAACAACAGTAGCAATATCTGGAATTTCCGTCACTTTGAACGT-3′), where the italic sequences represent the vacuole sorting determinants. The fragment was cloned into the EcoRI and BglII sites of pCambia1390 (pCambia-copC-V). copC-V was placed under the control of the CaMV35S promoter by mobilizing the 35S promoter fragment from pPZPY112 as described above (pCambia-35S-copC-V, SI Figure S2.C-D). Transformation of A. thaliana Plants and Selection of Transgenic Lines. Constructs were electroporated into Agrobacterium tumefaciens EHA10540 for A. thaliana transformation by the floral dip method.41 Seeds were sterilized for 8 min with 15% (v/v) household bleach containing a few drops of Tween 20, followed by three washes with sterile water. T1 generation seedlings were germinated on plates containing 1/2 MS (MS medium with one-half-strength macrosalts42) supplemented with hygromycin (30 mg/L) at 21 °C under a 12 h light/12 h dark regime. Plants surviving selection were grown on substrate in the greenhouse and T1 seeds were collected. The seeds were sown on 1/2 MS-hygromycin medium, and four hygromycin-resistant transgenic plant lines per construct (whose progeny segregated 3:1 for hygromycin resistance) were selected and allowed to set T2 generation seeds. Homozygous T3 lines were obtained as described previously.43 The presence of copC was confirmed by PCR using FEcop/RBcop primers for lines containing copC and FEcopV/RBcopV primers for those containing the modified gene copC-V. RNA Expression Analysis. For RNA studies, plants were grown in square plates containing 1/2 MS medium, supplemented with 50 μM Cu. Plates were incubated in a plant growth chamber at day/night temperatures of 22/18 °C and 16 h/8 h light/dark photoperiod. The root part of the plants was protected from light with black paper. Thirty-day-old seedlings were harvested at approximately 4 h after the light transition, for a high functionality of the cab1 promoter in cab1copC lines. RT-PCR. RNA was isolated from roots and shoots using the RNeasy Plant Mini Kit (Qiagen) following the manufacturer's instructions. Three independent RNA samples were obtained.

■

EXPERIMENTAL SECTION Generation of copC Constructs. Pseudomonas sp. strain Az13 was first isolated from the rhizosphere of legumes grown in metal polluted soils.33 It is able to tolerate up to 4.5 mM Cu34 and harbors a copABCD operon (acc. no EF587902). Comparison of the CopC protein sequence with the database is presented as Supporting Information (Figure S1). The copC gene was amplified using Pf u polymerase and primers FEcop (forward, 5′-GGGAATTCATGTTGCTCCTCAGCAGTC-3′) and RBcop (reverse, 5′-CCAGATCTTCACGTCACTTTGAACGT-3′). Restriction sites for EcoRI and BglII (underlined in the sequences) were included for cloning. The fragment was cloned into the EcoRI and BglII sites 12089

dx.doi.org/10.1021/es300842s | Environ. Sci. Technol. 2012, 46, 12088−12097


Article

Figure 1. Characteristic features of A. thaliana transgenic lines expressing copC under the control of 35S promoter. (A) RT-PCR amplification of copC in shoots and roots of 35S lines. No copC transcript was detected in wild-type (wt) plants (M: molecular weight marker). (B) Quantitative RTPCR of copC gene in shoots and roots of 35S lines. Amplification of the F-box transcript was used as a control to normalize expression levels. Results are the means ± SE of three different experiments. (Similar results were obtained using ACT2 and AT4G26410 as housekeeping genes.) (C) Aspect of wt and transgenic 35S-3 plants grown in medium containing 75 μM CuSO4. A representative set of plants is shown. Note the reduction of root length in transgenic plants. (D) Root length of 7-day-old wild-type and transgenic seedlings grown in the absence or presence of Cu (upper panel). Fresh weight of 14-day-old wt and transgenic seedlings grown in the absence or presence of Cu (lower panel). Data are means ± SE of 60 seedlings (20 representative seedlings × 3 plates). (E) Cu accumulation in shoots and root of wt and 35S transgenic plants. Plants were grown in a hydroponic system for one month and then transferred to 150 μM Cu for one week. Data are means ± SE of three independent determinations. Significant differences from wt plants as determined by Student’s t test are indicated by one asterisk (P < 0.05). The two asterisks indicate differences between transgenic lines.

at 95 °C for 45 s, 55 °C for 45 s, 72 °C for 1 min, and a final step at 72 °C for 10 min. qRT-PCR. Levels of mRNA were quantified by qRT-PCR as previously described44 using internal primers copC-q-F (5′ACCCTGGTCACGCAGTTTT-3′) and copC-q-R (5′CGCTGACTTTGGCTTTCAT-3′). RT-PCR was carried out using the Eco Real-Time PCR System (Illumina), following the manufacturer’s instructions. PCR conditions were as follows: 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 55 °C for 30 s, 72 °C for 10 s (reading), and a final step at 72 °C for 5 min, followed by a reading program consisting of 95 °C for 15 s, 50 °C for 15 s, and 30 min at increasing temperature (1.5 °C per min) and reading, and a final step at 95 °C for 15 s. Amplification of three independent housekeeping genes (actin2

For cDNA synthesis, 100 ng of DNase I-treated total RNA was used, and reverse transcription was carried out with the genespecific reverse primers RBcop and RBcopV, using the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions. Double-stranded cDNA was synthesized using FEcop/RBcop and FEcopV/RBcopV primers pairs, and concentration was adjusted to 75 ng/μL using a Thermo Scientific NanoDrop Spectrophotometer. RT-PCR was carried out using the QuantiFast Multiplex PCR Kit (Qiagen), primers pairs FEcop/RBcop or FEcopV/RBcopV, and a TGradient termocycler (Biometra), following the manufacturer’s instructions. PCR conditions were as follows: an initial denaturation at 95 °C for 2 min followed by 25 cycles 12090



Article

ACT2, F-Box and the unknown protein AT4G26410) was used to normalize results from different samples. Primers and conditions for ACT2 (actin-2 gene), F-Box, and the unknown protein AT4G26410 amplification have been described.45,46 Each assay was repeated twice (independent biological samples), and each measurement was performed in triplicate. Cu Tolerance Assays. Cu tolerance was evaluated as previously described,47 where the Cu concentrations were optimized. Seeds were germinated vertically on 1/2 MS plates. After three days, seedlings were transferred to 1/2 MS plates containing different concentrations of CuSO4 from 25 to 200 μM (at 25 μM intervals). Plates were incubated in a plant growth chamber at 16 h light/8 h dark photoperiod at temperature 22 °C/18 °C. Roots were protected from light by covering the lower part of the plate with black paper. Growth of the primary root was measured after 4 days (7-day-old seedlings), and biomass was determined in 14-day-old seedlings. Only relevant data are presented in the Results section at concentrations 50 and 75 μM: below 50 μM, minor differences between wild-type and transgenic lines were observed, and over 100 μM, phytotoxicity symptoms started to appear also in wildtype plants (SI Figure S3). Cu Accumulation Assays. To estimate Cu accumulation, a higher Cu concentration (150 μM) was used. Since this Cu concentration did not allow long-term Arabidopsis survival, plants were grown in a hydroponic system for one month in 1/ 2 MS medium (without additional Cu) and then transferred to 150 μM Cu for one week (1 week exposure). The system consisted in a container for the liquid 1/2 MS medium and a fine silk mesh floating onto the liquid surface. The system was placed inside transparent magenta boxes provided with a gaspermeable membrane that allowed gas exchange, and autoclaved. The lower part of the boxes was protected from light. Sterilized seeds from wild-type plants or from transgenic lines were spread on top of the mesh and incubated in a plant growth chamber at day/night temperatures of 22/18 °C and 16 h light/8 h dark photoperiod. After 1 month, the solution was substituted by fresh 1/2 MS medium containing 150 μM Cu, and plants were further cultivated for 1 week. After this period, plants were harvested at approximately 4 h after the light transition; roots and leaves were separated, exhaustively washed and dried; and metal content in both tissues was determined by ICP-OES as described.48 Targeting the Green Fluorescent Protein to the Vacuoles of Onion Cells. To test the correct targeting of proteins containing the vacuole sorting determinants, another construct was generated by replacing the copC gen in pCambia35S-CopC-V-plasmid by the green fluorescent protein gene (gf p). gf p was amplified from plasmid pMON3004949 using primers FEgfpV (forward, 5′-GGGAATTCATGAATCCAATTAGACTTGGCAAGGGCGAGGACTG-3′) and RBgfpV (reverse, 5′ CCAGATCTTCAAACAACAGTAGCAATATCTGGAATTTCCTTGTAGAGTTCATCCATGCC-3′), containing the same restriction sites and vacuole sorting determinants as copC-V. The PCR fragment was cloned into the EcoRI-BglII sites of pCambia-CopC-V, thus replacing copC by gf p (pCambia35S-gf p-V, Figure S1). pCambia-35S-gf p-V or pCambia-35S-gf p were delivered onto onion cells by gold particle bombardment as described.50,51 1.0 μm gold particles (Bio-Rad) were coated with 2 μL of a 1 μg/ μL solution of plasmid DNA. Particles were bombarded directly onto onion pieces using a Biolistic PDS-1000/He system (BioRad) with 1100 psi rupture discs under a vacuum of 28 in Hg.13

24 h after bombardment, the upper cell layer of onion pieces was peeled off and observed under an epifluorescence microscope Olympus BX61 provided with a camera DP70.

■

RESULTS Transgenic A. thaliana Plants Expressing Bacterial copC Gene Showed Enhanced Cu Accumulation. Four independent randomly selected T1 transgenic lines (designated 35S-2, 35S-3, 35S-4, and 35S-5) were analyzed for copC insertion. All selected lines contained the transgene (SI Figure S4), whereas untransformed plants did not show the PCR product. As a first approach, Cu content was determined in shoots of T1 lines (SI Table S1). All lines showed 2- to 4-fold increased Cu accumulation with regard to the untransformed control. Lines 35S-3 and 35S-5, presenting the highest Cu accumulation in shoots, were selected. Homozygous T3 lines of 35S-3 and 35S-5 were obtained and used for further characterization. RT-PCR analysis showed that A. thaliana was able to express the copC gene under the control of the 35S promoter, both in shoots and in roots (Figure 1A). No expression was found in wild-type plants. These data were further confirmed by quantitative qRT-PCR (Figure 1B). Similar expression levels in shoots and roots were observed in both lines. To examine whether the expression of copC influenced seedling tolerance to Cu, root growth inhibition and fresh weight were determined. No significant differences in root length were observed at 50 μM Cu (Figure 1C), while transgenic lines presented a reduction of around 20% in fresh weight (Figure 1D). At 75 μM Cu, 25% reduction in root length and 30% reduction in fresh weight were observed in transgenic lines with regard to the control (Figure 1D). These results suggested that expression of copC in A. thaliana decreases seedling tolerance toward Cu. Nevertheless, these plants still retained a relatively great biomass and were able to complete their life cycle in the presence of Cu (see Figure 3D in next section). As expected, wild-type plants showed a preferential accumulation of Cu in the roots. The concentration of Cu accumulated in the roots was up to 5-fold higher than that of the shoot (TF: translocation factor of 0.2 as root-to-shoot Cu concentration ratio) (Figure 1E). Transgenic lines 35S-copC showed enhanced Cu accumulation. Line 35S-5 was able to accumulate 2-fold more Cu, both in shoots and in roots. In particular, line 35S-3 showed the highest level of Cu accumulation, up to 400 μg Cu.g−1 in shoots and 1800 μg Cu.g−1 in roots (up to 5-fold increase in metal accumulation in shoots and roots with regard to control untransformed plants) (Figure 1E). Furthermore, translocation factors in both transgenic lines did not significantly change (0.22 and 0.23 for 35S-3 and 35S-5, respectively, compared to 0.20 for control untransformed plants, SI Table S2). It can be concluded that heterologous expression of the copC gene in A. thaliana plants led to a slight, although significant, decrease in copper tolerance, and at the same time, there was a marked increase of Cu accumulation in plant tissues. Transgenic A. thaliana Plants Expressing copC under the Control of the Light-Inducible and Tissue-Specific cab1 Promoter Displayed Higher Translocation Factors. Transgenic lines expressing copC under the control of the cab1 promoter could be an interesting model for Cu phytoextraction. Four randomly selected T1 lines (confirmed by PCR, not shown) were grown in the presence of Cu, and those 12091



Article

Figure 2. Characteristic features of A. thaliana transgenic lines expressing copC under the control of cab1 promoter. (A) RT-PCR amplification of copC in shoots and roots of cab1 lines. No copC transcript was detected in wild-type (wt) plants (M: molecular weight marker). (B) Quantitative RT-PCR of copC gene in shoots and roots of cab1-copC lines. Amplification of the F-box transcript was used as a control to normalize expression levels. Results are the means ± SE of three different experiments. (Similar results were obtained using ACT2 and AT4G26410 as housekeeping genes). (C) Root length of 7-day-old wild-type and transgenic seedlings grown in the absence or presence of Cu (upper panel). Fresh weight of 14day-old wt and transgenic seedlings grown in the absence or presence of Cu (lower panel). Data are means ± SE of 60 seedlings (20 representative seedlings × 3 plates). (D) Cu accumulation in shoots and roots of wt and cab1-copC transgenic plants. Plants were grown in a hydroponic system for one month and then transferred to 150 μM Cu during one week. Values of TF (Cu shoot accumulation/Cu root accumulation) are given. Data are means ± SE of three independent determinations. Significant differences from wt plants as determined by Student’s t test are indicated by one asterisk (P < 0.05).

showing higher Cu accumulation in shoots, designated cab1−4 and cab1−6, were selected (SI Table S1). Homozygous T3 lines were obtained and used for further characterization. The level of expression of the copC gene was analyzed by RTPCR (Figure 2A). Both lines seemed to have higher expression of copC in shoots than in roots. qRT-PCR was also performed (Figure 2B). It can be seen that the level of copC expression was not higher in shoots than in roots. By contrast, a higher expression in roots was observed in cab1−6. The experiment was repeated several times, and every time, the same result was obtained. Thus, qRT-PCR did not allow us to confirm a higher expression of the copC gene under the control of the tissuespecific promoter cab1 in green tissues. The sensitivity to copper was analyzed in T3 seedlings. There was a slight reduction (about 10−20%) in root length and a decrease in plant biomass (between 20% and 30%) (Figure 2C). These results again suggest a higher sensitivity of transgenic lines cab1−4 and cab1−6 to Cu, when compared

to control untransformed plants, quantitatively similar to that found in 35S-copC lines. Cu accumulation in plant tissues was determined (Figure 2C). Thirty-day-old transgenic seedlings were able to accumulate 2−3 times more Cu in the green tissues when compared to control plants, reaching values of Cu accumulation around 185−240 μg Cu.g−1. By contrast, root Cu accumulation was only up to 1.3−1.6-fold as compared to control untransformed plants (between 500 and 600 μg Cu.g−1). These data suggested that the expression of copC under the control of the light-inducible and tissue-specific promoter cab1 allowed higher Cu accumulation in shoots, with a maximum translocation factor of 0.41 for the transgenic line cab1−6 (SI Table S2). Moreover, total Cu accumulation in transgenic lines cab1−4 and cab1−6 were lower when compared to 35S lines, probably as a consequence of cab1 being a weaker promoter than 35S. 12092



Article

Figure 3. Characteristic features of A. thaliana transgenic lines expressing copC-V (with vacuole sorting determinants) under the control of 35S promoter. (A) Transient expression of control cytoplasmic GFP in onion epidermal cells. Fluorescence appears inside the nucleus (N), in the cytoplasm, and in transvacuolar strands (TVS) containing cytoplasm. The cytoplasm is located in the periphery of the cell (cyt). Lower right corner: close-up view of a cell expressing the nontargeted GFP. (B) Transient expression of gf p-V fusion in onion epidermal cells. Fluorescence appears diffusely in the cells, coincident with the position of the central vacuole. Fluorescence was not observed in the nucleus or in TVS. Lower right corner shows some cells in which the tonoplast is separated from the plasma membrane (indicated by an asterisk). (C) Cu accumulation in shoots and roots of wt and 35S−V transgenic plants. Plants were grown in a hydroponic system for one month and then transferred to 150 μM Cu during one week. Data are means ± SE of three independent determinations. Significant differences from wt plants as determined by Student’s t test are indicated by one asterisk (P < 0.05). (D−G) Comparison of transgenic lines 35S and 35S−V grown in the presence of 150 μM Cu. Note the symptoms of Cu hypersensitivity in 35S−V lines (D,E): lower biomass and size, small and brown-purple leaves and early flowering. (F,G) Comparison of rosette leaves of transgenic lines 35S (F) and 35S−V (G): leaves are brown-purple and smaller in 35S−V lines. (H,I) Comparison of 7-day-old transgenic 35S (H) and 35S−V (I) seedlings grown in the presence of 75 μM Cu. Cu hypersensitivity in transgenic 35S−V lines was observed as shorter and branched root systems.

contain cytoplasm.50,51 When the vacuole sorting determinants were added, fluorescence showed a diffuse aspect and occupied all the central cell volume, coincident with the position of the large central vacuole (Figure 3B). As previously reported,52,53 no fluorescence was observed in the nucleus. Cu accumulation was measured in tissues of transgenic lines 35S−V-4 and 35S−V-6. In both lines, Cu accumulation was up to 2-fold as compared to control untransformed plants, both in shoots and in roots (Figure 3C). Translocation factors were also similar to those of the control untransformed plants and 35S transgenic lines (SI Table S2). The sensitivity toward Cu of transgenic lines 35S−V was analyzed in plantlets and mature plants. There was a reduction of 35−40% in the length of the root and around 30−40% in biomass (SI Figure S5). These results suggested a higher sensitivity to Cu, as compared to control untransformed plants and also to 35S-copC plants. Transgenic 35S-copC and 35S-copC-V lines (containing the cytoplasmic or the vacuolar CopC) were compared for their sensitivity toward Cu in two developmental stages: 7-day-old plantlets and 1-month-old mature plants. Stronger Cu

Subcellular Targeting of CopC to the Vacuole Led to Cu Hypersensitivity. CopC protein was targeted to the vacuole by adding specific vacuole sorting determinants. Four randomly selected transgenic lines were confirmed by PCR (SI Figure S4) and those with the highest level of Cu accumulation, designated 35S−V-4 and 35S−V-6, were chosen (SI Table S1). T3 homozygous plants were obtained and used for further characterization. The expression of the chimerical copC-V gene was confirmed by qRT-PCR. Similar levels of expression were found in shoots and roots of both transgenic lines 35S−V-4 and 35S−V-6 (data not shown). In order to confirm that the vacuole sorting determinants were able to target soluble proteins to the vacuole, the construct pCambia-gf p-V was delivered by bombardment onto onion epidermal cells, and fluorescence of the GFP protein due to transient expression was investigated. In the absence of vacuole sorting determinants (control), fluorescence was localized in the nucleus and in the cytoplasm (displaced to a peripheral position by the large central vacuole) (Figure 3A). Fluorescence was also observed in transvacuolar strands, typical of untargeted GFP, since these structures 12093



Article

the oxidative stress of the plant, which must cope with this oxidative damage. In particular, the cuproenzyme Cu/Zn superoxide dismutase (Cu/ZnSOD) is involved in the detoxification of ROS and receive Cu through protein−protein interaction with the copper chaperone for superoxide dismutase (CCS).61 Cu trafficking between different cuproproteins has been shown to depend, not only on affinity gradients, but also on protein−protein specific recognition.60 Maybe the prokaryotic CopC protein cannot deliver Cu to plant cuproproteins, such as Cu/ZnSOD, due to a lack of specific protein−protein interactions. Furthermore, the binding constant of the CopCCu(II) complex (k ∼10−13 M)19 is much lower than that of the CopC-Cu(I) complex, indicating much more tightly bound Cu(II) to CopC. Thus, in this context, and in spite of the high external Cu concentration, an intracellular “Cu-depletion” situation may have been created (due to both thermodynamic and kinetic reasons), which may be another reason for Cusensitivity. Alternatively, enhanced Cu accumulation in transgenic lines could damage the photosynthetic apparatus. For example, Cu excess has been reported to decrease quantum efficiency of photosystem II, net photosynthetic rate, stomatal conductance, and pigment concentrations in Spartina densiflora.62 This effect is attributed to a substitution of chlorophyll Mg2+ by Cu2+ and to oxidative stress.63,64 Further investigation is required to elucidate these possibilities. For example, the expression of genes depending on SPL7 (FeSOD, COPTs, CCS, CumicroRNAs) could be analyzed in order to know whether a “Cu-depletion situation” is sensed by the plants. On the contrary, analyzing the levels of metallothioneins, HMA5 and PC2, which are known to be involved in Cu detoxification, could be done as an indication of copper excess.12,15,16 In addition, enzymes involved in redox stress can be studied. In an attempt to drive the expression of copC to shoots, it was cloned downstream of the cab1 promoter.36 Apparently, a higher expression of copC in green tissues could be detected by RT-PCR. At the same time, further increases in the translocations factors were achieved. These results suggested that these plants limit Cu accumulation in roots and upload more Cu to the xylem, maybe in response to a hypothetical “Cu-depletion” situation due to Cu tightly bound to CopC in green tissues. Expression levels of Cu transporters that upload Cu into the xylem, such as HMA5,12 might be investigated. Again, the expression of copC driven by cab1 led to Cusensitivity. It would be interesting to know whether there is additional damage to the photosynthetic apparatus in cab1-lines due to increased TFs. Under Cu excess, plastocyanin2 (PC2) has been shown to participate, not only in electron transfer during photosynthesis, but also in buffering Cu excess.16 Levels of PC2, which accumulates after Cu addition, can be investigated to test this possibility. However, Cu-depletion could also explain a Cu-sensitive phenotype, having a great influence on photosynthesis by modulating plastocyanin levels.14 Although speculative, the use of a stronger tissue-specific promoter could further increase Cu accumulation in shoots, making plants more useful for Cu phytoextraction. The lightinduced tissue-specific promoter SRS1p driving the expression of arsC to the shoots resulted in As hyperaccumulation and hypersensitivity.31 Finally, subcellular targeting was addressed as a strategy to accumulate the metal in the vacuole, one of the main detoxification mechanisms in plants.9 Since the vacuole-sorting

sensitivity was observed in mature 35S−V lines. There was a considerable reduction in plant biomass (Figure 3D,E), leaves were smaller and brown-purple (Figure 3F,G), and plants presented a shorter life cycle (early flowering), smaller seedpods, and a lower production of seeds when compared to 35S transgenic lines (Figure 3D,E). This enhanced Cu sensitivity was also remarkable in 7-day-old plantlets: 35S−V lines showed shorter and branched roots (Figure 3H,I).

4. DISCUSSION Cu hyperaccumulation is not a frequent trait in plants: up to the present date, 35 plant taxa belonging to 15 families were described as Cu (hyper)accumulators,54 although this number might be overestimated.55 Attempts to increase Cu accumulation/tolerance by expressing methallotioneins genes were made.29,30,47 In most cases, increased Cu tolerance was achieved, although Cu accumulation was not significantly improved. In this work, the first transgenic plants expressing a prokaryotic Cu binding protein have been generated. Expression of copC under the control of 35S promoter led to a maximum 5-fold increase in Cu accumulation in shoots and roots, without alteration of the TF values. These plants can be considered Cu hyperaccumulators, since the threshold for Cu hyperaccumulation has been recently established as 300 μg Cu.g−1.54 However, they showed lower Cu tolerance than the control untransformed plants at the seedling stage, as deduced from the reduction in root length and total biomass, which could be a handicap for phytoremediation. Nevertheless, these plants were able to complete their life cycles. Bacterial genes have been expressed in plants with variable phenotypes. For example, the expression of arsenate reductase arsC gene led to arsenic hypersensitivity.31 Analogously, the expression of merC from Acidithobacillus ferrooxidans (encoding a mercury uptake pump) led to enhanced Hg accumulation and hypersensitivity.56 Conversely, the expression of a bacterial heavy metal transporter in A. thaliana led to enhanced resistance and decreased uptake.57 Finally, the expression of the metal binding protein MerP from Bacillus megaterium allowed both metal (Hg, Cd, and Pb) tolerance and accumulation, due to metal biosorption to MerP on the plant cell surface.58 The biochemistry of the CopC protein might be related to the phenotype of 35S-copC plants, since CopC can exchange copper between the two Cu binding sites activated by a redox switch in the presence of O2.18,19 Due to its inherent toxicity, Cu(I), the most abundant Cu species in the cytoplasm, is always bound to ligands. The concentration of free Cu(I) in the cytosol of yeast cells is below 10−18 M.59 The partitioning of Cu(I) in the cytoplasm would depend on the relative binding affinities of Cu complexes with the array of cuproproteins, which have been recently investigated,60 and with the introduced protein CopC. In the cytoplasm, with a low redox potential, Cu/ZnSOD1 and metallothioneins are the proteins with higher affinity for Cu(I) (dissociations constants, Kd ∼0.23 and 0.41 and × 1015 M, respectively).60 After these proteins, some others also bind Cu(I) very tightly, such as the chaperone CCS.60 Under Cu excess, Cu(I) could still be available for binding to CopC [binding constant k ∼10−7 to 10−13 M for Cu(I)].19 However, when this reaction occurs, the CopC-Cu(I) loaded protein must not be stable in air, and it must quickly oxidize to CopC-Cu(II) in a intermolecular transfer reaction with redox change.18,19 The generation of ROS could increase 12094



■

determinants used in this work38,39 were able to target GFP to the vacuole of onion cells, it could be assumed that CopC was targeted to the vacuole as well, although further confirmation using a fusion protein or antibodies could be approached. Subcellular targeting of proteins to the endoplasmic reticulum or chloroplast were shown to improve Hg phytoremediation.65,66 In our study, transgenic plants with vacuole-targeted CopC showed 2-fold increased Cu accumulation, with no significant alteration of TF values. Surprisingly, an enhanced Cu accumulation was not achieved with regard to 35S lines. It seems that a great part of the copper is transported to the cell wall and bound to pectins.67,68 Alternatively, targeting CopC as a secreted protein to the cell wall may be attempted.65,69 The most remarkable characteristic of 35S−V lines was the high Cu hypersensitivity, especially in mature plants (low biomass, inhibited root growth, early flowering, and poor seed production). Since a higher Cu accumulation compared to 35ScopC lines was not seen, it could be due to other reasons, such as a higher oxidative stress or damage to the photosynthetic apparatus.4,5 Besides, a situation of Cu-depletion might have been provoked by irreversible copper sequestration by CopC inside the vacuole. Whereas in the cytoplasm Cu is bound to −S ligands (such as metallothioneins), in the vacuole it is thought to be bound to N− and O− ligands like organic acids and nicotinamide. Cu is also bound to −N and −O ligands of CopC. The vacuole Cu transporter COPT5 is involved in remobilizing Cu from the vacuoles.7,8 Again, the vacuolar prokaryotic CopC might not be able to deliver Cu to COPT5, and Cu cannot be reallocated to the cytoplasm. For instance, Cu deprivation is known to affect photosynthesis, pigments such as chlorophyll and carotenoids, and reproductive organs due to pollen development defects70 (in our case, 35S-copC-V transgenic plants have lower biomass, purple-brown leaves, and decreased seed production). However, the addition of more external Cu supply did not alleviate the hypersensitivity toward Cu (SI Figure S3). Furthermore, analyzing the expression levels of SPL7 (or other genes previously mentioned, such as FeSOD, CCH, and Cu-microRNAs) could shed some light on this phenotype, since the transcription factor SPL7 is a master regulator of Cu starvation. In this work, evidence is presented that Cu hyperaccumulation in plants can be achieved by expressing the prokaryotic copC gene. Expression of copC in deep-rooted plants with higher biomass production and adapted to particular environments could be interesting in Cu phytostabilization, since they accumulated huge Cu concentrations in roots. Furthermore, the light-inducible and tissue-specific promoter cab1 can drive the expression of the gene to the shoots, leading to increased TF for Cu accumulation, a desirable trait in Cu phytoextraction. The main disadvantage of transgenic plants expressing copC is the elevated Cu sensitivity, which could be related with one or several aspects of Cu homeostasis (redox unbalance, Cu hyperaccumulation, or even cytoplasmic “Cu-depletion”). Some possibilities to alleviate Cu hypersensitivity may be crossing these plants to metallotionein-expressing plants30,47 or buffering redox stress by coexpressing antioxidative enzymes, such as Fe superoxide dismutase (FeSOD), ascorbate peroxidase (APX), catalase (CAT), and glutathione reductase (GR), involved in ROS scavenging in hyperaccumulators.71

Article

ASSOCIATED CONTENT

S Supporting Information *

Additional information and figures. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel.: +34954556924. Fax: +34954628162. E-mail: epajuelo@ us.es. Author Contributions †

These authors contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was financed by the MICIIN (BIO2009/7766) and Junta de Andaluciá (P06−CVI-01850). FEDER founding is acknowledged. Authors are grateful to the Microanalysis and Biology Services of the CITIUS (University of Sevilla) for Cu determinations and particle bombardment equipment. Comments and suggestions made by anonymous reviewers are acknowledged.

■

REFERENCES

(1) Peñarrubia, L.; Andrés-Colás, N.; Moreno, J.; Puig, S. Regulation of copper transport in Arabidopsis thaliana: a biochemical oscillator? J. Biol. Inorg. Chem. 2010, 15 (1), 29−36 ; DOI DOI: 10.1007/s00775009-0591-8. (2) Festa, R. A.; Thiele, D. J. Copper: an Essential Metal in Biology. Curr. Biol. 2011, 21, 877−883. (3) Kopittke, P. M.; Blamey, F. P.; Asher, C. J.; Menzies, N. W. Trace metal phytotoxicity in solution culture: a review. J. Exp. Bot. 2010, 6 (4), 945−954 ; DOI DOI: 10.1093/jxb/erp385. (4) Himelblau, E.; Amasino, R. Delivering copper into plant cells. Curr. Opin. Plant Biol. 2000, 3 (3), 205−210 ; DOI DOI: 10.1016/ S1369-5266(00)80066-7. (5) Pilon, M.; Cohu, C. M.; Ravet, K.; Abdel-Ghany, S. E.; Gaymard, F. Essential transition metal homeostasis in plants. Curr. Opin. Plant Biol. 2009, 12 (3), 347−357 ; DOI DOI: 10.1016/j.pbi.2009.04.011. (6) Bernal, M.; Casero, D.; Singh, V.; Wilson, G. T.; Grande, A.; Yang, H.; Dodani, S. C.; Pellegrini, M.; Huijser, P.; Connolly, E. L.; Merchant, S. S.; Krämer, U. Transcriptome sequencing identifies SPL7-regulated copper acquisition genes FRO4/FRO5 and the copper dependence of iron homeostasis in Arabidopsis. Plant Cell 2012, 24 (2), 738−761 ; DOI DOI: 10.1105/tpc.111.090431. (7) Klaumann, S.; Nickolaus, S. D.; Fürst, S. H.; Starck, S.; Schneider, S.; Ekkehard, R.; Neuhaus, H.; Trentmann, O. The tonoplast copper transporter COPT5 acts as an exporter and is required for interorgan allocation of copper in Arabidopsis thaliana. New Phytol. 2011, 192 (2), 393−404 ; DOI DOI: 10.1111/j.1469-8137.2011.03798.x. (8) Garcia-Molina, A.; Andrés-Colás, N.; Perea-García, A.; Del ValleTascón, S.; Peñarrubia, L.; Puig, S. The intracellular Arabidopsis COPT5 transport protein is required for photosynthetic electron transport under severe copper deficiency. Plant J. 2011, 65 (6), 848− 60 ; DOI DOI: 10.1111/j.1365-313X.2010.04472.x. (9) Abdel-Ghany, S. E.; Pilon, M. Micro-RNA-mediated systemic down-regulation of copper protein expression in response to low copper availability in Arabidopsis. J. Biol. Chem. 2008, 283 (23), 15932−15945 ; DOI DOI: 10.1074/jbc.M801406200. (10) Kropat, J.; Tottey, S.; Birkenbihl, R. P.; Depège, N.; Huijser, P.; Merchant, S. A regulator of nutritional copper signaling in Chlamydomonas is an SBP domain protein that recognizes the GTAC core of copper response element. Proc. Natl. Acad. Sci. U.S.A. 2005, 102 (51), 18730−18735 ; DOI DOI: 10.1073/ pnas.0507693102. 12095



Article

(11) Birkenbihl, R. P.; Jach, G.; Saedler, H.; Huijser, P. Functional dissection of the plant-specific SBP-domain: overlap of the DNAbinding and nuclear localization domains. J. Mol. Biol. 2005, 352 (3), 585−596 ; DOI DOI: 10.1016/j.jmb.2005.07.013. (12) Andrés-Colás, N.; Sancenón, V.; Rodríguez-Navarro, S.; Mayo, S.; Thiele, D. J.; Ecker, J. R.; Puig, S.; Peñarrubia, L. The Arabidopsis heavy metal P-type ATPase HMA5 interacts with metallochaperons and functions in copper detoxification of roots. Plant J. 2006, 45 (2), 225−236 ; DOI DOI: 10.1111/j.1365-313X.2005.02601.x. (13) Binder, B. M.; Rodríguez, F. I.; Bleecker, A. B. The copper transporter RAN1 is essential for biogenesis of ethylene receptors in Arabidopsis. J. Biol. Chem. 2010, 285 (48), 37263−70 ; DOI DOI: 10.1074/jbc.M110.170027. (14) Abdel-Ghany, S. E.; Muller-Moule, P.; Niyogi, K. K.; Pilon, M.; Shikanai, T. Two P-type ATPases are required for copper delivery in Arabidopsis thaliana chloroplasts. Plant Cell 2005, 17 (4), 1233−1251 ; DOI DOI: 10.1105/tpc.104.030452. (15) Guo, W.-J.; Meetam, M.; Goldsbrough, P. B. Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance. Plant Physiol. 2008, 146 (4), 1697−1706 ; DOI DOI: 10.1104/pp.108.115782. (16) Abdel-Ghany, S. E. Contribution of plastocyanin isoforms to photosynthesis and copper homeostasis in Arabidopsis thaliana grown at different copper regimes. Planta 2009, 229 (4), 767−779 ; DOI DOI: 10.1007/s00425-008-0869-z. (17) Cánovas, D.; Cases, I.; de Lorenzo, V. Heavy metal tolerance and metal homeostasis in Pseudomonas putida as revealed by complete genome analysis. Environ. Microbiol. 2003, 5 (12), 1242−1256 ; DOI DOI: 10.1046/j.1462-2920.2003.00463.x. (18) Arnesano, F.; Banci, L.; Bertini, I.; Mangani, S.; Thompsett, A. R. A redox swich in CopC: An intriguing copper trafficking protein that binds copper (I) and copper (II) at different sites. Proc. Natl. Acad. Sci. USA. 2003, 100 (7), 3814−3819 ; DOI DOI: 10.1073/ pnas.0636904100. (19) Zhang, L.; Koay, M.; Maher, M. J.; Xiao, Z.; Wedd, A. G. Intermolecular transfer of copper ions from the CopC protein of Pseudomonas syringae. Crystal structures of fully loaded CuICII forms. J. Am. Chem. Soc. 2006, 128 (17), 5834−5850 ; DOI DOI: 10.1021/ ja058528x. (20) Silver, S.; Phung, L. T. Bacterial heavy metal resistance: new surprises. Annu. Rev. Microbiol. 1996, 50 (1), 753−789 ; DOI DOI: 10.1146/annurev.micro.50.1.753. (21) Prassad, M. N. V.; Freitas, H.; Fraenzle, S.; Wuenschmann, S.; Markert, B. Knowledge explosion in phytotechnologies for environmental solutions. Environ. Pollut. 2010, 158, 18−23 ; DOI DOI: 10.1016/j.envpol.2009.07.038. (22) Pilon-Smits, E. A. H. Phytoremediation. Annu. Rev. Plant Biol. 2005, 56 (1), 15−39 ; DOI DOI: 10.1146/annurev.arplant.56.032604.144214. (23) Méndez, M. O.; Maier, R. M. Phytostabilisation of mine tailings in arid and semiarid environments: an emerging remediation technology. Environ. Health Perspect. 2008, 116 (3), 278−283 ; DOI DOI: 10.1289/ehp.10608. (24) Satake, K.; Shibata, K.; Nishikawa, M.; Fuwa, K. Copper accumulation and location in the moss Scopelophila cataractae. J. Bryol. 1988, 15, 353−376. (25) Baker, A. J. M.; Walker, P. L. Ecophysiology of metal uptake by tolerant plants. In Heavy Metal Tolerance in Plants: Evolutionary Aspects, Shaw, A. J., Ed.; CRC Press: Boca Raton, FL, 1990; p 155. (26) Shu, W.; Yang, K.; Zhang, Z.; Yang, B.; Lan, C. Y. Flora and heavy metals in dominant plants growing on an ancient copper spoil heap on Tonglushan in HuBei province China. Chin. J. Appl. Environ. Biol. 2001, 7, 7−12. (27) Song, J.; Zhao, F. J.; Luo, Y. M.; MsGrath, S. P.; Zhang, H. Copper uptake by Elsholtzia splendens and Silene vulgaris and assessment of copper phytoavailability in contaminated soils. Environ. Pollut. 2004, 128, 307−315 ; DOI DOI: 10.1016/j.envpol.2003.09.019.

(28) Küpper, H.; Gotz, B.; Mijovilovich, A.; Küpper, F. C.; MeyerKlaucke, W. Complexation and toxicity of copper in higher plants. I. Characterization of copper accumulation, speciation and toxicity in Crassula helmsii as a new copper accumulator. Plant Physiol. 2009, 151 (2), 702−714 ; DOI DOI: 10.1104/pp.109.139717. (29) Eapen, S.; D’Souza, S. F. Prospects of genetic engineering of plants for phytoremedation of toxic metals. Biotechnol. Adv. 2005, 23 (2), 97−114 ; DOI DOI: 10.1016/j.biotechadv.2004.10.001. (30) Kotrba, P.; Najmanova, J.; Macek, T.; Rumi, T.; Mackova, M. Genetically modified plants in phytoremediation of heavy metal and metalloid soil and sediment pollution. Biotechnol. Adv. 2009, 27 (6), 799−810 ; DOI DOI: 10.1016/j.biotechadv.2009.06.003. (31) Dhankher, O. P.; Li, Y.; Rosen, B. P.; Shi, J.; Salt, D.; Senecoff, J. F.; Sashti, N. A.; Meagher, R. B. Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and γ-glutamylcysteine synthetase expression. Nat. Biotechnol. 2002, 20 (11), 1140−1145 ; DOI DOI: 10.1038/nbt747. (32) Bizily, S. P.; Rugh, C. L.; Meagher, R. B. Phytodetoxification of hazardous organomercurials by genetically engineered plants. Nat. Biotechnol. 2000, 18 (2), 213−217 ; DOI DOI: 10.1038/72678. (33) Carrasco, J. A.; Armario, P.; Pajuelo, E.; Burgos, A.; Caviedes, M. A.; López, R.; Chamber, M. A.; Palomares, A. J. Isolation and characterisation of symbiotically effective Rhizobium resistant to arsenic and heavy metals after the toxic spill at the Aznalcollar pyrite mine. Soil Biol Biochem. 2005, 37 (6), 1131−1140 ; DOI DOI: 10.1016/j.soilbio.2004.11.015. (34) Dary, M.; Chamber-Pérez, M. A.; Palomares, A. J; Pajuelo, E. In situ phytostabilisation of heavy metal polluted soils using Lupinus luteus inoculated with metal resistant plant-growth promoting rhizobacteria. J. Haz. Mat. 2010, 177 (1−3), 323−330 ; DOI DOI: 10.1016/ j.jhazmat.2009.12.035. (35) Yamamoto, Y. Y.; Matsui, M.; Ang, L. H.; Deng, X. W. Role of COP1 interacting protein in mediating light regulated gene expression in Arabidopsis. Plant Cell. 1998, 10 (7), 1083−1094. (36) Ha, S. B.; An, G. Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene. Proc. Natl. Acad. Sci. U.S.A. 1988, 85 (21), 8017−8021. (37) Mitra, A.; Han, J.; Zhang, Z. J.; Mitra, A. The intergenic region of Arabidopsis thaliana cab1 and cab2 divergent genes functions as a bidirectional promoter. Planta 2009, 229 (5), 1015−1022 ; DOI DOI: 10.1007/s00425-008-0859-1. (38) Matsuoka, K.; Neuhaus, J. M. Cis-elements of protein transport to the plant vacuoles. J. Exp. Bot. 1999, 50, 165−174. (39) Saint-Jore-Dupas, C.; Gilbert, M. A.; Ramis, C.; Nadine, P.; Kiefer-Meyer, M. C.; Neuhaus, J. M.; Faye, L.; Gomord, V. Targeting of proConA to the plant vacuole dependes on its nine aminoacids Cterminal polypeptide. Plant Cell Physiol. 2005, 46 (10), 1603−1612 ; DOI DOI: 10.1093/pcp/pci176. (40) Hood, E. E.; Gelvin, S. B.; Melcehers, L. S.; Hoekema, A. New Agrobacterium helper plasmids for gene transfer to plants. Trans. Res. 1993, 2, 208−218. (41) Clough, S. J.; Bent, A. F. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16 (6), 735−743. (42) Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassay with tobacco tissue culture. Plant Physiol. 1962, 15, 473− 497. (43) Harrison, S. J.; Mott, E. K.; Parsley, K.; Aspinall, S.; Gray, J. C.; Cottage, A. A rapid and robust method of identifiying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods 2006, 2, 19 ; DOI DOI: 10.1186/1746-4811-2-19. (44) Lafuente, A.; Pajuelo, E.; Caviedes, M. A.; Rodríguez-Llorente, I. D. Reduced nodulation in alfalfa induced by arsenic correlates with altered expression of early nodulins. J. Plant Physiol. 2010, 167 (4), 286−291 ; DOI DOI: 10.1016/j.jplph.2009.09.014. (45) Ben Amor, B.; Wirth, S.; Merchan, F.; Laporte, P.; d’AubentonCarafa, Y.; Hirsch, J.; Maizel, A.; Mallory, A.; Lucas, A.; Deragon, J. M.; Vaucheret, H.; Thermes, C.; Crespi, M. Novel long non-protein coding RNAs involved in Arabidopsis differentiation and stress 12096



Article

responses. Genome Res. 2009, 19 (1), 57−69 ; DOI DOI: 10.1101/ gr.080275.108. (46) Czechowski, T.; Stitt, M.; Altmann, T.; Udvardi, M. K.; Scheible, W. R. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005, 139 (1), 5−17 ; DOI DOI: 10.1104/pp.105.063743. (47) Rodríguez-Llorente, I. D.; Pérez-Palacios, P.; Doukkali, D.; Caviedes, M. A.; Pajuelo, E. Expression of the seed-specific metallothionein mt4a in plant vegetative tisues increases Cu and Zn tolerance. Plant Sci. 2010, 178 (3), 327−332 ; DOI DOI: 10.1016/ j.plantsci.2010.01.011. (48) Madejón, P.; Murillo, J. M.; Marañoń , T.; Cabrera, F. Bioaccumulation of trace elements in a wild grass three years after the Aznalcóllar mine spill (South Spain). Environ. Monit. Assess. 2006, 114 (1−3), 169−189 ; DOI DOI: 10.1007/s10661-006-2523-1. (49) Pang, S. Z.; DeBoer, D. L.; Wan, Y.; Ye, G.; Layton, J. G.; Neher, M. K.; Armstrong, C. L.; Fry, J. E.; Hinchee, M. A. W.; From, M. E. An improved green fluorescent protein gene as a vital marker in plants. Plant Physiol. 1996, 112 (3), 893−900 ; DOI DOI: 10.1104/ pp.112.3.893. (50) Scott, A.; Wyatt, S.; Tsou, P. L.; Robertson, D.; Stromgren Allen, N. Model system for plant cell biology: GFP imaging in onion living epidermal cells. Biotechniques 1999, 26 (6), 1125−1132. (51) Rodríguez-Llorente, I. D.; Pérez-Hormaeche, J.; Dary, M.; Caviedes, M. A.; Kondorosi, A.; Ratet, P.; Palomares, A. J. Expression of MsPG3-GFP fusions in Medicago truncatula “hairy roots” reveals preferential tip localization of the protein in root hairs. Eur. J. Biochem. 2003, 270 (2), 261−269 ; DOI DOI: 10.1046/j.14321033.2003.03384.x. (52) Matsuba, Y.; Sasaki, N; Tera, M.; Okamura, M.; Abe, Y.; Okamoto, E.; Nakamura, H.; Funabashi, H.; Takatsu, M.; Saito, M.; Matsuoka, H.; Nagasawa, K.; Ozeki, Y. A novel glucosylation reaction on anthocyanins catalyzed by acyl-glucose dependent glucosyltransferase in the petals of Carnation and Delphinium. Plant Cell 2010, 22 (10), 3374−3389 ; DOI DOI: 10.1105/tpc.110.077487. (53) Nomura, T.; Kutchan, T. M. Three new o-methyltransferases are sufficient for all o-methylation reactions of ipecac alkaloid biosynthesis in root culture of Psychotria ipecacuanha. J. Biol. Chem. 2010, 285 (10), 7722−7738 ; DOI DOI: 10.1074/jbc.M109.086157. (54) Kramer, U. Metal hyperaccumulation in plants. Annu Rev Plant Biol. 2010, 61, 517−534 ; DOI DOI: 10.1146/annurev-arplant042809-112156. (55) Faucon, M. P.; Ngoy Shutcha, M.; Meerts, P. Revisiting copper and cobalt concentrations in supposed hyperaccumulators from SC Africa: influence of washing and metal concentrations in soil. Plant Soil 2007, 301 (1−2), 29−36 ; DOI DOI: 10.1007/s11104-007-9405-3. (56) Sasaki, Y.; Hayakawa, T.; Inoue, C.; Miyazaki, A.; Silver, S.; Kusano, T. Generation of mercury-hyperaccumulating plants through transgenic expression of the bacterial mercury membrane transport protein MerC. Trans. Res. 2006, 15 (5), 615−625 ; DOI DOI: 10.1007/s11248-006-9008-4. (57) Lee, J. Y.; Yang, Y. Y.; Hwang, I.; Martinoia, E.; Lee, Y. Functional expression of a bacterial heavy metal transporter in Arabidopsis enhances resistance to and decreases uptake of heavy metals. Plant Physiol. 2003, 133 (2), 589−596 ; DOI DOI: 10.1104/ pp.103.021972. (58) Hsieh, J. L.; Chen, C. Y.; Chiu, M. H.; Chein, M. F.; Chang, J. S.; Endo, G.; Huan, C. C. Expressing a bacterial mercuric ion binding protein in plant for phytoremediation of heavy metals. J. Haz. Mater. 2009, 161 (2−3), 920−925 ; DOI DOI: 0.1016/j.jhazmat.2008.04.079. (59) Rae, T. D.; Schmidt, P. J.; Pufahl, R. A.; Culotta, V. C.; O’Halloran, T. V. Undetectable intracellular free copper: the requirement of a copper chaperone for superoxide dismutase. Science 1999, 284 (5415), 805−808 ; DOI DOI: 10.1126/science.284.5415.805. (60) Banci, L.; Bertini, I.; Ciofi-Baffoni, S.; Kozyreva, T.; Zovo, K.; Palumaa, P. Affinity gradients drive copper to cellular destinations.

DOI: 10.1038/ Nature 2010, 465 (7298), 645−648 ; DOI nature09018. (61) Cohu, C. M.; Abdel-Ghany, S. E.; Gogolin Reynolds, K. A; Onofrio, A. M.; Bodecker, J. R.; Kimbrel, J. A; Niyogi, K. K.; Pilon, M. Copper delivery by the copper chaperone for chloroplast and cytosolic copper/zinc-superoxide dismutases: regulation and unexpected phenotypes in an Arabidopsis mutant. Mol. Plant 2009, 2 (6), 1336−1350 ; DOI DOI: 10.1093/mp/ssp084. (62) Mateos-Naranjo, E.; Redondo-Gómez, S.; Cambrollé, J.; Figueroa, M. E. Growth and photosynthetic responses to copper stress of an invasive cordgrass Spartina densif lora. Mar. Environ. Res. 2008, 66, 459−465 ; DOI DOI: 10.1016/j.marenvres.2008.07.007. (63) Küpper, H.; Setlík, I.; Setliková, E.; Ferimazova, N.; Spiller, M.; Küpper, F. C. Copper-induced inhibition of photosynthesis: limiting steps of in vivo copper chlorophyll formation in Scenedesmus quadricauda. Funct. Plant Biol. 2003, 30 (12), 1187−1196 ; DOI DOI: 10.1071/FP03129. (64) Rocchetta, I.; Küpper, H. Chromium and copper induced inhibition of photosynthesis in Euglena gracilis analysed on the singlecell level by fluorescence kinetic microscopy. New Phytol. 2009, 182 (2), 405−420 ; DOI DOI: 10.1111/j.1469-8137.2009.02768.x. (65) Bizily, S. P.; Kim, T.; Kandasamy, M. K.; Meagher, R. B. Subcellular targeting of methylmercury lyase enhances its specific activity for organic mercury detoxification in plants. Plant Physiol. 2003, 131 (2), 463−471 ; DOI DOI: 10.1104/pp.010124. (66) Ruiz, O. N.; Hussein, H. S.; Terry, N.; Daniell, H. Phytoremediation of organomercurials via the chloroplast genetic engineering. Plant Physiol. 2003, 132 (3), 1344−1352 ; DOI DOI: 10.1104/pp.103.020958. (67) Konno, H.; Nakato, T.; Nakashima, S.; Katoh, K. Lygodium japonicum fern accumulates copper in the cell wall pectin. J. Exp. Bot. 2005, 56 (417), 1923−1931 ; DOI DOI: 10.1093/jxb/eri187. (68) Konno, H.; Nakashima, S.; Katoh, K. Metal-tolerant moss Scopelophila cataractae moss accumulates copper in the cell wall pectin of protonemata under copper-enriched conditions. J. Plant Physiol. 2010, 167 (5), 358−364 ; DOI DOI: 10.1016/j.jplph.2009.09.011. (69) Mathur, J. The illuminated plant cell. Trends Plant Sci. 2007, 12, 506−513 ; DOI DOI: 10.1016/j.tplants.2007.08.017. (70) Sancenon, V.; Puig, S.; Mateu-Andrés, I.; Dorcey, E.; Thiele, D.; Peñarrubia, L. The Arabidopsis copper transporter COPT1 functions in root elongation and pollen development. J. Biol. Chem. 2004, 279 (15), 15348−15355 ; DOI DOI: 10.1074/jbc.M313321200. (71) Sarma, H. Metal Hyperaccumulation in Plants: A Review Focusing on Phytoremediation Technology. J. Environ. Sci. Technol. 2011, 4 (2), 118−138 ; DOI DOI: 10.3923/jest.2011.118.138.

12097


Engineering Copper Hyperaccumulation in Plants by Expressing a

Recommend Documents