Engineering DNAâNanozyme Interfaces for Rapid Detection of Dental

Subscriber access provided by BUFFALO STATE

Biological and Medical Applications of Materials and Interfaces

Engineering DNA-Nanozyme Interfaces for Rapid Detection of Dental Bacteria Ling Zhang, Zhengnan Qi, Yan Zou, Jiaxing Zhang, Wenjun Xia, Rui Zhang, Zhiyan He, Xiaoxiao Cai, Yunfeng Lin, Shengzhong Duan, Jiang Li, Lihua Wang, Na Lu, and Zisheng Tang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b10718 • Publication Date (Web): 18 Jul 2019 Downloaded from pubs.acs.org on July 19, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Engineering DNA-Nanozyme Interfaces for Rapid Detection of Dental Bacteria Ling Zhang,†,§,⊥,▲ Zhengnan Qi,∥,◇,▲ Yan Zou,†,§,⊥ Jiaxing Zhang,# Wenjun Xia,†,§,⊥ Rui Zhang,# Zhiyan He,‡,§,⊥ Xiaoxiao Cai,¶ Yunfeng Lin,¶ Sheng-zhong Duan,‡,§,⊥ Jiang Li,○ Lihua Wang,○ Na Lu,#,* Zisheng Tang†,§,⊥,* †Department

of Endodontics and ‡Laboratory of Oral Microbiota and Systemic

Diseases, Shanghai Ninth People’s Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China

§National

Clinical Research Center of Oral Diseases, Shanghai 200011, China

⊥Shanghai

Key Laboratory of Stomatology & Shanghai Research Institute of

Stomatology, Shanghai 200011, China

∥Department

of Oral Medicine, Shanghai Stomatological Hospital, Fudan University,

Shanghai 200031, China

◇ Oral

Biomedical Engineering Laboratory, Shanghai Stomatological Hospital, Fudan

University, Shanghai 200031, China

#School

of Materials Engineering, Shanghai University of Engineering Science,

Shanghai 201620, China


Page 2 of 31

Page 3 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral

¶

Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, China ○

Zhangjiang Laboratory, Shanghai Advanced Research Institute, Chinese Academy of

Sciences, Shanghai 201210, China

KEYWORDS: DNA, nanozymes, biointerfaces, Streptococcus mutans, rapid detection

ABSTRACT Engineering biological interfaces represents a powerful means to improve the performance of biosensors. Here we developed a DNA-engineered nanozyme interface for rapid and sensitive detection of dental bacteria. We employed DNA aptamer as both molecular recognition keys and adhesive substrates to functionalize nanozyme. Utilizing different immobilization strategies and DNA designs, a range of DNA nanoscale biointerfaces were constructed to modulate enzymatic and biological properties of the nanozyme systems. These functional biointerfaces improved the accessibility of bacteria to the nanozyme surface, providing large signal change range at optimal DNA probe density. The DNA-functionalized nanozymes demonstrate a rapid, label-free and high sensitive direct colorimetric detection of Streptococcus



Page 4 of 31

mutans (S. mutans) with a detection limit of 12 CFU mL-1, as well as excellent discrimination from other dental bacteria. We demonstrate the use of this biological nanointerface for identifying dental bacteria in salivary samples, showing its potential in clinical prevention and diagnosis of dental diseases.

INTRODUCTION There is increasing interest on the studies of the interactions of nanostructured interfaces with biomolecules,1 cells,2, applications.

Particularly,

3

and living bodies4,

nanomaterials6,

7

with

5

for a wide variety of

enzyme-like

(nanozymes)9-12 have been proposed to build nanosystems13,

14

activities8

to explore the

feasibility in clinical diagnosis and therapeutics.15 For example, iron oxide (Fe3O4) nanoparticles or nanocomposites16-18 were proved to be capable of biodetection,19-21 bioimaging,22-24 bioadsorption25 and cancer therapy26,

27

by using or regulating the

enzymatic-like activities of inorganic nanozymes. However, accumulating evidence suggests that inorganic nanostructures can be interacted with nanomaterials non-specifically or incorporated into living organism discretionarily, which lacks structural stability in physiological environment and goes against the treatment of the disease.

DNA nanotechnology28 displays rational design and programmable assembly, which imitates natural biological interfaces with good biocompatibility and improves


Page 5 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the ability to interact with organism. DNA nanostructures29, 30 immobilized on surface allows high-parallel and high-efficient capture of specific identified targets from complex matrix samples.31 On the other hand, extracellular DNA (eDNA) plays a vital role in promoting or modulating biofilm forming bacteria,32 which mediates cell adhesion and maintains the structural integrity of biofilms.33 Therefore, DNA nanotechnology-enabled interfacial engineering onto various material surfaces34-37 imparted

with

multiple

functions

could

effectively

improve

biosensing

performances38-40 or treatment efficiency.41, 42

Dental caries is the most common oral disease.43 Severe caries may cause pulpitis, apical periodontitis and even loss of teeth. Interestingly, increasing reports have revealed the relationship between caries and systemic diseases, such as endocarditis and brain abscess.44 Since caries are bacteriogenic infection, detection of cariogenic pathogens is meaningful for prevention and diagnosis. Recently, molecular measures such as polymerase chain reaction (PCR)45 and enzyme amplified methods (e.g. ELISA) have gradually replaced conventional plating and culturing46 due to the advantages of high sensitivity and specificity. But the demand of expensive instruments and professional operation limits their practical application. Thereby, simple, rapid and direct detection of oral pathogens is a significant issue to public health.



In this study, we explored the use of DNA for engineering various interfaces on Fe3O4 NPs that remarkably improve the DNA-bacteria interactions. By using different DNA designs, three biointerfaces were finely constructed to regulate catalytic and biological properties of nanozymes. More importantly, these DNA-engineered nanosystem interfaces allowed for rapid and direct detection of typical oral pathogen of S. mutans with high affinity and recognition capabilities. Furthermore, this high-performance biointerface was tested for identifying artificial saliva samples used as an experimental cariogenic condition of the disease.

MATERIALS AND METHODS Optimization of colorimetric assays. The peroxidase-like activity of three bioconjugates was evaluated by oxidation of TMB substrate in the presence of H2O2, which produces blue color with a maximum absorbance at 652 nm. We examined whether the catalytic activity of Fe3O4 NPs is dependent on ssDNA concentrations and pH value of reacted solutions. At first, we measured the peroxidase-like activity of three Fe3O4 bioconjugates while varying the ssDNA concentration from 0 to 2 M and pH ranging from 4 to 8. Thus, we adopted optimal conditions of different systems respectively for the following experiments.

Quantitative measurement of S. mutans. A range of bacterial concentrations were prepared for the colorimetric assay using three nanosystems. 20 L of S. mutans


Page 6 of 31

Page 7 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


suspension was mixed with three kinds of bioconjugates in HAc-NaAc buffer (0.2 M, pH 4) in a clean microcentrifuge tube for 30 min. The final concentration of Fe3O4 in each tube was 10 g mL-1, and bacterium was 109, 108, 107, 106, 105, 104, 103, 102, 10, and 0 CFU mL-1, respectively. Isotonic saline solution replaced bacteria suspension was served as negative control.

Selectivity experiments toward dental pathogens. Three other dental bacterial samples including Fusobacterium nucleatum (F. nucleatum) ，

Porphyromonas

gingivalis (P. gingivalis) and Lactobacillus acidophilus （ L. acidophilus ） were used to study the selectivity of the proposed biosensors. 20 L diluted bacteria suspension at a final concentration of 109 CFU mL-1 was dispersed in microcentrifuge tubes and coincubated with three bioconjugates solutions (10 g mL-1) for 30 min at room temperature, respectively.

Application experiments with artificial saliva samples. We used sterile artificial saliva with a range of known amounts of S. mutans to mimic human saliva samples. The artificial saliva was used to replace saline in the preparation of bacterial samples, and S. mutans cells were resuspended in sterile artificial saliva after centrifuging. Next, we set three representative concentrations of S. mutans in this experiment, including high concentration (109 CFU mL-1), medium concentration (106 CFU mL-1), and low concentration (103 CFU mL-1), separately. In addition, same volume of saline



instead of the bacterial strain was used as negative control. Then we used them to be incubated with three bioconjugates above for 30 min at room temperature.

Colorimetric readout of the prepared samples. After adding appropriate concentration of TMB and H2O2, all the reactions were carried out at shaker with constant temperature (37°C, 140 rpm min-1) for 15 min in the dark. After centrifugation, 200 L of supernatant was transferred into a 96-well plate for analyzing the absorbance at 652 nm using a microplate reader (Bio-tek, USA). All the measurements were carried out at least three times.

RESULTS AND DISCUSSION DNA accelerated nanozyme activity. Since the pioneering report of the intrinsic peroxidase-like properties of Fe3O4 NPs,47 they provide a typical model for studying the interactions of nanozyme with living organisms. In this work, we chose Fe3O4 NPs with an average diameter of around 150 nm (Figure 1A) as an enzyme mimics for DNA interfacial engineering, which could catalyze the oxidation of the colorless substrate (e.g., TMB for 3,3’,5,5’-tetramethylbenzidine) to its corresponding blue color product in the presence of H2O2 (Figure 1B, C). DNA binding has been reported to alter the enzymatic properties of nanozymes, whereas the effects of assembly design on the activity of nanozymes has few been exploited. To make clear it, two DNA sequences mainly included S. mutans-binding


Page 8 of 31

Page 9 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


aptamer were appropriately designed as the probe strands. One design without any modification (Sm1, 5’- ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGG TGGGGGTCGGT-3’)48 was physically absorbed on the surface of Fe3O4 NPs through electrostatic interaction (Figure 1C), while the second design with similar length labeled with biotin (Sm2, 5’-Biotin- TTTATACTATCGCATTCCTTCCGAGGGGG GAGGGGGGGGTGGGGGTCGGT-3’) was attached via another popular approach of affinity coupling (Figure 1D). Indeed, we observed that both two interfaces engineered Fe3O4 NPs, named as Fe3O4/Sm1 and Fe3O4/Sm2 bioconjugate, respectively, revealed an obvious enhancement of the peroxidase-like activities than naked nanoparticles, in agreement with the previously reported results.49-51 More interestingly, we further found that Fe3O4/Sm2 bioconjugate resulted in a larger increase in optical enhancement than that of Fe3O4/Sm1 bioconjugate, indicating that DNA attachment through affinity coupling could improve the enzymatic properties more significantly than that through physisorption. DNAzyme with superior peroxidase-like properties have been widely used as a catalytic label and a signal-transducing element to build various biosensors.52 To further enhance the catalytic activity of Fe3O4 NPs, we developed the third design (Sm3), consisting of a split DNAzyme, a rigid duplex spacer, as well as an anti-S. mutans aptamer. As expected, UV-Vis spectrum of Sm3-functionalized Fe3O4 NPs (Fe3O4/Sm3 bioconjugate) exhibited an obvious larger peak than that of the former two DNA-treated surfaces at 652 nm (Figure 1E). The same trend was also reflected



by visual inspection of the optical change toward the oxidation of TMB (inset in Figure 1B-E). Analysis of the relative signal change demonstrated that the catalytic activity of nanozymes treated by three designs were respectively about 3-, 4- and 5-fold of that of naked ones, characteristic of modification method -dependent optical enhancement and synergistic effect of DNAzyme (Figure 1F).


Page 10 of 31

Page 11 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. DNA accelerated catalytic activity of Fe3O4 NPs. (A) SEM (Scanning electron microscope) (left) and TEM (Transmission electron microscope) (right) images of Fe3O4 NPs. (B) Schematic illustration and typical UV-Vis spectrum of the peroxidase-like activity of Fe3O4 NPs catalyzed by chromogenic substrate. (C-E) Schematics of DNA-engineered biointerfaces on Fe3O4 NPs and UV-Vis spectra of the peroxidase-like activity of Fe3O4/Sm1 bioconjugate (C), Fe3O4/Sm2 bioconjugate (D), and Fe3O4/Sm3 bioconjugate (E), respectively. (F) The relative signal change for the catalytic assays. Catalytic oxidation was carried out in HAc-NaAc buffer (0.2M, pH 4.0) using 10 g mL-1 Fe3O4 NPs. 0.4 mM TMB, and 10 mM H2O2 of Fe3O4/Sm1 bioconjugate; 0.6 mM TMB, and 5 mM H2O2 of Fe3O4/Sm2 bioconjugate; 1.0 mM TMB, and 15 mM H2O2 of Fe3O4/Sm3 bioconjugate. Error bars: standard error (n = 3).

Next, we examined the influence of the concentration of treated DNA on the catalytic enhancement in interfacial engineering. Clearly, the absorbance of all three-DNA treated nanozymes plotted as a function of DNA concentration in a certain range. The maximum absorbance was obtained at a moderate DNA concentration, and then decreased as the concentration increased. Moreover, it can be seen that the optimal concentration for three DNA designs in order were 0.4 M, 0.5 M, and 0.4 M, respectively (Figure 2A-C). Considering the close relationship of DNA concentration with the surface density, we further quantitatively determined the



surface density of DNA on the surface of Fe3O4 NPs via a fluorescence-based method40,

53, 54

at optimized conditions. After adding phosphate or biotin as

competitors, the bound FAM-labeled DNA was released under the external competition, and then the fluorescence recovered. Similar fluorescence intensity at 520 nm were obtained for both Fe3O4/Sm2 and Fe3O4/Sm3 bioconjugates (Figure 2E-F), which was more than 2 times stronger than for Fe3O4/Sm1 bioconjugate (Figure 2D). As listed in Figure 2G, the average surface density for three systems in order was 2.61 ± 0.20, 9.41 ± 0.60, and 8.59 ± 0.88 pm cm-2, respectively. This suggested that the non-specific binding of Sm1 through physical interactions was inclined to a flat conformation which led to a lower density, whereas self-assembling of Sm2 and Sm3 offered a physical spacer to reduce steric hindrance by end-grafting and brought a higher surface coverage. Similar to Fe3O4 NPs, the peroxidase-mimicking activities of all three bioconjugates were likewise in a pH-dependent manner. Since a low pH buffer solution could leach out iron ions from Fe3O4 nanoparticles, three bioconjugates were incubated in varying pH buffer solutions ranging from 4.0 to 8.0. Of note, the results illustrated that all three bioconjugates exhibited the most active catalysis at pH 4.0 (Figure S1). These catalytic activities were gradually declined when pH increased and almost completely disappeared as pH approached 8.0. Thus, we selected buffer solution with pH of 4.0 as the optimized experimental conditions.


Page 12 of 31

Page 13 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. (A-C) The relative activity of TMB-H2O2 solutions as functions of DNA concentrations for Fe3O4/Sm1 bioconjugate (A), Fe3O4/Sm2 bioconjugate (B), and Fe3O4/Sm3 bioconjugate (C). (D-F) Schematic illustrations of fluorescence-based method (left) and typical fluorescent spectra (right) of the proposed biointerfaces for



Fe3O4/Sm1 bioconjugate (D), Fe3O4/Sm2 bioconjugate (E), and Fe3O4/Sm3 bioconjugate (F), respectively. (G) DNA surface coverage density of three bioconjugates.

DNA Nanointerfaces for identifying targets. We next determined how various DNA nanointerfaces affected the nanozyme-bacteria interactions. S. mutans, a principal etiological agent of dental caries, was chosen as a typical model of identifying target bacterium. The colorimetric changes of catalytic behaviors for each nanosystem have been measured in the presence of S. mutans, which were all typical turn-off optical sensing designs. The UV-Vis spectra, the relative signal change, as well as the ratio of the absorbance of in the presence and in the absence of S. mutans, were defined to describe the signal suppression induced by the bacteria. We first interrogated the interaction of naked Fe3O4 NPs with S. mutans (System 0). As shown in Figure 3A-D, the absorbance signal was attenuated by different levels in the presence of S. mutans at a high concentration of 109 CFU mL-1 for all nanosystems. Likewise, it also produced an evident color change from dark blue into light blue through the colorimetric “readout”. To further compare the suppression effect, the absorbance change (A) at 625 nm in the absence and presence of bacteria were demonstrated in Figure 3E. For System 0, it exhibited a smallest variation among four nanosystems, with only less than half of the absorbance change. In sharp contrast, the interaction of Fe3O4/Sm2 bioconjugate with S. mutans (System 2) showed an increase


Page 14 of 31

Page 15 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of the absorbance change, and followed by Fe3O4/Sm1 bioconjugate with S. mutans (System 1). This evidence suggested the functionalization of DNA aptamer as molecular keys could remarkably improve the recognition capability of nanozyme and enhance the accessibility to target. Moreover, we reasoned that System 2 with a larger signal alteration was likely to be the binding of more bacteria on the surface of Fe3O4 NPs led to a greater degree of catalytic inhibition. Of particular note is Fe3O4/Sm3 bioconjugate that interacted with S. mutans (System 3) had the highest signal suppression toward TMB oxidation, up to 6.5 times compared with System 0. Likewise, an incremental suppression ratio was also observed after the addition of S. mutans for four nanosystems. For System 3, the synergistic signal enhancement might arise from the interface including an incorporation of split DNAzyme, a specific-binding aptamer, as well as a high coupling affinity of DNA molecules. More importantly, such a DNA interface could provide larger signal change range, which was very vital for a signal-off biosensor.



Figure 3. (A-D) DNA Nanointerfaces for identifying targets. The Schematic illustrations (Left), typical photographs (Middle) and UV-vis absorption spectra (Right) of catalytic reactions incubated with or without S. mutans of four bio-interfaces. The absorbance change (E) and the signal suppressions (F) of four


Page 16 of 31

Page 17 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


systems incubated with or without S. mutans. All the assay conditions were the chosen optimal conditions. Error bars: standard error (n = 3).

Rapid and direct detection of dental bacteria. The proposed effective DNA-bacteria interaction mechanisms based on DNA-functionalized biointerfaces allowed for detecting dental bacteria, which play a crucial part in the clinical diagnosis of oral diseases. To explore the practice application of three nanosystems, we developed a series of colorimetric biosensors for rapid and direct detection of S. mutans. In short, DNA interfaces recognized S. mutans with a range of concentrations from 0 to 109 CFU mL-1, followed by stepwise catalytic oxidation toward colorless substrate of each nanosystem, which produced a series of color change. The reaction could directly detect S. mutans within 15 min, not requiring any molecular extraction or bacteria culturing, which was simple and fast. All three biosensors exhibited a colorimetric signal response in a concentration-dependent manner, in which the absorbance little by little declined as the concentration of S. mutans increased. For System 1 and 2, the slope of calibration curves decreased at the concentrations less than 105 CFU mL-1, indicating a poor sensitivity at lower concentrations. Comparably, System 3 demonstrated significantly highest slope of the fit line than that of the former two systems, which might arise from the largest signal change within the same detection range. On the whole, we found that System 3 demonstrated the highest sensitivity with the detection limit of 12 CFU mL-1 evaluated by 3-time signal against



the target blank. Also, the assay solutions presented an evident color change from dark to pale blue with increasing concentration of bacteria (Inset in Figure 4B-D), and we could observe a detectible visual colorimetric change down to 104 CFU mL-1. To further investigate the selectivity of the proposed methods, other three significant dental pathogens in saliva, including L. acidophilus, P. gingivalis and F. nucleatum, were used to be evaluated. Figure 4E-G showed the signal change caused by other three bacteria at the same concentration of 109 CFU mL-1. It was found that System 3 exhibited the most excellent selectivity against other dental bacteria among three biosensors. We speculated that the disparity in selectivity for three systems was caused by DNA spatial structure modified on the surface. Two-dimensional (2D) recognition and binding platform in System 1&2 greatly increased the chance of nonspecific adsorption and entanglement between aggregated bacterial cells and DNA sequences, while System 3 commendably avoided it due to its spatial limitation of 3D G-quadruplex DNAzymes structure. Nevertheless, it still requires further study to explore the detailed mechanisms.


Page 18 of 31

Page 19 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Rapid and direct detection of dental bacteria. (A) Schematic illustration of the proposed colorimetric biosensors to detect S. mutans in 15 min. (B-D) Absorbance responses to a series of S. mutans based on three biosensors. The detection limits were 96, 41, and 12 CFU mL-1 respectively. (E-G) The absorbance changes of three biosensors for the detection of S. mutans, L. acidophilus, P. gingivalis, F. nucleatum



(109 CFU mL-1). All the assay conditions were the chosen optimal conditions. Error bars: standard error (n = 3).

To test the practice application of the biosensors, we studied the performances of three biosensors with artificial saliva samples. Several representative concentrations of S. mutans (high concentration: 109 CFU mL-1, medium concentration: 106 CFU mL-1, low concentration: 103 CFU mL-1) into the sterilized artificial saliva were chosen for analysis (Figure 5A). As shown in Figure 5B-D, the absorbance was monotonic decreased-response with good reproducibility when the concentration of bacteria increased for all three biosensors. Similar to the pervious results, the biosensor of System 3 displayed the best performance in the analysis of clinical samples. These results demonstrated the potential of our proposed biosensors for detecting S. mutans in saliva of clinical patients.


Page 20 of 31

Page 21 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Applications of three biosensors in artificial saliva samples. (A) Schematic illustration of the procedure of detection of S. mutans (109, 106, 103, and 0 CFU mL-1) with artificial saliva samples. (B-D) The absorbance responses in artificial saliva of three biosensors (isotonic saline solution replaced bacteria suspension was served as negative control). All the assay conditions were the chosen optimal conditions. Error bars: standard error (n = 3).

CONCLUSION In summary, we have engineered three functional nanoscale DNA biointerfaces on Fe3O4 NPs, allowing for regulation of catalytic activities of nanozymes, enhancement of DNA-bacteria interaction, as well as rapid and direct detection of dental bacteria. The utilization of three DNA designs and different immobilizing approaches to improve the peroxidase-like behaviors of Fe3O4 NPs provided an effective way to build bioinspired nanozymes. Also, it revealed that three DNA-functionalized nanosystems demonstrated excellent identification capability, which enabled simple and optical detection of dental bacteria by visual inspection. Of particular note, the third designed system through affinity-coupling and incorporated of DNAzyme displayed the highest sensitivity and the most excellent specificity among three nanosystems. Indeed, such a nanosystem possessed several inherent strengths. First, the catalytic activity was about 5-fold greater than that of naked nanozymes with synergistic signal enhancement, resulting from a higher DNA coverage and the



incorporation of split DNAzyme. Next, this system with a largest signal suppression ratio could precisely identify bacteria for ultrasensitive analysis. It might be ascribed to that the function of DNA aptamer as molecular recognition elements and adhesive substance of target, causing the inhibition of enzymatic activity by bacteria. Then, the detected procedure performed within 15 min, not requiring several hours’ molecular extraction or several days’ conventional culturing, which was simple and fast. Also, it was better than or comparable to that other previously reported bacterial biosensors (Table S2). Finally, the biosensor demonstrated a broad prospect in clinical prevention and diagnosis of dental diseases, which might open new possibilities for creating a platform in future clinical chair-by caries screening.

ASSOCIATED CONTENT

Supporting Information. This material is available free of charge on the ACS Publications website. Materials; DNA sequences used in the experiments (Table S1); Preparation of bacterial samples; Preparation of Fe3O4/Sm1 bioconjugate; Preparation of Fe3O4/Sm2 bioconjugate; Preparation of Fe3O4/Sm3 bioconjugate, Optimization of pH (Figure S1); Comparison of different nanomaterial-based bacterial sensors (Table S2)

AUTHOR INFORMATION Corresponding Author


Page 22 of 31

Page 23 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


*E-mail addresses: [email protected] (N. Lu), [email protected] (Z. Tang).

Author Contributions

▲L.Z.

and Z.Q. contributed equally.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was financially supported by the National Natural Science Foundation of China (81870749)，the National Key Research and Development Program of China (2017YFC0840100, 2017YFC0840110, 2016YFA0201200, 2016YFA0400900), the Open Large Infrastructure Research of Chinese Academy of Sciences, the LU Jiaxi International Team of the Chinese Academy of Sciences, the Shanghai Municipal Natural Science Foundation (17ZR1412100), and the Talent Program of Shanghai University of Engineering Science.

REFERENCES 1. Mehmet, S.; Candan, T.; Alex, K.; Klaus, S.; Francois, B. Molecular BiomimeticsNanotechnology through Biology. Nat. Mater. 2003, 2, 577-585.



2. Chen, F.; Bai, M.; Cao, K.; Zhao, Y.; Cao, X.; Wei, J.; Wu, N.; Li, J.; Wang, L.; Fan, C.; Zhao, Y. Programming Enzyme-Initiated Autonomous DNAzyme Nanodevices in Living Cells. ACS Nano 2017, 11 (12), 11908-11914. 3.

Chen, F.; Bai, M.; Cao, K.; Zhao, Y.; Wei, J.; Zhao, Y. Fabricating MnO2

Nanozymes as Intracellular Catalytic DNA Circuit Generators for Versatile Imaging of Base-Excision Repair in Living Cells. Adv. Funct. Mater. 2017, 27 (45),1702748. 4.

He, J.; Zhu, X.; Qi, Z.; Wang, C.; Mao, X.; Zhu, C.; He, Z.; Li, M.; Tang, Z.

Killing Dental Pathogens Using Antibacterial Graphene Oxide. ACS Appl. Mater. Inter. 2015, 7 (9), 5605-5611. 5.

Wang, T.; He, J.; Duan, D.; Jiang, B.; Wang, P.; Fan, K.; Liang, M.; Yan, X.

Bioengineered Magnetoferritin Nanozymes for Pathological Identification of High-Risk and Ruptured Atherosclerotic Plaques in Humans. Nano Res. 2019, 12 (4), 863-868. 6.

Lin, Y.; Ren, J.; Qu, X. Catalytically Active Nanomaterials: A Promising

Candidate for Artificial Enzymes. Acc. Chem. Res. 2014, 47 (4), 1097-1105. 7.

Zhang, M.; Chen, L.; Zheng, J.; Li, W.; Hayat, T.; Alharbi, N.; Gan, W.; Xu, J.

The Fabrication and Application of Magnetite Coated N-Doped Carbon Microtubes Hybrid Nanomaterials with Sandwich Structures. Dalton Trans. 2017, 46 (28), 9172-9179.


Page 24 of 31

Page 25 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8.

Wei,

H.;

Wang,

E.

Nanomaterials

with

Enzyme-Like

Characteristics

(Nanozymes): Next-Generation Artificial Enzymes. Chem. Soc. Rev. 2013, 42 (14), 6060-6093. 9.

Huang, Y.; Ren, J.; Qu, X. Nanozymes: Classification, Catalytic Mechanisms,

Activity Regulation, and Applications. Chem. Rev. 2019, 119 (6), 4357-4412. 10. Wang, X.; Hu, Y.; Wei, H. Nanozymes in Bionanotechnology: from Sensing to Therapeutics and Beyond. Inorg. Chem. Front. 2016, 3 (1), 41-60. 11. Zhang, Z.; Li, Y.; Zhang, X.; Liu, J. Molecularly Imprinted Nanozymes with Faster Catalytic Activity and Better Specificity. Nanoscale 2019, 11 (11), 4854-4863. 12. Li, J.; Song, S.; Liu, X.; Wang, L.; Pan, D., Huang, Q.; Zhao, Y.; Fan, C. Enzyme-Based MultiComponent Optical Nanoprobes for Sequence Specific Detection of DNA Hybridization. Adv. Mater. 2008, 20 (3), 497-500. 13. Zhang, M.; Zheng, J.; Wang, J.; Xu, J.; Hayat, T.; Alharbi, N. Direct Electrochemistry of Cytochrome c Immobilized on One Dimensional Au Nanoparticles Functionalized Magnetic N-Doped Carbon Nanotubes and its Application for the Detection of H2O2. Sens. Actuators B-Chem. 2019, 282, 85-95. 14. Yang, F.; Zuo, X.; Li, Z.; Deng, W.; Shi, J.; Zhang, G.; Huang, Q.; Song, S.; Fan, C. A Bubble-Mediated Intelligent Microscale Electrochemical Device for Single-Step Quantitative Bioassays. Adv. Mater. 2014, 26 (27), 4671-4676. 15. Van, S; Vucic, E.; Koole, R.; Zhou, Y.; Stocks, J.; Cormode, D.; Tang, C.; Gordon, R.; Nicolay, K.; Meijerink, A.; Fayad, Z.; Mulder, W. Improved



Biocompatibility and Pharmacokinetics of Silica Nanoparticles by Means of a Lipid Coating: a Multimodality Investigation. Nano Lett. 2008, 8 (8), 2517-2525. 16. Yan, Y.; Shi, X.; Miao, M.; He, T.; Dong, Z.; Zhan, K.; Yang, J.; Zhao, B.; Xia, B. Bio-Inspired Design of Hierarchical FeP Nanostructure Arrays for the Hydrogen Evolution Reaction. Nano Res. 2018, 11 (7), 3537-3547. 17. Zhang, Y.; Zhang, M.; Yang, J.; Ding, L.; Zheng, J.; Xu, J.; Xiong, S. Formation of Fe3O4@SiO2@C/Ni Hybrids with Enhanced Catalytic Activity and Histidine-Rich Protein Separation. Nanoscale 2016, 8 (35), 15978-15988. 18. Wang, J.; Zhang, M.; Xu, J.; Zheng, J.; Hayat, T.; Alharbi, N. Formation of Fe3O4@C/Ni Microtubes for Efficient Catalysis and Protein Adsorption. Dalton Trans. 2018, 47 (8), 2791-2798. 19. Mumtaz, S.; Wang, L.; Hussain, S.; Abdullah, M.; Huma, Z.; Iqbal, Z.; Creran, B.; Rotello, V.; Hussain, I. Dopamine Coated Fe3O4 Nanoparticles as Enzyme Mimics for the Sensitive Detection of Bacteria. Chem. Commun. 2017, 53 (91), 12306-12308. 20. Wang, S.; Deng, W.; Yang, L.; Tan, Y.; Xie, Q.; Yao, S. Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureus. ACS Appl. Mater. Interfaces. 2017, 9 (29), 24440-24445. 21. Lu, N.; Zhang, M.; Ding, L.; Zheng, J.; Zeng, C.; Wen, Y.; Liu, G.; Aldalbahi, A.; Shi, J.; Song, S.; Zuo, X.; Wang, L. Yolk-Shell Nanostructured Fe3O4@C Magnetic


Page 26 of 31

Page 27 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Nanoparticles with Enhanced Peroxidase-Like Activity for Label-Free Colorimetric Detection of H2O2 and Glucose. Nanoscale 2017, 9 (13), 4508-4515. 22. Cormode, D.; Sanchez-Gaytan, B.; Mieszawska, A.; Fayad, Z.; Mulder, W. Inorganic Nanocrystals as Contrast Agents in MRI: Synthesis, Coating and Introduction of Multifunctionality. NMR biomed. 2013, 26 (7), 766-780. 23. Tian, F.; Chen, G.; Yi, P.; Zhang, J.; Li, A.; Zhang, J.; Zheng, L.; Deng, Z.; Shi, Q.; Peng, R.; Wang, Q. Fates of Fe3O4 and Fe3O4@SiO2 Nanoparticles in Human Mesenchymal Stem Cells Assessed by Synchrotron Radiation-Based Techniques. Biomaterials 2014, 35 (24), 6412-6421. 24. Zhao, H.; Liu, S.; He, J.; Pan, C.; Li, H.; Zhou, Z.; Ding, Y.; Huo, D.; Hu, Y. Synthesis and Application of Strawberry-Like Fe3O4-Au Nanoparticles as CT-MR Dual-Modality Contrast Agents in Accurate Detection of the Progressive Liver Disease. Biomaterials 2015, 51, 194-207. 25. Arami, H.; Khandhar, A.; Liggitt, D.; Krishnan, K. In vivo Delivery, Pharmacokinetics, Biodistribution and Toxicity of Iron Oxide Nanoparticles. Chem. Soc. Rev. 2015, 44 (23), 8576-8607. 26. Nguyen,

T.;

Pitchaimani,

A.;

Ferrel,

C.;

Thakkar,

R.;

Aryal,

S.

Nano-Confinement-Driven Enhanced Magnetic Relaxivity of SPIONs for Targeted Tumor Bioimaging. Nanoscale 2017, 10 (1), 284-294.



27. Kang, T.; Li, F.; Baik, S.; Shao, W.; Ling, D.; Hyeon, T. Surface Design of Magnetic Nanoparticles for Stimuli-Responsive Cancer Imaging and Therapy. Biomaterials 2017, 136, 98-114. 28. Fan, C.; Pei, H. Special Issue of “DNA Nanotechnology”. Chin. J. Chem. 2016, 34, 251. 29. Yao, G.; Li, J.; Chao, J.; Pei, H.; Liu, H.; Zhao, Y.; Shi, J.; Huang, Q.; Wang, L.; Huang, W.; Fan, C. Gold-Nanoparticle-Mediated Jigsaw-Puzzle-Like Assembly of Supersized Plasmonic DNA Origami. Angew. Chem.-Int. Edit. 2015, 54 (10), 2966-2969. 30. Chen, F.; Bai, M.; Cao, K.; Zhao, Y.; Wei, J.; Zhao, Y. Fabricating MnO2 Nanozymes as Intracellular Catalytic DNA Circuit Generators for Versatile Imaging of Base-Excision Repair in Living Cells. Adv. Funct. Mater. 2017, 27 (45),1702748. 31. Jin, D.; Yang, F.; Zhang, Y.; Liu, L.; Zhou, Y.; Wang, F.; Zhang, G. ExoAPP: Exosome-Oriented, Aptamer Nanoprobe-Enabled Surface Proteins Profiling and Detection. Anal. Chem. 2018, 90 (24), 14402-14411. 32. Whitchurch, C.; Tolker, N; Ragas, P.; Mattick, J. Extracellular DNA Required for Bacterial Biofilm Formation. Science 2002, 295 (5559), 1487. 33. Flemming, H.; Wingender, J. The Biofilm Matrix. Nat. Rev. Microbiol. 2010, 8, 623.


Page 28 of 31

Page 29 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


34. Zhou, P.; Jia, S.; Pan, D.; Wang, L.; Gao, J.; Lu, J.; Shi, J.; Tang, Z.; Liu, H. Reversible Regulation of Catalytic Activity of Gold Nanoparticles with DNA Nanomachines. Sci. Rep. 2015, 5, 14402. 35. Chou, L.; Song, F.; Chan, W. Engineering the Structure and Properties of DNA-Nanoparticle Superstructures Using Polyvalent Counterions. J. Am. Chem. Soc. 2016, 138 (13), 4565-4572. 36. Yang, F.; Zuo, X.; Fan, C.; Zhang, X. Biomacromolecular Nanostructures-Based Interfacial Engineering: From Precise Assembly to Precision Biosensing. Nati. Sci. Rev. 2018, 5 (5), 740-755. 37. Liu, B.; Liu, J. Surface Modification of Nanozymes. Nano Res. 2017, 10 (4), 1125-1148. 38. Ye, D.; Zuo, X.; Fan C. DNA Nanotechnology-Enabled Interfacial Engineering for Biosensor Development. Annu. Rev. Anal. Chem. 2018, 11(1), 171-195. 39. Wang, Y.; Liu, J.; Adkins, G.; Shen, W.; Trinh, M.; Duan, L.; Jiang, J.; Zhong, W. Enhancement of the Intrinsic Peroxidase-Like Activity of Graphitic Carbon Nitride Nanosheets by ssDNAs and Its Application for Detection of Exosomes. Anal. Chem. 2017, 89 (22), 12327-12333. 40. Zhan, P.; Wang, Z.; Li, N.; Ding, B. Engineering Gold Nanoparticles with DNA Ligands for Selective Catalytic Oxidation of Chiral Substrates. ACS Catal. 2015, 5 (3), 1489-1498.



41. Tjong, V.; Tang, L.; Zauscher, S.; Chilkoti, A. "Smart" DNA Interfaces. Chem. Soc. Rev. 2014, 43 (5), 1612-1626. 42. Pei, H.; Liang, L.; Yao, G.; Li, J.; Huang, Q.; Fan, C. Reconfigurable Three-Dimensional DNA Nanostructures for the Construction of Intracellular Logic Sensors. Angew. Chem.-Int. Edit. 2012, 51 (36), 9020-9024. 43. Robert, H.; Amid, I.; Nigel, B. Dental Caries. Lancet 2007, 369 (9555), 51-59. 44. Takahashi, N.; Nyvad, B. The Role of Bacteria in the Caries Process: Ecological Perspectives. J. Dent. Res. 2011, 90 (3), 294-303. 45. Phillip, B.; William, B.; Dean, H.; James, R.; Paul, S.; Raymond, M.; Fred, M. PCR Detection of Bacteria in Seven Minutes. Science 1999, 284, 449-450. 46. Loesche, W.; Lopatin, D.; Stoll, J.; Van, P.; Hujoel, P. Comparison of Various Detection Methods for Periodontopathic Bacteria: Can Culture be Considered the Primary Reference Standard? J. Clin. Microbiol. 1992, 30 (2), 418-426. 47. Gao, L.; Zhuang, J.; Nie, L.; Zhang, J.; Zhang, Y.; Gu, N.; Wang, T.; Feng, J.; Yang, D.; Perrett, S.; Yan, X. Intrinsic Peroxidase-Like Activity of Ferromagnetic Nanoparticles. Nat. Nanotechnol. 2007, 2 (9), 577-583. 48. Savory, N.; Takahashi, Y.; Tsukakoshi, K.; Hasegawa, H.; Takase, M.; Abe, K.; Yoshida, W.; Ferri, S.; Kumazawa, S.; Sode, K.; Ikebukuro, K. Simultaneous Improvement of Specificity and Affinity of Aptamers against Streptococcus mutans by in silico Maturation for Biosensor Development. Biotechnol. Bioeng. 2014, 111 (3), 454-461.


Page 30 of 31

Page 31 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


49. Liu, B.; Liu, J. Accelerating Peroxidase Mimicking Nanozymes Using DNA. Nanoscale 2015, 7 (33), 13831-13835. 50. Zeng, C.; Lu, N.; Wen, Y.; Liu, G.; Zhang, R.; Zhang, J.; Wang, F.; Liu, X.; Li, Q.; Tang, Z.; Zhang, M. Engineering Nanozymes Using DNA for Catalytic Regulation. ACS Appl. Mater. Interfaces. 2019, 11 (2), 1790-1799. 51. Tan, B.; Zhao, H.; Wu, W.; Liu, X.; Zhang, Y.; Quan, X. Fe3O4-AuNPs Anchored 2D Metal-Organic Framework Nanosheets with DNA Regulated Switchable Peroxidase-Like Activity. Nanoscale 2017, 9 (47), 18699-18710. 52. Lu, N.; Shao, C.; Deng, Z. Rational Design of an Optical Adenosine Sensor by Conjugating a DNA Aptamer with Split DNAzyme Halves. Chem. Commun. 2008, (46), 6161-6163. 53. Demers, L.; Mirkin, C.; Mucic, R.; Reynolds, R.; Letsinger, R.; Elghanian, R.; Viswanadham, G. A Fluorescence-Based Method for Determining the Surface Coverage and Hybridization Efficiency of Thiol-Capped Oligonucleotides Bound to Gold Thin Films and Nanoparticles. Anal. Chem. 2000, 72 (22), 5535-5541. 54. Liu, B.; Huang, Z.; Liu, J. Polyvalent Spherical Nucleic Acids for Universal Display of Functional DNA with Ultrahigh Stability. Angew. Chem.-Int. Edit. 2018, 57 (30), 9439-9442.



Table of contents (TOC)


Page 32 of 31

Engineering DNAâNanozyme Interfaces for Rapid Detection of Dental

Recommend Documents

Engineering DNAâNanozyme Interfaces for Rapid Detection of Dental