Enhanced efficiency of an enzyme cascade on DNA-activated silica

Subscriber access provided by University of South Dakota

Interfaces: Adsorption, Reactions, Films, Forces, Measurement Techniques, Charge Transfer, Electrochemistry, Electrocatalysis, Energy Production and Storage

Enhanced efficiency of an enzyme cascade on DNA-activated silica-surfaces Kilian Vogele, Jonathan List, Friedrich C Simmel, and Tobias Pirzer Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b01770 • Publication Date (Web): 21 Nov 2018 Downloaded from http://pubs.acs.org on November 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Enhanced efficiency of an enzyme cascade on DNAactivated silica-surfaces Kilian Vogele†, Jonathan List†, Friedrich C. Simmel†⊥, Tobias Pirzer†* AUTHOR ADDRESS †

Physics of Synthetic Biological Systems - E14, Physics-Department and ZNN, Technische Universität München, 85748 Garching, Germany

⊥

Nanosystems Initiative Munich, 80539 Munich, Germany

KEYWORDS: enzyme cascade, silica surface, DNA nanotechnology, chemiluminescence, enzyme activity

In nature, compartmentalized and spatially organized enzyme cascades are utilized to increase the efficiency of enzymatic reactions. From a technologically relevant perspective, synthetic enzyme systems have to be optimized with emphasis on enzyme activity, productivity, scalability, and ease of use. But the underlying principles and relevant parameters that lead to an enhancement of the activity of enzyme cascades through spatial organization are still under debate. Here, we report on the 10-fold activity enhancement of the GOx-HRP enzyme cascade for the oxidation of luminol, when the enzymes are co-localized on micron-scaled solid scaffolds. Both enzymes were initially assembled and concentrated on DNA origami rectangles and finally further concentrated on the surface of silica particles. We show that each particular component of the designed system

ACS Paragon Plus Environment

1

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 24

contributes to the activity enhancement. Furthermore, we measured an influence of the silica particle length scale on the total productivity by a factor of 5-10, but to a lesser extent on the maximum enzyme activity. Our findings demonstrate that micrometer-sized scaffolds can be used to enhance the efficiency of enzyme-cascades by at least a magnitude and that solid-phase scaffolds enable scalability for technological applications. INTRODUCTION In living organisms, compartmentalization and co-localization of reactants are utilized to control the yield and specificity of biochemical reactions.1-4 Enclosed compartments are used to separate competing processes, whereas activity is regulated by compartmentalization, concentration and spatial organization of the involved enzymes. In general, a higher local concentration increases the reaction rates, whereas the specific arrangement of the enzymes only plays a role when a reaction is diffusion-limited.5-6 For reactants with small diffusion coefficients this is important in close proximity, whereas for small molecules with large diffusion coefficients dimensionality and different length scales can be used to manipulate biochemical processes.7-8 An intriguing mechanism found to play a role in some multi-enzyme complexes is substrate channeling. Transferring substrates or intermediary products locally from one reactant to another not only enhances the activity, but it also prevents in some degree losses and competing reactions.9-13 In recent years, nucleic acids have been used as a scaffolding material to precisely co-localize and arrange molecular reactions. Several groups used DNA to spatially organize enzymes, most prominently the GOx-HRP system, and reported activity enhancements.8,

14-16

However, the

measured enhancement factors varied considerably and seemed to be dependent on the specific design of the systems. For instance, placing a GOx-HRP dimer on a DNA origami structure within


2

Page 3 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

close proximity reportedly increased their activity,14 but using a zero-length linker to dimerize the two enzymes did not affect their activity.16 Hess and coworkers have shown that proximity plays a role in the first milliseconds, but for larger time scales the enzyme activity is reaction-limited and proximity less important. Since the activity of GOx and HRP is pH-dependent, they suggested the local pH, which is reduced in the vicinity of DNA, as the possible origin for the measured enhancements.16-17 On the other hand, concentrating GOx and HRP on a scaffold structure increased the overall activity in simulations and experiments, whereas the dimensionality only had a small effect.8 Aside from mechanistic considerations, from a (bio-)technological point of view it is important to choose the ideal environmental conditions to increase the productivity of enzyme systems, to ensure uncomplicated handling and scalability for high turnover. For the model system GOx-HRP a mildly acidic pH would be the best choice. However, this cannot be generalized to all enzyme systems and the choice of environmental conditions might be restricted by experimental constraints. Therefore, simple accumulation and co-localization of enzymes represents a more generally applicable strategy to enhance the activity of enzymatic reaction systems.18 This can be implemented through the localization of these enzymes on more extended scaffold structures in the micrometer range or even larger. Here we show that the activity of the model enzyme cascade GOx-HRP can be increased when they are concentrated on the surface of micrometer-sized solid particles, which is effectively mediated by DNA origami supports.19 To this end, GOx and HRP were initially immobilized by specific attachment on DNA origami rectangles at a high density. In the following step, the DNA structures were physically adsorbed on the surface of various silica materials, namely silica microspheres, silica microparticles and glass fibers. Figure 1 illustrates the fabrication principle


3

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 24

Figure 1. Illustration of the co-localization steps. Glucose oxidase (GOx) oxidizes glucose and produces H2O2, which is used by horseradish peroxidase (HRP) to oxidize luminol whereby chemiluminescence (CL) appears. Its intensity is direct proportional to its activity. GOx and HRP are attached to a rectangular DNA structure and the CL increases by a factor of 2.1. Upon adsorption of the DNA structures onto silica particles the CL is 5- to 10fold increased depending on the silica particle and the local enzyme concentration.

of these enzymatically activated silica particles. The activity of the cascade was determined through the chemiluminescence (CL) generated when luminol is oxidized by HRP.20-24 The necessary H2O2 was produced by GOx through the oxidation of glucose. Simple co-localization on the DNA origami structures resulted only in a small enhancement. By contrast, subsequent adsorption onto the silica particles resulted in an enhanced CL of up to 10-fold with respect to the free enzymes in bulk solution.


4

Page 5 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

EXPERIMENTAL SECTION Conjugation of DNA to GOx and HRP. Initially, the N-terminus and the lysine residues of the proteins were activated with azide groups. The used NHS-azide-linker (y-azidobutyric acid oxysuccinimide ester) was dissolved in DMSO to a final concentration of 20 mM and the proteins were dissolved in 1x PBS (8 g/L NaCl, 2 g/L KCl, 1.42 g/L Na2HPO4, 0.27 g/L K2PO4, pH 6.8 7.0). The proteins were mixed with a 10-fold excess of linker per available amine group and incubated for 8 h at room temperature. To remove residual NHS-azide linker we used 100 kDa MWCO centrifuge filters (Amicon Ultra, Milipore) for GOx and 30 kDa MWCO centrifuge filters for HRP. The purification using these filters was repeated two times. The coupling of the proteins to their specific DNA linker was carried out by copper-catalyzed azide-alkyne Huisgen cycloaddition (further denoted as 'click-chemistry'). Alkyne-modified linkers were mixed with the proteins to obtain an equimolar ratio of alkyne DNA and azide groups on the proteins; the sequence for GOx is TATGTAGATAATAGATGTATAACT with an alkyne group attached at the 5' end and the sequence for HRP is CCTCGCTCTGCTAATCCTGTTAAA with an alkyne group attached at the 5' end. Afterwards we added 1 mM TBTA (Tris(benzyltriazolylmethyl)amine), 10 mM TCEP (Tris(2-carboxyethyl)phosphine hydrochloride) and 10 mM CuSO4; all concentrations are given as final concentrations. The mixture was incubated at 4 °C for 8 h. Residual linker strands were removed using the aforementioned centrifugal filters, whereby the purification step was repeated five times. Success of the conjugation reaction was controlled by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with Roti®-blue staining (see Figure S4). Assembly of DNA origami rectangles. The twist-corrected rectangular origami structure was self-assembled from about 200 short staple strands and a 7,249 nucleotides (nt) long single-


5

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 24

stranded scaffold strand from phage M13mp18.25 We used a three-fold excess of standard staples and a 5-fold excess of extended staples to implement the desired binding sites (bs) (see SI section S3). The structure was folded in so-called folding buffer (FB), which consisted of 1x TAE (40 mM Tris, 20 mM Acetate, 1 mM EDTA) with 12.5 mM MgCl2. During folding an initial temperature of 70 °C was used; the following temperature ramp was from 65 °C to 40 °C for about 1 h with a final temperature jump to 20 °C. For sample purification, we used PEG precipitation.26 We mixed the sample with 15% PEG-8000 dissolved in FB with 100 mM NaCl (further denoted as PEG solution) in a 1:1 (v/v) ratio followed by centrifugation at 16,000 rcf for 25 min. After discarding the supernatant, the pellet was redissolved in FB and mixed with the PEG solution at a final ratio of 1:1 (v/v). This step was repeated three times. After the last purification step the pellet was only redissolved in 1x FB. For concentration measurement, we used absorption spectrometry (Nanophotometer IMPLEN vers. 7122 V2.3.1, Munich, Germany) with an extinction coefficient of 1.12 x 108 cm-1mol-1 and adjusted the concentration of the solution to 100 nM. Enzymatic activation of silica particles surfaces. For activation, we adjusted a protocol for electrostatic binding of DNA nanostructures to silica surfaces previously developed in our group.27 Initially, the silica particles (1% w/v) were suspended in 1x TAE buffer with additional 32 mM MgCl2. Afterwards the DNA origami structures were added to the silica suspension to reach a final concentration of 0.1 nM DNA structures. These DNA origami structures are equipped with staple strands augmented with the complementary sequence of the proteins' DNA linker (see SI section S3). After an incubation time of 5 min where the sample was gently shaken, DNA-functionalized GOx and HRP were mixed with the DNA-silica suspension at a final concentration of 1 nM of each protein and again gently shaken for 2 min. The resulting suspension was not further purified for the chemiluminescence experiments. To determine the binding yields of the proteins the DNA


6

Page 7 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

origami structures were eluted from the silica particles. This step was carried out by adding 1x TAE with 100 mM NaCl followed by a centrifugation at 20 000 rcf for 3 min to separate the silica particles and solution with the enzyme-functionalized DNA origami structures. The final salt concentration of the supernatant was set to 32 mM MgCl2. Protocols to increase the protein density on silica. The concentration of proteins on the surface of the glass fibers was increased through a dipping protocol. We incubated the glass fibers several times in fresh enzyme solutions each containing 4 nM of DNA-functionalized GOx and HRP. Altogether we used four incubation steps with incubation times of 15 min. Due to their macroscopic size the glass fibers could be easily transferred from solution to solution using tweezers. For further enrichment of proteins on silica microparticles the aforementioned attachment protocol of GOx and HRP to the DNA origami structures was altered.28 After the functionalization of GOx and HRP with their specific DNA linker, a solution containing 2 nM of each protein was mixed with a 0.1 nM DNA rectangle solution. After gentle mixing a temperature ramp for 10 min from 37 °C to 20 °C was applied. Afterwards the solution was mixed with a silica suspension as described before. Atomic Force Microscopy. For AFM imaging, we used the AC mode of the Cypher ESTM Environmental AFM (Asylum Research, Santa Barbara, USA), Asylum Research's blueDriveTM for photothermal excitation of the cantilever and AR software version 13.06.82 implemented in IGOR Pro 6.34A. The utilized silicon cantilever (Olympus micro-cantilevers BL-AC40TS-C2) had a nominal force constant of 0.09 N/m and a notational resonance frequency in water of 25 kHz. The used scan rates were between 1 and 4 Hz. Image processing was carried out using the


7

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 24

aforementioned software and the plugin Scale Bar Tools for Microscopes for Java-based software ImageJ. Imaging was carried out by depositing a sample volume of 5 µl with 5 nM DNA structures onto freshly cleaved muscovite mica (Plano GmbH, Wetzlar, Germany) followed by the addition of 60 µl of FB. Light microscopy. For brightfield microscopy an inverted fluorescence microscope (Olympus IX71) with a 20x objective (Olympus UIS2 20× UPlanSApo) was used and the samples were placed on a cleaned glass slide. The glass slide were cleaned by rinsing them with water and subsequently rinsing them with ethanol and dry them with nitrogen gas. For fluorescence experiments, an MG filter cube (Extinction 605-648 nm/Emission 692/40 -∞) was utilized. Images were recorded with an EM-CCD (Andor LucaR (DL-604 M-#VP)) and processing was carried out using the plugin Scale Bar Tools for Microscopes for Java-based software ImageJ. Chemiluminescence spectroscopy. The chemiluminescence intensity was measured using the FLUOstar Omega plate reader from MBG Labtech (Offenburg, Germany). The samples (aqueous solutions and silica suspensions) were prepared in a well plate and were allowed to sediment. During the measurement the well plate was gently shaken.

RESULTS AND DISCUSSION The enzymatic activation of the silica surfaces was carried out using a twist-corrected rectangular DNA origami structure25 equipped with orthogonal binding sites (bs) for GOx and HRP. Initially, the lysine side chains of both enzymes were functionalized with azide residues followed by the attachment of specific alkyne-DNA linkers using copper- catalyzed azide-alkyne Huisgen cycloaddition (see Experimental Section and SI section S1). Control measurements in


8

Page 9 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

bulk showed that the CL intensity is positively affected by the functionalization of the enzymes with the linker DNA. With respect to the non-functionalized enzymes the CL already increased by a factor of aL≈1.3 (see SI Figure S5). A rationale for this effect is a lower pH at the enzymes due to the attached DNA strands as already stated by Hess and coworkers16-17 for DNA origami structures. These DNA-functionalized enzymes were attached to the DNA rectangle using a procedure developed in our group,27 where initially the DNA rectangles are adsorbed onto the silica surfaces and then incubated with the enzymes for their attachment. For a stable adsorption of the DNA origami structures on silica, the MgCl2 concentration was set to 32 mM. To test its influence on the enzyme activity we assayed the oxidation of ABTS2- through absorption spectroscopy for various MgCl2 concentrations and with 1 nM of each enzyme, 1x TAE, 2 mM ABTS2- (including TE) and 2 mM glucose. In the relevant range between 5 mM and 70 mM MgCl2 the activity of free GOx and HRP functionalized with DNA linkers was reduced to ≈ 64% of its original activity (see Figure S1). Unless otherwise mentioned the experimental standard buffer conditions were 1x TAE, 32 mM MgCl2 at room temperature, 2 mM luminol (including TE and KCl) and 2 mM glucose. For further experiments we used a standard enzyme reference (SER) containing 1 nM GOx and 1 nM HRP each functionalized with DNA-linkers and dissolved in the aforementioned standard buffer. To avoid systematic errors, we used the same enzyme batches and measured the CL in parallel. In order to examine the effect of co-localization of GOx and HRP on DNA structures, rectangles with 1, 6 and 17 bs for each enzyme were designed. Using the standard conditions, we found that for an enzyme dimer with GOx and HRP at a distance of about 10 nm on the rectangle (1 nM)


9

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 24

the enhancement factor is a1bs ≈ 1.5 with respect to the SER. For 6 bs and 17 bs only a minor increase to a6bs ≈ a17bs ≈ 1.6 was measured. This little effect could emerge from the measured binding yields of GOx and HRP to the DNA origami rectangle. From AFM measurements, the yield was determined to be ≈ 31% for GOx and ≈ 68% for HRP (see SI section S1) and could originate from a moderate yield for the functionalization of the enzymes with their specific DNA linkers. Additionally, the dense packing of enzymes on the rectangle could also be influenced by steric hindrance during the binding process. However, we can still deduce that localization on a DNA structure increases the activity, which is in agreement with recent literature8, 14-17 regardless of the underlying process. Interestingly, the activity could not be further increased by localizing a larger number of enzymes on the DNA structures. This suggests that a potential substrate channeling between the enzymes on the origami platform is negligible for our experiments. With respect to the free enzymes in solution (with no DNA modification), the measured CL enhancements of aL ≈ 1.5 (due to the DNA linker) and a17bs ≈ 1.6 (due to the co-localization and concentration on the origami structures) correspond to an effective enhancement by a factor of aori = aL × a17bs ≈ 2.1. To further increase the CL, we introduced a second level of spatial organization on a much larger length scale and localized the DNA rectangles equipped with GOx and HRP on the surface of various silica particles. The rectangles were prepared with 17 bs for each enzyme and the rectangle concentration was 0.1 nM in each experiment. In a previous study, we have shown that almost 100% of the DNA rectangles adsorb onto the surface of silica particles.27 As particles, we used silica microspheres (about 100 µm in diameter), highly polydisperse silica microparticles (roughly 0.8 µm to 8 µm in diameter) and glass fibers (15 µm in diameter and roughly 5 mm in


10

Page 11 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Figure 2. Chemiluminescence on silica particles. Left: Bright field microscopy images of silica particles, namely a) silica microspheres, b) polydisperse silica microparticles and c) glass fibers, equipped with DNA rectangles carrying GOx and HRP. Right: Microscopy image without light source showing chemiluminescence after the addition of glucose. Initially, the samples were visualized without glucose in the measurement chamber. After the addition of glucose chemiluminescence started. Due to the size of the chamber the solution couldn't properly mixed. Scale bars: 100 µm.

length). The DNA rectangles nearly completely adsorb onto the glass fibers (see Figure S3) and for the microparticles, we showed in a previous study that also almost all of the DNA rectangles adsorb.27 Upon the addition of glucose, these enzymatically activated silica particles showed CL, which was visualized using light microscopy (Figure 2). For quantification, we measured the CL intensity of the glass fibers and the silica microparticles in a fluorescent plate reader in top view. Glucose and luminol were mixed with the silica samples which were allowed to sediment before the start of the measurement. To reduce systematic errors a single batch of DNA-functionalized enzymes was used to prepare all samples of the study and all measurements were performed in parallel. Furthermore, we estimated the mass of the


11

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 24

microparticles and the glass fibers needed for the experiments from the given dimensions to insure similar available surface areas. This means that on average the available surface area of both particle types for DNA origami adsorption was equal and therefore, the amounts of enzymes on all surfaces can be estimated as equal as well. During the parallel measurements the samples were gently shaken and the particles moved in the wells. Abrasion caused by this movement can affect the coating and can reduce the number of adsorbed structures by an estimated 10-15%.27 Figure 3 shows the CL intensity over time starting with a steep increase at the beginning and a slower decrease following after some minutes. To determine the enhancement of the enzyme activity we compared the maximum values of the CL intensity. Due to our parallel measurements and sample preparation the fast kinetics at the beginning could not be completely resolved for some of the samples. Nevertheless, the evident intensity decrease was probably not due to the consumption of luminol or glucose, especially since the far less active SER also showed a similar decay. Misra and coworkers proposed that due to the accumulation of products or dismutation of reactive intermediates the CL gets reduced.24 They also found that by adding more H2O2 or luminol the intensity can be increased, but that the overall shape of the intensity time course remains the same. The measured chemiluminescence in Figure 3 also showed such a behavior and this indicates a higher H2O2 concentration, for instance, through a higher local enzyme concentration rather than H2O2 accumulation. H2O2 has a relatively large diffusion coefficient (D = 1.71×103 µm2/s)16 and it is unlikely that it accumulates next to the silica particle surface. By using x2 = Dt we find a typical diffusion distance of x ≈ 40 µm for a diffusion time t = 1 s.


12

Page 13 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Using the glass fibers (gf) as the solid scaffold, and GOx and HRP bound to the DNA rectangle the CL intensity increased by agf ≈ 4 with respect to the SER (Figure 3a). To understand the influence of the silica surface we incubated 1 nM GOx and 1 nM HRP with the glass fibers (without DNA rectangles) and due to the attached DNA-linker the enzymes adsorbed onto the silica surface. Due to this random physical adsorption process the intermolecular distance between GOx-HRP pairs is less controllable. In this case, the CL intensity resulted only in an enhancement of asurf ≈ 2. We can dismiss another pH effect due to the charges present at the silica surface, because for the buffer conditions used (pH 8) its low surface charge density only marginally influences the local pH.29 In either case - with and without the DNA rectangles - the activity increased when GOx and HRP were localized on the micrometer-sized particles. If we assume that both enzymes are still fully functional on the silica surface, the adsorption contributes with an enhancement factor of at least two. We cannot exclude that the conformation of the enzymes is affected due to adsorption onto a hard surface, which might corrupt the single enzyme's activity. Potentially, the origami platforms act as a biocompatible adaptor structure between the enzymes and the silica particle, which would lead to an even larger surface enhancement of asurf > 2. Together with the enhancement of the reaction simply by co-localization of GOx and HRP on the DNA-rectangles


13

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 24

Figure 3. Chemiluminescence vs. time. Intensity profiles in time using a) glass fibers and b) silica microparticles. Each curve was normalized to the standard bulk reference (blue dots). Insets are the microscopy images of the silica particles.

(by a factor of a17bs ≈ 1.6), the overall expected enhancement of asurf × a17bs > 3 is consistent with the experimentally determined 4-fold CL intensity increase with respect to the SER. Co-localization of GOx and HRP on glass fibers increased their local concentration, which would be the most obvious explanation for the measured enhancement effect. But as mentioned before, the binding yield for GOx and HRP to the DNA rectangle is only moderate. To further increase the concentration of proteins on the surface of the glass fibers we used a dipping protocol (see experimental section). As a result, the CL intensity further increased to 8-fold


14

Page 15 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

compared to the SER (Figure 3a), and 10.4-fold with respect to the free, unmodified enzymes (Figure 4). As with 0.1 nM the concentration of the DNA rectangles is rather low, the glass fibers cannot be fully covered with DNA structures.27e It is likely that also DNA-functionalized GOx and HRP (not bound to the origami rectangles) physically adsorb onto the glass fiber's surface and thus further increase the surface density. We also attached the enzyme-covered DNA-origami structures to the polydisperse silica

Figure 4. Overview of maximum chemiluminescence intensities for different co-localization strategies with respect to the non-modified enzymes in solution (free enzymes). The standard enzyme reference is depicted as enzymes w DNA.

microparticles (sm) and measured similar CL intensity profiles in time, which also showed an enhancement by asm ≈ 4 (Figure 3b). For both, glass fibers and microparticles, we used the same batch and thus the same concentration of functionalized DNA structures. To improve the concentration of proteins on the surface of the microparticles, we used the temperature-gradient protocol from the experimental section. When closely spaced binding sites are used proteins with multiple linkers can bind to two adjacent binding positions simultaneously. This can be


15

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 24

prevented by stabilizing the DNA structure on a solid support27 or by applying the aforementioned temperature gradient which is basically a thermal annealing process. We assume that due to this slow annealing GOx and HRP bound more uniformly to their binding sites without occupying two binding sites at the same time. Unfortunately, neither AFM nor TEM imaging were sufficient to determine the binding yield or the packing density on the rectangle adequately after this second accumulation step. However, the CL intensity further increased to 7fold in relation to the SER (Figure 3b) and 9.1-fold in relation to the free, unmodified enzymes, respectively (Figure 4). The apparent scatter in Figure 3b originates most probably from the microparticles' movement during the measurement. Hess and coworkers have already shown that proximity in an enzyme dimer only affects the activity at the beginning of a reaction.8, 16 After about one second after the start of the reaction direct substrate fluxes (from the source) and indirect substrate fluxes (from bulk solution) are equal and any proximity effect is compensated. In our systems, large amounts of enzymes are accumulated on the surface of micrometer-sized scaffold structures. We assume that due to the high amounts of enzymes located at the surface, their concentrations affect reaction parameters such as the reaction rate or the reaction order. Due to their form and size the surface-to-volume ratio of the glass fibers and microparticles are very different, but this parameter did not seem to be important for the maximum CL intensity generated. However, for the microparticles the CL decays far less steeply, which means that they generate more light over time. This indicates a potential influence of the surface-to-volume ratio or the length scale of the silica material. As mentioned before both fibers and microparticles are coated with the same amounts of enzymes (except when the dipping and the temperature gradient protocols were used). If we compare the integrated light production shown in Figure 3, which is


16

Page 17 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

directly proportional to luminol turnover, the silica microparticles with a larger surface-tovolume ratio are about 5 to 10 times more efficient or productive than the glass fibers. In this context it is useful to compare the typical time-scales for reaction and diffusion involved. In previous works it has been shown that systems with a length scale below about 1-10 µm are reaction-limited and diffusion is fast enough to be neglected. In such a case the activity may be altered by changing reaction parameters. On the other hand, for systems much larger than ~110 µm the typical reaction times are faster than the diffusion or traffic times of small molecules.30-31 In this sense, the optimal length scale for micro-scaffolds (e.g. their radius of curvature) should also be in the range of 1-10 µm, especially if product accumulation has to be prevented. This is also comparable to the size of most prokaryotes, which are between 1-10 µm and which rely on passive transport through diffusion. CONCLUSION In this paper, different types of micrometer-scale silica particles - silica microspheres, glass fibers and silica microparticles - were used as a solid scaffold material for the adsorption of DNA origami rectangles. The latter were functionalized with GOx and HRP for the production of chemiluminescence via oxidation of luminol. We showed that by using this strategy the efficiency of the enzyme cascade GOx-HRP can be increased by one order of magnitude. We also demonstrated that each component of the system makes a small contribution to the total observed efficiency enhancement. This suggests that a synergistic interplay of various physicochemical contributions to the performance of an enzyme cascade, e.g. accumulation of enzymes, (optimal) reaction conditions as well as length scales and dimensionality, has to be achieved for the design of optimized enzyme cascade "reactors". In the present form the


17

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 24

Figure 5. Upscaled silica application. a) A 50 mL tube with a silica microparticles suspension equipped with a filter and a syringe. b) A flexible tube containing silica microparticles, which is equipped with a filter and a syringe.

presented system is not long-term stable and cannot be used under continuous operating conditions because of mechanical interactions between the particles and accumulation of products. Two of the major advantages of using silica particles as microcarriers is their ease of use, and their potential for upscaling. In our experiments suspension volumes in the low milliliter range were used, but as long as excessive sedimentation is prevented, larger suspension volumes are conceivable. Figure 5a shows a silica suspension with a volume of 20 ml with DNA origami structures located on the silica microparticles. In this specific example the tube was equipped with a 0.45 µm syringe filter to separate the silica particles with adsorbed DNA structures from


18

Page 19 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

the solute using a syringe. The silica particles can also be resuspended by pressing the initial solute back into the tube or a new solute with different content or volume (see Figure S10). Depending on the magnesium content in the solute the DNA origami structures can be easily eluted if necessary. Silica microparticles can also be placed into flexible plastic tubes (Figure 5b) and might be used as flow-through components of fluidic systems. In order to develop this into a real technological application the particles would have to be fixed or embedded, e.g. in a protective matrix to prevent abrasion effects and to facilitate fast and simple fluid exchange. For instance, it is conceivable to utilize chromatography columns as scaffold structures or even larger matrices to use biotechnological relevant volumes in optimized enzyme reactors. But in all cases biocompatible adaptors such as DNA origami structures have to be used to avoid unwanted interactions between enzymes and scaffold material. ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website at DOI: Additional information on the influence of MgCl2 on the enzyme activity, the activity of DNAfunctionalized enzymes, binding yields, further chemiluminescence data, and DNA sequences and are given. (PDF) AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]


19

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 24

Author Contributions K.V., J.L, and T.P. designed research. K.V. performed research. J.L. assisted in experiments. K.V., F.C.S. and T.P. analyzed data. K.V., F.C.S. and T.P. wrote the manuscript. Notes The authors declare no competing financial interest. ACKNOWLEDGMENT This work was supported by the DFG through the SFB 1032 Nanoagents (TP A2) and the Cluster of Excellence Nanosystems Munich (NIM). T.P. was supported by TUM International Graduate School for Sciene and Engineering IGSSE project no. 9.05. We would like to acknowledge F. Tostevin, G. Giunta and F. Hinzpeter for helpful discussions. The authors also thank M. Goetzfried for helpful discussions about click chemistry. ABBREVIATIONS CL, chemiluminescence; GOx, gluocose oxidase; HRP, horseradish peroxidase. REFERENCES 1.

An, S.; Kumar, R.; Sheets, E. D.; Benkovic, S. J., Reversible compartmentalization of de novo purine biosynthetic complexes in living cells. Science 2008, 320 (5872), 103-106.

2.

Campanella, M. E.; Chu, H.; Low, P. S., Assembly and regulation of a glycolytic enzyme complex on the human erythrocyte membrane. Proc. Natl. Acad. Sci. U.S.A. 2005, 102 (7), 2402-2407.

3.

Hinzpeter, F.; Gerland, U.; Tostevin, F., Optimal Compartmentalization Strategies for Metabolic Microcompartments. Biophys. J. 2017, 112 (4), 767-779.


20

Page 21 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

4.

Srere, P. A., Complexes of sequential metabolic enzymes. Annu. Rev. Biochem. 1987, 56, 89-124.

5.

Buchner, A.; Tostevin, F.; Gerland, U., Clustering and optimal arrangement of enzymes in reaction-diffusion systems. Phys. Rev. Lett. 2013, 110 (20), 208104.

6.

Buchner, A.; Tostevin, F.; Hinzpeter, F.; Gerland, U., Optimization of collective enzyme activity via spatial localization. J. Chem. Phys. 2013, 139 (13), 135101.

7.

Idan, O.; Hess, H., Diffusive transport phenomena in artificial enzyme cascades on scaffolds. Nat. Nanotechnol. 2012, 7, 769-770.

8.

Idan, O.; Hess, H., Origins of activity enhancement in enzyme cascades on scaffolds. ACS Nano 2013, 7 (10), 8658-8665.

9.

Castellana, M.; Wilson, M. Z.; Xu, Y.; Joshi, P.; Cristea, I. M.; Rabinowitz, J. D.; Gitai, Z.; Wingreen, N. S., Enzyme clustering accelerates processing of intermediates through metabolic channeling. Nat. Biotechnol. 2014, 32 (10), 1011-1018.

10. Conrado, R. J.; Varner, J. D.; DeLisa, M. P., Engineering the spatial organization of metabolic enzymes: mimicking nature's synergy. Curr. Opin. Biotechnol. 2008, 19 (5), 492499. 11. Fu, J.; Yang, Y. R.; Johnson-Buck, A.; Liu, M.; Liu, Y.; Walter, N. G.; Woodbury, N. W.; Yan, H., Multi-enzyme complexes on DNA scaffolds capable of substrate channelling with an artificial swinging arm. Nat. Nanotechnol. 2014, 9 (7), 531-536. 12. Ke, G.; Liu, M.; Jiang, S.; Qi, X.; Yang, Y. R.; Wootten, S.; Zhang, F.; Zhu, Z.; Liu, Y.; Yang, C. J.; Yan, H., Directional Regulation of Enzyme Pathways through the Control of Substrate Channeling on a DNA Origami Scaffold. Angew. Chem. Int. Ed. 2016, 55 (26), 7483-7486.


21

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 24

13. Miles, E. W.; Rhee, S.; Davies, D. R., The molecular basis of substrate channeling. J. Biol. Chem. 1999, 274 (18), 12193-12196. 14. Fu, J.; Liu, M.; Liu, Y.; Woodbury, N. W.; Yan, H., Interenzyme substrate diffusion for an enzyme cascade organized on spatially addressable DNA nanostructures. J. Am. Chem. Soc. 2012, 134 (12), 5516-5519. 15. Wilner, O. I.; Weizmann, Y.; Gill, R.; Lioubashevski, O.; Freeman, R.; Willner, I., Enzyme cascades activated on topologically programmed DNA scaffolds. Nat. Nanotechnol. 2009, 4 (4), 249-254. 16. Zhang, Y.; Tsitkov, S.; Hess, H., Proximity does not contribute to activity enhancement in the glucose oxidase-horseradish peroxidase cascade. Nat. Commun. 2016, 7, 13982. 17. Zhang, Y.; Wang, Q.; Hess, H., Increasing Enzyme Cascade Throughput by pH-Engineering the Microenvironment of Individual Enzymes. ACS Catal. 2017, 7 (3), 2047-2051. 18. Jung, C.; Allen, P. B.; Ellington, A. D., A stochastic DNA walker that traverses a microparticle surface. Nat. Nanotechnol. 2016, 11 (2), 157-163. 19. Rothemund, P. W. K., Folding DNA to create nanoscale shapes and patterns. Nature 2006, 440 (7082), 297-302. 20. Bastos, E. L.; Ciscato, L. F. M. L.; Bartoloni, F. H.; Catalani, L. H.; Baader, W. J., Studies on PVP hydrogel-supported luminol chemiluminescence: 1. Kinetic and mechanistic aspects using multivariate factorial analysis. Luminescence 2007, 22 (2), 113-125. 21. Cormier, M. J.; Prichard, P. M., An investigation of the mechanism of the luminescent peroxidation of luminol by stopped flow techniques. J. Biol. Chem. 1968, 243 (18), 47064714.


22

Page 23 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

22. Díaz, A. N.; Sanchez, F. G.; García, J. A. G., Hydrogen peroxide assay by using enhanced chemiluminescence of the luminol-H2O2-horseradish peroxidase system: Comparative studies - ScienceDirect. Anal. Chim. Acta 1996. 23. Kamidate, T.; Komatsu, K.; Tani, H.; Ishida, A., Direct determination of horseradish peroxidase encapsulated in liposomes by using luminol chemiluminescence. Anal. Sci. 2008, 24 (4), 477-481. 24. Misra, H. P.; Squatrito, P. M., The role of superoxide anion in peroxidase-catalyzed chemiluminescence of luminol. Arch. Biochem. Biophys. 1982, 215 (1), 59-65. 25. Aghebat Rafat, A.; Pirzer, T.; Scheible, M. B.; Kostina, A.; Simmel, F. C., Surface-Assisted Large-Scale Ordering of DNA Origami Tiles. Angew. Chem. Int. Ed. 2014, 53 (29), 76657668. 26. Stahl, E.; Martin, T. G.; Praetorius, F.; Dietz, H., Facile and scalable preparation of pure and dense DNA origami solutions. Angew. Chem. Int. Ed. 2014, 53 (47), 12735-12740. 27. Vogele, K.; List, J.; Pardatscher, G.; Holland, N. B.; Simmel, F. C.; Pirzer, T., SelfAssembled Active Plasmonic Waveguide with a Peptide-Based Thermomechanical Switch. ACS Nano 2016, 10, 11377-11384. 28. Fu, Y.; Zeng, D.; Chao, J.; Jin, Y.; Zhang, Z.; Liu, H.; Li, D.; Ma, H.; Huang, Q.; Gothelf, K. V.; Fan, C., Single-Step Rapid Assembly of DNA Origami Nanostructures for Addressable Nanoscale Bioreactors. J. Am. Chem. Soc. 2013, 135 (2), 696-702. 29. Behrens, S. H.; Grier, D. G., The charge of glass and silica surfaces. J. Chem. Phys. 2001, 115 (14), 6716-6721. 30. Hess, B.; Mikhailov, A., Microscopic self-organization in living cells: a study of time matching. J. Theor. Biol. 1995, 176 (1), 181-184.


23

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 24

31. Mikhailov, A.; Hess, B., Fluctuations in living cells and intracellular traffic. J. Theor. Biol. 1995, 176 (1), 185-192.

For Table of Contents Only


24

Enhanced efficiency of an enzyme cascade on DNA-activated silica

Recommend Documents