Article Cite This: ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
www.acsabm.org
Enhanced Osteointegration of Hierarchical Structured 3D-Printed Titanium Implants Mengfei Yu,†,§ Yihan Lin,†,§ Yu Liu,† Ying Zhou,† Chao Liu,† Lingqing Dong,*,†,‡ Kui Cheng,‡ Wenjian Weng,‡ and Huiming Wang*,† †
Stomatologic Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China School of Materials Science and Engineering, State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027, China
Downloaded via UNIV OF CALGARY on June 20, 2018 at 12:59:27 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
‡
S Supporting Information *
ABSTRACT: Three-dimensional (3D) printing technology has been widely used to fabricate of various titanium and its alloy implants. However, engineering the 3D printing nanoscaled feature to realize a hierarchical micronano structured surface topography still remains a challenge. On one hand, enhanced bioactivity is always expected on micronano-hybrid biomimetic topography; on the other hand, a typical functional protein in extracellular matrix (ECM) is nanoscaled; therefore, nanoscaled features might affect its binding to specific receptor and subsequent cell response. Here, we engineered a novel hierarchical structure with microparticles and rutile TiO2 nanorods topography that fabricated by 3D printing of pure titanium followed by a hydrothermal process. Although there was no difference on the microscaled feature before/after nanonization, cellular behaviors including adhesion, proliferation, and osteogenic differentiation of mesenchymal stem cells (MSCs) were significantly upregulated on the hierarchical micronano structured topography. Moreover, we demonstrated that the distinct conformation of the initially fibronectin proteins adsorbed on nanorods was more beneficial to cellular adhesion. In vivo test in a rabbit femur model also demonstrated the favorable for new bone formation on the novel hierarchical micronano structured implant−bone interface. These results therefore suggest that the hierarchical micronano structured topography might be a promising surface feature for the new generation of bone implants. KEYWORDS: 3D printing, hierarchical micronano structure, mesenchymal stem cell, osteointegration, pure Ti implant
■
INTRODUCTION Cells are able to respond to physicochemical cue features scaled from nanoto-micron in their extracellular matrix (ECM).1−3 The sizes of cells themselves are comparable to microscale feature. Therefore, microscaled feature topography could directly regulate the alignment and orientation of cells through the cytoskeletal rearrangement, nuclear shape alterations, and subsequent specific genetic expression.4 In terms of nanoscale feature with the dimension of some important transmembrane receptors, such as integrin (8−12 nm), the distinct adsorbed protein conformation dependent on the nanoscale topography might trigger corresponding signaling pathway and direct cellular responses.5,6 Furthermore, the biomimetic microto-nanoscale hierarchical surface topography has been demonstrated to receive desired cell responses.7−10 For example, Ogawa et al. observed that the strength of boneimplant integration was significantly improved for the implants with microto-nanoscale hierarchical model as compared to that of microscale feature alone.11 Cho et al. demonstrated that the differentiation of human neural stem cells could be promoted by a patterned substrate with simultaneously spatial controls of microscale and nanoscale.12 Therefore, engineering of the hierarchical micronano structured topography would be a © XXXX American Chemical Society
promising surface feature for the development of functional biomaterials. Titanium (Ti) and its alloys have been widely used for orthopedic and dental implant applications due to their excellent biocompatibility, high corrosion resistance, and superior mechanical properties.13,14 Traditional Ti implants were produced by processing titanium rods, followed by further surface modification, such as sandblasting, acid-etching, and electrochemical anodization etc., to improve stability and enhance osteointegration.15,16 Recent revolutionary advancements in three-dimensional (3D) printing technology have not only substantially broadened the field of Ti implants application, but also provided an economical processing technique to meet the personal requirements for each clinical patient.17,18 Jiang et al. reported the combined application of 3D scanning and 3D printing for treating bone and cartilage defects.19 However, it also carries the disadvantage that the nanoscaled feature topography of metal imprinting process involves multiple steps and expensive processes due to the high Received: April 22, 2018 Accepted: June 14, 2018 Published: June 14, 2018 A
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
Figure 1. SEM images of three typical surface topographies: (a) Ti, (b) 3D-Ti, (c) 3D-Ti-Nano and the (d) high-resolution image of nanorods on 3D-Ti-Nano surface; further surface phase analysis of 3D-Ti-Nano and 3D-Ti implants by using (e) XRD pattern and (f) Raman spectra; (g) TEM characterization of a typical single nanorod.
Figure 2. Cellular viability evaluation of MSCs on various implants after 1 day and 3 days of culture and the corresponding quantitative analysis of cell number and spreading area.
melting temperature of metals.20 Therefore, postprocessing a 3D printed Ti implant has always been carried out to further achieve the nanoscale feature topography.21 For example, Losic et al. engineered 3D-Printed Ti alloy implant by an anodization process featuring unique microparticles and nanotubular topography to enhance its bone osteointegration and drug loading capabilities.16 Nune et al. demonstrated that the osteoconductive potential of anodized 3D printed Ti-6Al-4 V alloy with a multimodal roughness surface ranging from nano to micro to macroscale.22 In this study, we demonstrated the enhanced osteointegration of hierarchical micronano structured 3D-printed titanium implants. The aim of this study was to compare the osteointegration performance of traditional titanium implants
with 3D printed Ti implants with microscaled topography and hierarchical micronano structured 3D-printed titanium implants after the subsequent processing. The selective laser melting (SLM) 3D printing technology was carried out to fabricate pure Ti implants with an unique microscale structured topography whereby the spherical Ti microparticles were randomly dispersed. The 3D-printed implants were further hydrothermal treated to generate a TiO2 nanorods layer on top of the surface while preserving the microscale topography feature. The osteointegration performance was evaluated by exploring the osteoblast differentiation potential of mesenchymal stem cells in vitro, as well as the in vivo monitoring of implant osteointegration in a rabbit femur model. B
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
■
RESULTS
The surface topography of three typical implants, Ti, 3D-Ti, and 3D-Ti-Nano, were characterized by scanning electron microscopy (SEM), as shown in Figure 1a−c. The results showed that the normal Ti implant was flat and its average roughness was about 400 nm, as we previously reported. However, the surface topography engineered by 3D-printing (3D-Ti) was completely covered by randomly distributed microparticles of various sizes, ranging from 10 to 40 μm. This unique microscaled feature was of a comparable size to the cells and therefore beneficial to cell response. Hydrothermal growth process was further carried out to introduce TiO2 nanorods on 3D-Ti surface while preserving the microscaled feature topography, as shown in Figure 1c. The SEM image (Figure 1d) demonstrated that nanorods densely covered onto the microparticle surface with the length of 800 ± 200 nm and diameter of 30 ± 10 nm, respectively. To further investigate the phase of growth nanorods, XRD pattern and Raman spectra were performed. As shown in Figure 1e, the XRD pattern fully fitted well with rutile TiO2 phase (JCPDS No. 21−1276). This result was consistent with the Raman spectra in Figure 1f. Three characteristic bands were observed at 235, 445, and 612 cm−1, which could be ascribed to the Raman active modes of rutile TiO2.23 Furthermore, the relative peak intensity of {002} was significantly enhanced in XRD pattern, compared to the standard powder diffraction patterns, suggesting the preferred growth direction of TiO2 nanorod crystals. This finding was confirmed by the following TEM characterization in Figure 1g. Two interplanar spacings of 0.296 and 0.325 nm that were attributed to {001} and {110}, respectively, were observed from the edge of a typical single-crystalline TiO2 nanorod. These results were consistent with the aforementioned oriented growth of TiO2 nanorod along direction. The cellular adhesion and proliferation behaviors were by live/dead staining assays and corresponding quantitative analysis, as shown in Figure 2. Although the initial attached cell number was upregulated on Ti implant surface compared with that on the 3D-Ti and 3D-Ti-Nano surfaces during the first 1 day of incubation, cell spreading area was expedited remarkably on the 3D-Ti and 3D-Ti-Nano implant surfaces. After 3 days of culture, this trend was even more obvious. Especially, both the initial attached cell number and cell spreading area were more upregulated on the 3D-Ti-Nano implant surface than that of 3D-Ti implant surface. These results were also confirmed by the CCK-8 assay analysis results, as shown in Figure 3. SEM was carried out to evaluate the cellular morphology. As shown in Figure 4, cellular morphology was notable different due to the differences of topography feature of various implant surfaces. Cells were flattened and lacked the noticeable filopodia extensions and cellular propagation fronts on Ti implant surface. In contrast, cells attached tightly to the structural features of 3D-Ti and 3D-Ti-Nano implants and appeared to be polygon-shaped and spread completely on the pseudo-3D artificial microenvironment. Furthermore, numerous of filopodia and lamellipodia (arrows) extensions were observed on 3D-Ti and 3D-Ti-Nano implant surfaces, as shown in Figure 4. To further evaluate how the surface topography features regulated cell focal adhesion (FA) formation and actin filaments activation, the focal adhesion protein vinculin and
Figure 3. Cellular viability analysis (CCK-8 assay) for 1, 3, and 5 days of culture on various implants.
the actin were stained. The distribution of cellular vinculin expression on Ti implant surface was flattened round and stationary (Figure 5). In contrast, FAs were observed to distribute widely on the microparticles surface of 3D-Ti and 3D-Ti-Nano implants, presenting a three-dimensional feature. The interlaced distribution of actin fiber bundles in three dimensions was also observed. These results could be more clearly observed through the color video with three-dimensional perspective (Videos 1, 2, and 3). These results were consistent with the SEM observation results. To explore the osteogenic differentiation of MSCs on various implants, the expression levels of osteogenic differentiation genes of MSCs (COL-1, Runx2, and OCN) were evaluated by using the polymerase chain reaction (PCR) method. As shown in Figure 6, the expressions of COL-1, Runx-2 and OCN were significantly upregulated at days 7 and 14 on 3D-Ti and 3D-Ti-Nano implant surfaces than that of Ti, especially of the 3D-Ti-Nano implant (nearly 6-fold). The exception to this was that the expression level of Runx2 was downregulated at day 14 on 3D-Ti implant surface compared to that on Ti implant surface. These results suggested that the microscale feature topography was more conducive to the early stage of MSCs osteogenic differentiation. In all, with comprehensive consideration of the expression of COL-1 and OCN, it might be reasonable to conclude that the trend of osteogenic differentiation on 3D-Ti and 3D-Ti-Nano implant surfaces was more significant than that on the Ti implant surface. Quantitative alkaline phosphatase (ALP) activity assay was also performed to evaluate the protein expression levels of early stage osteogenic differentiation hallmark of MSCs. As shown in Figure 7, the activity of the osteogenic differentiation marker was slightly upregulated at day 7 on the 3D-Ti-Nano implant surface than that on the Ti implant surface. However, there was no statistically significant difference in the expression level at day 14 on various implants. Moreover, we evaluated the effects of surface morphology feature of various implants on the conformation of initial adsorbed FN protein. As shown in Figure 8a, the sites for antibody-binding epitopes in the ninth and 10th type III repeats (HFN7.1) and the eighth type III (mAb1937) of FN were significantly upregulated on 3D-Ti-Nano surface compared to that of Ti and 3D-Ti surfaces. Because HFN7.1 and mAb1937 sites bound to the cell adhesion domain (RGD) and its synergy domain (PHSRN) of FN, respectively,24 these C
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
Figure 4. SEM observation of typical MSCs attachment on various implants after 1 d of culture. White arrows show the microfilaments.
Figure 5. Typical cytoskeleton and focal adhesions (FAs) immunofluorescent observation of MSCs on various implants. (A) MSCs were stained for the focal adhesion protein vinculin (green), actin cytoskeleton (red), and cellular nuclei (blue). All of the images share one scale bar of 50 μm.
of implantation. However, toluidine blue staining results appeared the active new formation bone and a close contact surrounding the 3D-Ti and 3D-Ti-Nano implants, suggesting the acceleration osseointegration of microscaled feature topography. Moreover, more abundant osteocytes and haversian canal structures were observed on 3D-Ti-Nano implant compared with that of 3D-Ti implant. The histologic analysis results by using Masson’s trichrome staining (Figure 10) further demonstrated a significantly upregulated expression of collagen and new formation bone on 3D-Ti-Nano implant-
results therefore suggested that implant surface feature could regulate cell adhesion behavior through the conformational change of initial adsorbed FN and triggered subsequent corresponding signal pathways, as schematic demonstrated in Figure 8b. We further evaluated the osteointegration performance of various implants by histological observation of the bone− implant interface. As the toluidine blue staining results shown in Figure 9, the boundary between Ti implant and host bone still seemed not tight enough or continuous even after 8 weeks D
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
results further confirmed the novel osseointegrated performance of hierarchical micronano structured topography. These in vivo results were consistent with the in vitro results.
■
DISCUSSION In recent years, 3D printing technology has opened new horizons for the design and fabricating complex biomedical implants and devices using polymers, ceramics, and metals.21,25,26 3D printing is particularly advantages for macro/ micro architecture control, customized complex devices that are not easy realize using conventional manufacturing technologies such as injection molding.27−29 Although macro/microarchitecture processing has made great strides in the past five years due to the advancements in 3D printing technologies, additional work should focus on the nanoarchitecture that might need to be further implemented by surface modification.30 Surface modification of implant materials, such as sandblasting, acid-etching, electrochemical anodization, etc., have been widely carried out to improve their biological activity. The method for clinical commonly used implants is to increase its roughness and to construct novel topography features.31 The presence of rough surfaces has been considered to promote cell adhesion, proliferation, and osteogenic differentiation as well as the contact area of implant−bone interface after implantation. The strategy in this study for growth of rutile nanorods on 3D-Ti surface was followed our previous preparation technology. The mechanism of nanorods formation after hydrothermal treatment process involved the nucleation and epitaxial growth of the titania nanorods on titanium surface.23 The cell morphology is also demonstrated to vary closely related to the surface topography feature. Therefore, the relative smooth surface feature of Ti implant is detrimental to MSCs adhesion and spreading completely, as shown in Figures 2, 4, and 5. In contrast, cells on 3D-Ti and 3D-Ti-Nano implant surfaces appear to be polygon-shaped and spread completely on the pseudo-3D artificial microenvironment. These cell morphology differences triggered by surface topography feature eventually lead to the significantly variety of osteogenic differentiation potential, as indicated in Figures 6 and 7. The downregulated expression of osteogenic differentiation related gene at D14 compared with D7 further confirmed the excellent osteogenic capacity of 3D printed Ti implants. We therefore conclude that 3D-Ti and 3D-Ti-Nano implant surfaces with novel microscaled feature can promote adhesion, proliferation, and osteogenic differentiation, compared with that of Ti implant surface, which is considered as relative smooth surface. Microscaled and nanoscaled feature topography as well as their combination have demonstrated their enhanced osteoblast differentiation performance. For example, Ogawa et al. created a micropit-and-nanonodule hybrid topography of TiO2 to improve osteoconductivity of Ti surface.11 Losic et al. showed a unique combination of microscale and nanotopography on 3D-printed Ti implants promoted osteoblast adhesion and osteogenic differentiation.16 Those results are consistent with our results in this study. However, those previous efforts have only reported the ultimately osteogenic performance of microto-nanoscale hierarchical topography models. The observations still show a lack of the mechanism underlying how microscaled and nanoscaled topography feature affects the osteogenic performance, respectively.
Figure 6. PCR evaluation of osteogenic differentiation related gene markers expression level: COL-1, Runx2, and OCN, on various implants after 7 and 14 days of culture. All data were normalized to the gene expression of the corresponding marker of Ti group.
Figure 7. Alkaline phosphatase (ALP) protein expression levels of MSCs on various implants after 7 days and 14 days of culture.
bone interface after 4 weeks and 8 weeks of implantation, respectively, compared with that of other two groups. These E
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
Figure 8. (a) Relative fluorescence intensity of bound HFN7.1 and mAB1937 monoclonal antibodies onto the FN protein adsorbed on various implants. (b) Schematic illustration of how nanorods on 3D-Ti-Nano surface regulate the conformation of initial adsorbed FN, which might subsequently trigger the integrin−FA cytoskeleton actin transduction pathway to regulate the gene and protein expressions of MSCs.
cell attachment.38 Furthermore, because the comparable size to functional protein in ECM, it is reasonable for us to speculate that the distinct protein (FN) conformation due to the distinct nanoscale topography might trigger specific receptor-mediated intracellular signaling cascade and mediate cellular responses as shown in Figure 8. Our experimental analysis results of initial absorbed FN conformation also confirm this hypothesis. FN is the major integrin-binding anchor functional protein and can be recognized by various integrin subunits such as αv, α5, β1, β3, etc.39 Among them, α5β1 is the most widely studied subunit that binds FN to subsequent influence cell adhesion, proliferation, and differentiation.40−42 The upregulated expression results of HFN7.1 and mAb1937 in Figure 8 suggest that the higher availability of RGD and PHSRN sequences, respectively, which have been considered a crucial role on cell adhesion. We therefore suggest that the enhanced osteogenic performance of nanoscaled feature topography might be inspired from the distinct conformation of initial adsorbed functional protein. Nevertheless, it still needs further optimization strategies of hierarchical micronano structured topography for implants with ideal osteogenic performance.
Normally, microscaled feature topography could directly regulate the alignment and orientation of cells through the cytoskeletal rearrangement, accompanied by the upregulated expression of Rho kinase (ROCK) activity, and subsequent osteogenesis.32,33 Therefore, microscaled feature topography can promote the osteogenic differentiation of MSCs but inhibit their proliferation.34 The cellular viability evaluations in Figures 2 and 3 also show that cellular viability is upregulated on Ti implant surface at initial stage (1 day) compared with that on 3D-Ti implant surface. Although the difference between 3D-Ti and 3D-Ti-Nano samples was not obvious according to the results of cell viability in Figure 3 and immunofluorescent observation in Figure 5, cells on the 3D-Ti and 3D-Ti-Nano showed significantly different to that on Ti implant surface. The significant differences in osteogenic differentiation related gene markers expression level between 3D-Ti and 3D-Ti-Nano samples in Figure 6 clearly displayed the additional benefits of nanoscaled topography. Therefore, the microscaled feature topography might be beneficial for the initial osteogenic performance. In terms of nanoscaled feature topography, it provides a biomimetic extracellular matrix (ECM) environment, enhancing the cellular adhesion, proliferation, and osteogenic differentiation.35−37 It was noteworthy to mention that the surface hydrophilicity of 3D-Ti-Nano and 3D-Ti implants was superhydrophilic and hydrophobic, with the water contact angle of 127° and 0°, respectively (data not shown). It was believed that the increased hydrophilicity was beneficial to protein adsorption because of increased adsorption sites on the hydrophilic surface, which subsequently promoted the initial
■
CONCLUSION In summary, we here demonstrated the enhanced osteointegration of engineered novel hierarchical structure with 3Dprinted pure titanium microparticles and hydrothermal grown rutile TiO2 nanorods topography. Not only the expression of osteogenic-related gene markers of MSCs, but also the new bone formation capacity showed significantly upregulated on 3D-Ti-Nano implant surface compared that on Ti and 3D-Ti F
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
Figure 9. Histologic analysis (toluidine blue staining) at the bone−implant interface of various groups after implantation for 4 and 8 weeks. The white arrows indicate osteocytes. B, bone tissue; Ft, fibrous tissue; Hc, haversian canal. out in a 0.03 M tetra-n-butyl titanate (Ti(OBu)4, TBOT) of hydrochloric acid solution (15% by weight) at 160 °C for 2 h. After the reaction, the 3D-Ti substrate with nanorods on its surface (3D-Ti-Nano) was taken out and washed extensively with deionized water. Surface Characterization of Prepared Implants. The surface topography of the samples was observed by field emission scanning electron microscopy (FESEM, HITACHI SU-70). The crystal structure of the as-growth nanorods was examined by X-ray diffraction (XRD, PANalytical X’Pert Pro, Netherlands) and Raman spectra (Thermo Fisher Scientific, USA). The microstructures of rutile nanorods were further observed by transmission electron microscopy (TEM, FEI JEM-2100). Mesenchymal Stem Cell Culture. Mesenchymal stem cells (MSCs) were isolated and collected from the bone marrow of 4-weekold male Sprague−Dawley (SD) rats. Briefly, bone marrow was harvested and then placed into α-MEM medium. Osteogenic medium consisting of α-MEM supplemented with 15% fetal bovine serum (FBS, Gibco), 0.1 μmol/L dexamethasone (Sigma-Aldrich), 10 mmol/L β-glycerol phosphate (Sigma-Aldrich), and 0.2 mmol/L ascorbic acid (Sigma-Aldrich) was used during the differentiation experiments. Cells were incubated in a humidified atmosphere of 5% CO2 at 37 °C. When the cells grew to 80% confluence, they were
implant surfaces. Moreover, we demonstrated that the microscaled feature topography might be beneficial for the initial osteointegration, and the enhanced osteogenic performance of nanoscaled feature topography might be inspired from the distinct conformation of initial adsorbed functional protein. This work therefore suggests that engineering hierarchical micronano structured topography on orthopedic implant surface might be a novel strategy to enhance osteointegration.
■
EXPERIMENTAL SECTION
3D Printing of Ti Implants. Master pure titanium (Ti) powder with an average particle size of 1−10 μm was used as basic material. The square implant substrates (1.0 × 1.0 cm2) were printed with a 3D-selective laser melting machine (EOS M290, Germany) equipped with 400 W Yb (Ytterbium) fiber laser system under inert argon atmosphere. The obtained 3D-printed Ti (3D-Ti) substrates were then thoroughly cleaned by wiping and ultrasonication in ethanol and water to remove the unmelted particles. Growth of Rutile Nanorods on 3D-Printed Ti Implants. Prior to growth of nanorods on 3D-printed Ti implant surface using hydrothermal process, 3D-Ti substrates were annealed at 800 °C for 1 h to remove internal stresses. The hydrothermal process was carried G
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials
Figure 10. Histologic analysis (Masson’s trichrome staining) at the bone−implant interface of various groups after implantation for 4 and 8 weeks. The white arrows indicate osteocytes. B, bone tissue; C, collagen; Ft, fibrous tissue; Hc, haversian canal. detached and passaged. The culture medium was renewed every 2 days. This protocol was approved by the Ethics Committee of Animal Care and Use Committee for Teaching and Research in the First Affiliated Hospital of Medical College, Zhejiang University. Cell Viability. A density of 5 × 104 cells/well was cultured on the substrates. Cell viability was evaluated by the cell counting kit-8 (CCK-8) assay. Briefly, at each time point, the substrates were transferred to a new plate and washed using phosphate buffer saline (PBS). Then 500 μL of medium and 50 μL of CCK-8 (Dojindo Laboratories) solution were added. Live−Dead Staining. A density of 5 × 104 cells/well was cultured on the substrates. At each time, substrates were washed gentlely and added 2 μg/mL calcein-AM and 1 μg/mL ethidium homodimer-1. After 30 min, substrates were observed by fluorescence microscopy (Zeiss, Germany). Alkaline Phosphatase (ALP) Activity. The MSCs were cultured on the substrates in 24-well plates using a density of 5 × 104 cells/ well. Alkaline phosphatase (ALP) activity was determined at day 7 and day 14 using phosphatase substrate kit (Wako, Japan). At each time point, cells were rinsed with PBS and then cell supernatant was extracted. The experimental procedure was completely in accordance the manufacturer’s protocol. The ALP activity was evaluated. Cell Morphology Observation. A density of 1 × 104 cells/well was cultured on the substrate. After 1 d of culture, cells were rinsed with PBS and were fixed in 2.5% glutaraldehyde overnight at 4 °C.
The substrates were then dehydrated through a series of concentrated ethanol solution followed by supercritical drying (Hitachi Model Hcp2). Cell morphology was observed by SEM after coating with gold in Hitachi Model E-1010 ion sputter for 40 s. Immunofluorescent Staining. A density of 1 × 104 cells/well was cultured on the substrate. After 1 d of culture, cells were fixed in 4% paraformaldehyde for 15 min, permeablized in 4% Triton X 100 for 15 min, and then blocked in 2% bovine serum albumin (BSA) for 1 h. The antivinculin polyclonal antibody (ab18058, Abcam) was used to stain focal adhesion. Rhodamine phalloidin (PHDR1, Cytoskeleton, Inc.) was used to stain cytoskeleton. DAPI (DAPI, H-1200, VECTOR) was used to stain the nucleus. PCR Analysis. A density of 5 × 104 cells/well was cultured on substrate. The total ribonucleic acid (RNA) of each sample was extracted by using TRIzol (Gibco). Then RNA was reverse transcripted of into DNA (cDNA). The relative gene expression was normalized to that of the endogenous reference transcript gene GAPDH expression on Ti implant at days 7 and 14, respectively. The primer sequences of three osteogenic differentiation related gene marks were GAPDH (F, GGCACAGTCAAGGCTGAGAATG; R, ATGGTGGTGAAGACGCCAGTA); COL-1 (F, TCCTGCCGATGTCGCTATC; R, CAAGTTCCGGTGTGACTCGTG); OCN (F, AAAGCCCAGCGACTCT; R, CTAAACGGTGGTGCCATAGAT); and RunX-2 (F, GCTTCTCCAACCCACGAATG; R, GAACTGATAGGACGCTGACGA). H
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials FN Adsorption and Conformation. Fibronectin (Fn) was used as the model functional adsorbed protein. Immunosorbent assay was used to evaluate the initial adsorbed conformation of FN. Briefly, the clean substrates were incubated in 10 μg/mL Fn protein (SigmaAldrich) solution for 1 d at 37 °C. Then the substrates were washed with PBS and blocked in 1% bovine serum albumin (BSA) solution for 30 min at 37 °C. The primary monoclonal antibodies HFN7.1 (Developmental Studies Hybridoma Bank) and mAb1937 (Millipore) were used to directly link the flexible linker between the ninth and 10th type III repeat and the eighth type III repeat, respectively. Finally, the reaction products were evaluated by using a fluorescence microplate reader (Gemini XPS, Molecular Devices, USA). Animals and Surgical Procedures. The three types of implants (Ti, 3D-Ti, and 3D-Ti-Nano) were implanted into femoral metaphyses of New Zealand white rabbits (weighing >2.0 kg, n = 6 per group). An ear margin intravenous injection of 3% pentobarbital sodium (1 mL/kg) was administered before all the procedures were started. The rabbits were housed in Zhejiang University Animal House facility with constant temperature and sufficient feed and water. The rabbits were excessive anesthetic sacrificed after 4 and 8 weeks, and the femoral condyles containing the samples were collected in formalin for further histological analyses. This protocol was approved by the Ethics Committee of Animal Care and Use Committee for Teaching and Research in Zhejiang University. Statistical Analysis. For each test, three parallel samples in each group were used. All data are expressed as mean ± standard deviation (SD). A one-way analysis of variance (one-way ANOVA) with Tukey’s post hoc test was conducted for statistical analysis. A value of p < 0.05 was considered statistically significant (∗p < 0.05, ∗∗p < 0.01).
■
Provincial Chinese Medical Science Research Foundation (2016ZB077), and the Postdoctoral Science Foundation of China (2017M621923).
■
(1) Lutolf, M. P.; Gilbert, P. M.; Blau, H. M. Designing Materials to Direct Stem-Cell Fate. Nature 2009, 462 (7272), 433−441. (2) Weiss, P.; Garber, B. Shape and Movement of Mesenchyme Cells as Functions of the Physical Structure of the MediumContributions to a Quantitative Morphology. Proc. Natl. Acad. Sci. U. S. A. 1952, 38 (3), 264−280. (3) Bettinger, C. J.; Langer, R.; Borenstein, J. T. Engineering Substrate Topography at the Micro- and Nanoscale to Control Cell Function. Angew. Chem., Int. Ed. 2009, 48 (30), 5406−5415. (4) Mahmoudi, M.; Bonakdar, S.; Shokrgozar, M. A.; Aghaverdi, H.; Hartmann, R.; Pick, A.; Witte, G.; Parak, W. J. Cell-Imprinted Substrates Direct the Fate of Stem Cells. ACS Nano 2013, 7 (10), 8379−8384. (5) Xiong, J. P.; Stehle, T.; Zhang, R. G.; Joachimiak, A.; Frech, M.; Goodman, S. L.; Arnaout, M. A. Crystal structure of the Extracellular Segment of Integrin Alpha V Beta 3 in Complex with an Arg-Gly-Asp Ligand. Science 2002, 296 (5565), 151−155. (6) Wang, X.; Yan, C.; Ye, K.; He, Y.; Li, Z.; Ding, J. Effect of RGD Nanospacing on Differentiation of Stem Cells. Biomaterials 2013, 34 (12), 2865−2874. (7) Jaggy, M.; Zhang, P.; Greiner, A. M.; Autenrieth, T. J.; Nedashkivska, V.; Efremov, A. N.; Blattner, C.; Bastmeyer, M.; Levkin, P. A. Hierarchical Micro-Nano Surface Topography Promotes Long-Term Maintenance of Undifferentiated Mouse Embryonic Stem Cells. Nano Lett. 2015, 15 (10), 7146−7154. (8) Huang, Q.; Elkhooly, T. A.; Liu, X.; Zhang, R.; Yang, X.; Shen, Z.; Feng, Q. Effects of Hierarchical Micro/Nano-Topographies on the Morphology, Proliferation and Differentiation of Osteoblast-Like Cells. Colloids Surf., B 2016, 145, 37−45. (9) Li, G.; Song, Y.; Shi, M.; Du, Y.; Wang, W.; Zhang, Y. Mechanisms of Cdc42-Mediated Rat MSC Differentiation on Micro/ Nano-Textured Topography. Acta Biomater. 2017, 49, 235−246. (10) Moe, A. A. K.; Suryana, M.; Marcy, G.; Lim, S. K.; Ankam, S.; Goh, J. Z. W.; Jin, J.; Teo, B. K. K.; Law, J. B. K.; Low, H. Y.; Goh, E. L. K.; Sheetz, M. P.; Yim, E. K. F. Microarray with Micro- and Nanotopographies Enables Identification of the Optimal Topography for Directing the Differentiation of Primary Murine Neural Progenitor Cells. Small 2012, 8 (19), 3050−3061. (11) Kubo, K.; Tsukimura, N.; Iwasa, F.; Ueno, T.; Saruwatari, L.; Aita, H.; Chiou, W.-A.; Ogawa, T. Cellular Behavior on TiO2 Nanonodular Structures in a Micro-to-Nanoscale Hierarchy Model. Biomaterials 2009, 30 (29), 5319−5329. (12) Yang, K.; Jung, H.; Lee, H.-R.; Lee, J. S.; Kim, S. R.; Song, K. Y.; Cheong, E.; Bang, J.; Im, S. G.; Cho, S.-W. Multiscale, Hierarchically Patterned Topography for Directing Human Neural Stem Cells into Functional Neurons. ACS Nano 2014, 8 (8), 7809− 7822. (13) Bai, L.; Du, Z.; Du, J.; Yao, W.; Zhang, J.; Weng, Z.; Liu, S.; Zhao, Y.; Liu, Y.; Zhang, X.; Huang, X.; Yao, X.; Crawford, R.; Hang, R.; Huang, D.; Tang, B.; Xiao, Y. A Multifaceted Coating on Titanium Dictates Osteoimmunomodulation and Osteo/Angio-Genesis towards Ameliorative Osseointegratioxn. Biomaterials 2018, 162, 154−169. (14) Lotz, E. M.; Berger, M. B.; Schwartz, Z.; Boyan, B. D. Regulation of Osteoclasts by Osteoblast Lineage Cells Depends on Titanium Implant Surface Properties. Acta Biomater. 2018, 68, 296− 307. (15) Park, K.-S.; Al Awamleh, A. G. I.; Cho, S.-A. Comparison of Removal Torques between Laser-Etched and Modified Sandblasted Acid-Etched Ti Implant Surfaces in Rabbit Tibias. J. Adv. Prosthod. 2018, 10 (1), 73−78. (16) Maher, S.; Kaur, G.; Lima-Marques, L.; Evdokiou, A.; Losic, D. Engineering of Micro- to Nanostructured 3D-Printed Drug-Releasing Titanium Implants for Enhanced Osseointegration and Localized
ASSOCIATED CONTENT
* Supporting Information S
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsabm.8b00017. Additional characterization data, videos (ZIP)
■
REFERENCES
AUTHOR INFORMATION
Corresponding Authors
*E-mail:
[email protected]. *E-mail:
[email protected]. ORCID
Mengfei Yu: 0000-0002-7700-4697 Lingqing Dong: 0000-0002-2203-3212 Kui Cheng: 0000-0003-4828-6450 Wenjian Weng: 0000-0002-9373-7284 Author Contributions §
These authors contributed equally to this work. M.Y. and L.D. conceived and designed the experiments. M.Y. and Y.L. carried out the experiments. M.Y., Y.L., Y.L. Y.Z., C.L., L.D., K.C., W.W., and H.W. analyzed the data. L.D. and M.Y. wrote the manuscript. The manuscript was commented by all authors. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was financially supported by the National Natural Science Foundation of China (51502262, 81600838, 81670972, 51772273, 51472216, 81501607), Key Research and Development Program of Zhejiang, China (2017C01054, 2018C03062), the 111 Project under Grant No. B16042, the Medical Technology and Education of Zhejiang Province of China (2016KYB178, 2018KY501), the Zhejiang Provincial Natural Science Foundation (LY15E020004), the Zhejiang I
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
Article
ACS Applied Bio Materials Delivery of Anticancer Drugs. ACS Appl. Mater. Interfaces 2017, 9 (35), 29562−29570. (17) Zhu, W.; Ma, X.; Gou, M.; Mei, D.; Zhang, K.; Chen, S. 3D Printing of Functional Biomaterials for Tissue Engineering. Curr. Opin. Biotechnol. 2016, 40, 103−112. (18) Gorsse, S.; Hutchinson, C.; Gouné, M.; Banerjee, R. Additive Manufacturing of Metals: A Brief Review of the Characteristic Microstructures and Properties of Steels, Ti-6Al-4V and HighEntropy Alloys. Sci. Technol. Adv. Mater. 2017, 18 (1), 584−610. (19) Li, L.; Yu, F.; Shi, J. P.; Shen, S.; Teng, H. J.; Yang, J. Q.; Wang, X. S.; Jiang, Q. In Situ Repair of Bone and Cartilage Defects Using 3D Scanning and 3D Printing. Sci. Rep. 2017, 7, 9416. (20) Wysocki, B.; Idaszek, J.; Szlazak, K.; Strzelczyk, K.; Brynk, T.; Kurzydlowski, K. J.; Swieszkowski, W. Post Processing and Biological Evaluation of the Titanium Scaffolds for Bone Tissue Engineering. Materials 2016, 9 (3), 197. (21) Vyatskikh, A.; Delalande, S.; Kudo, A.; Zhang, X.; Portela, C. M.; Greer, J. R. Additive Manufacturing of 3D Nano-Architected Metals. Nat. Commun. 2018, 9, 593. (22) Nune, K. C.; Misra, R. D. K.; Gai, X.; Li, S. J.; Hao, Y. L. Surface Nanotopography-Induced Favorable Modulation of Bioactivity and Osteoconductive Potential of Anodized 3D Printed Ti6Al-4V Alloy Mesh Structure. J. Biomater. Appl. 2018, 32 (8), 1032− 1048. (23) Dong, L.; Cheng, K.; Weng, W.; Song, C.; Du, P.; Shen, G.; Han, G. Hydrothermal Growth of Rutile TiO2 Nanorod Films on Titanium Substrates. Thin Solid Films 2011, 519 (15), 4634−4640. (24) Dong, L.; Cheng, K.; Zhou, Y.; Yu, M.; Gong, J.; Lin, Y.; Luo, Q.; Wang, Q.; Weng, W.; Wang, H. Surface Atomic Structure Directs the Fate of Human Mesenchymal Stem Cells. ACS Appl. Mater. Interfaces 2017, 9 (18), 15274−15285. (25) Taormina, G.; Sciancalepore, C.; Messori, M.; Bondioli, F. 3D Printing Processes for Photocurable Polymeric Materials: Technologies, Materials, and Future Trends. Polymers 2018, 10, 2280800018764770−2280800018764770. (26) McOwen, D. W.; Xu, S.; Gong, Y.; Wen, Y.; Godbey, G. L.; Gritton, J. E.; Hamann, T. R.; Dai, J.; Hitz, G. T.; Hu, L.; Wachsman, E. D. 3D-Printing Electrolytes for Solid-State Batteries. Adv. Mater. (Weinheim, Ger.) 2018, 30, e1707132−e1707132. (27) Shah, F. A.; Omar, O.; Suska, F.; Snis, A.; Matic, A.; Emanuelsson, L.; Norlindh, B.; Lausmaa, J.; Thomsen, P.; Palmquist, A. Long-Term Osseointegration of 3D Printed CoCr Constructs with an Interconnected Open-Pore Architecture Prepared by Electron Beam Melting. Acta Biomater. 2016, 36, 296−309. (28) Li, Z. H.; Liu, C.; Wang, B. F.; Wang, C. Y.; Wang, Z. H.; Yang, F.; Gao, C. H.; Liu, H.; Qin, Y. G.; Wang, J. C. Heat Treatment Effect on the Mechanical Properties, Roughness and Bone Ingrowth Capacity of 3D Printing Porous Titanium Alloy. RSC Adv. 2018, 8 (22), 12471−12483. (29) Li, W.; Liou, F.; Newkirk, J.; Taminger, K. M. B.; Seufzer, W. J. Investigation on Ti6Al4V-V-CrFe-SS316 Multi-layers Metallic Structure Fabricated by Laser 3D Printing. Sci. Rep. 2017, 7, 7977. (30) Chia, H. N.; Wu, B. M. Recent Advances in 3D Printing of Biomaterials. J. Biol. Eng. 2015, 9, 1. (31) Faia-Torres, A. B.; Guimond-Lischer, S.; Rottmar, M.; Charnley, M.; Goren, T.; Maniura-Weber, K.; Spencer, N. D.; Reis, R. L.; Textor, M.; Neves, N. M. Differential Regulation of Osteogenic Differentiation of Stem Cells on Surface Roughness Gradients. Biomaterials 2014, 35 (33), 9023−9032. (32) McBeath, R.; Pirone, D. M.; Nelson, C. M.; Bhadriraju, K.; Chen, C. S. Cell Shape, Cytoskeletal Tension, and RhoA Regulate Stem Cell Lineage Commitment. Dev. Cell 2004, 6 (4), 483−495. (33) Hu, J.; Hardy, C.; Chen, C.-M.; Yang, S.; Voloshin, A. S.; Liu, Y. Enhanced Cell Adhesion and Alignment on Micro-Wavy Patterned Surfaces. PLoS One 2014, 9 (8), e104502. (34) Yin, C.; Zhang, Y.; Cai, Q.; Li, B.; Yang, H.; Wang, H.; Qi, H.; Zhou, Y.; Meng, W. Effects of the Micro-Nano Surface Topography of Titanium Alloy on the Biological Responses of Osteoblast. J. Biomed. Mater. Res., Part A 2017, 105 (3), 757−769.
(35) Kulangara, K.; Yang, Y.; Yang, J.; Leong, K. W. Nanotopography as Modulator of Human Mesenchymal Stem Cell Function. Biomaterials 2012, 33 (20), 4998−5003. (36) Park, J.; Bauer, S.; Schlegel, K. A.; Neukam, F. W.; von der Mark, K.; Schmuki, P. TiO2 Nanotube Surfaces: 15 nm - An Optimal Length Scale of Surface Topography for Cell Adhesion and Differentiation. Small 2009, 5 (6), 666−671. (37) Teixeira, A. I.; McKie, G. A.; Foley, J. D.; Bertics, P. J.; Nealey, P. F.; Murphy, C. J. The Effect of Environmental Factors on the Response of Human Corneal Epithelial Cells to Nanoscale Substrate Topography. Biomaterials 2006, 27 (21), 3945−3954. (38) Hu, Q.; Ding, Y.d.; Shao, H.; Cong, T.; Yang, X. G.; Hong, X. The Effect of Nano-ZnO Surface Wettability on Modulating Protein Adsorption. IOP Conf. Ser.: Mater. Sci. Eng. 2017, 220, 012019. (39) Ochsenhirt, S. E.; Kokkoli, E.; McCarthy, J. B.; Tirrell, M. Effect of RGD Secondary Structure and the Synergy Site PHSRN on Cell Adhesion, Spreading and Specific Integrin Engagement. Biomaterials 2006, 27 (20), 3863−3874. (40) Keselowsky, B. G.; Collard, D. M.; Garcia, A. J. Surface Chemistry Modulates Focal Adhesion Composition and Signaling Through Changes in Integrin Binding. Biomaterials 2004, 25 (28), 5947−5954. (41) Miller, T.; Boettiger, D. Control of Intracellular Signaling by Modulation of Fibronectin Conformation at the Cell-Materials Interface. Langmuir 2003, 19 (5), 1723−1729. (42) Bachman, H.; Nicosia, J.; Dysart, M.; Barker, T. H. Utilizing Fibronectin Integrin-Binding Specificity to Control Cellular Responses. Adv. Wound Care 2015, 4 (8), 501−511.
J
DOI: 10.1021/acsabm.8b00017 ACS Appl. Bio Mater. XXXX, XXX, XXX−XXX
