Enhancing Electrochemiluminescence of Luminol by Chemically

Subscriber access provided by NEW MEXICO STATE UNIV

Article

Enhancing Electrochemiluminescence of Luminol by Chemically Modifying the Reaction Micro-environment Yali Qiao, Yuan Li, Wen Fu, Zhihui Guo, and Xingwang Zheng Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b02577 • Publication Date (Web): 04 Jul 2018 Downloaded from http://pubs.acs.org on July 5, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Enhancing Electrochemiluminescence of Luminol by Chemically Modifying the Reaction Micro-environment Yali Qiao, Yuan Li, Wen Fu, Zhihui Guo* and Xingwang Zheng Key Laboratory of Analytical Chemistry for Life Science of Shaanxi Province, School of Chemistry and Chemical Engineering, Shaanxi Normal University, Xi’an 710119, P. R. China

ABSTRACT As one of the most efficient and commonly used electrochemiluminescence (ECL) reagents, luminol had been paid much attention by the analysts due to its low excitation potential, simple dissolved oxygen-based co-reactant ECL reaction requirement and the widely analytical applications. However, the ECL performances of luminol on most electrode materials suffered from the lower ECL quantum yield, which limited its analytical applications. Herein, it was firstly found that, compared to that of the bare gold electrode, the ECL quantum yields of luminol on the 1,6-hexanedithiol hydrophobic pinhole film modified gold electrode was 3 times increased. This higher ECL quantum yield of luminol was related to the hydrophobic micro-environment on the surface of the modified electrode, which was formed from the hydrophobic carbon chains based on their supra-molecular interaction. Based on this new finding as well as the cap effect of gold nanoparticle to these pinholes gate, a highly sensitive ECL sensing scheme for microRNA was also developed. Key words: self-assembly electrode; pinholes film; electrochemiluminescence; luminol; gold electrode;

INTRODUCTION In recent years, electro-generated chemiluminescence, or electrochemiluminescence (ECL), has been used in a variety of fields such as clinical diagnostics, immunological analysis, and environmental monitoring due to its simplicity, high sensitivity, wide dynamic concentration response range and the better potential as well as spatial controllability.1-5 Up to now, many ECL 

Corresponding Author. Fax: +86 29 81530727.

E-mail addresses: [email protected], [email protected]; [email protected] 1

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 18

systems such as tris(2,2′-bipyridyl) ruthenium (II),6-11 luminol,3,4,12-14 lucigenin15 and quantum dots1,2,16-19 have been widely explored for analytical application. Of these ECL systems, except for the tris(2,2′-bipyridyl) ruthenium (II), the luminol ECL system was also paid much attention by the analysts since luminol ECL system possess the following advantages: firstly, the ECL reaction potential of luminol on the conventional electrodes is low and presents the multi-potential inducing ECL reactions feature; In addition, except for the lower cost, luminol has good water solubility; More importantly, compared to other ECL systems, the dissolved oxygen can be used as the co-reactant of the luminol ECL reaction on conventional electrode materials. It is environmentally friendly co-reactants and do not present any other side effects such as the higher background noise, the side interaction of the co-reactant with DNA probes or proteins as in the cases of using H2O2 as the ECL co-reactants for bio-assays.13,18,20 However, the luminol ECL system still suffers from several problems. Firstly, compared to the hydrophobic organic phase, the ECL quantum yield of luminol in water phase is obviously low, which limits the sensitivity of luminol ECL system in bioanalysis. Secondly, due to the electro-polymerizing behavior of luminol as well as the stronger adsorption effect of luminol on conventional electrode materials surface, the ECL reproducibility of luminol is also poor on conventional electrode. Therefore, the new idea to overcome these limitations of luminol ECL reaction on conventional electrode is desirable. In principle, the ECL reaction of electrogenerated luminol radical with dissolved oxygen in the bulk solution occurred in the reaction layer of the electrode surface. Thus, the microenvironment of reaction layer, such as its polarity, rigidity, hydrophilicity, etc., should have great impact on the luminescence behaviors of luminol-O2 ECL reaction. Furthermore, the ECL quantum yield of luminol were closely related to the chemiluminescence (CL) reaction conditions, since luminol presented the different CL performances in different reaction solution mediums.2,13,21-23 For example, Lee and coworkers21 reported that the CL quantum yield of luminol in aprotic solvents was higher than that in aqueous solution (0.01 in water and 0.05 in DMSO). Previous studies reported that the electrodes modified with Au or Pt metal nanoparticles could lead to 2-3 orders of ECL emission enhancement of luminol.22,23 So the chemical modification of the electrode reaction layer micro-environment to achieve the optimum condition of the luminol CL reaction is desirable. Up to now, although many novel ideas, which based on chemically modified electrode technique 2


Page 3 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


combining with luminol ECL reaction for electro-catalyzing oxidation, pre-concentrating analytes, etc.,3,13,24-26 have been developed, no work concerned the use of the chemically modified electrode technique to create a suitable CL reaction microenvironment for improving the analytical performances of luminol ECL reaction. On the other hand, self-assembled monolayers (SAMs) of alkanethiolates on gold form well-ordered films and have been widely studied for applications including biosensing and biocompatibility due to their fascinating electrochemical, electrocatalytic, redox reactive, molecule-identifying and biocompatible properties.27-34 Although some research groups have reported the combination of luminol ECL sensing methods with the SAMs modified electrodes, these works mainly focused on the immobilization of DNA probes or nanomaterials on gold basic electrodes.2,13,35,37 The study about improving the ECL reaction quantum yields of luminol has not yet been reported until now. In this study, the hydrophobic pinhole film modified gold electrode was prepared by self-assembling 1,6-hexanedithiol on gold electrode in the water-alcohol mixing medium. The ECL behaviors of luminol on the modified gold electrode were firstly investigated by the electrochemical and ECL methods. Our results showed that, compared with the bare gold electrode, the hydrophobic pinhole film electrode exhibited the higher ECL quantum yield of the luminol ECL system. This ECL quantum yield enhancement was found to be depended on hydrophobic micro-environment on the electrode surface, which was formed from the hydrophobic alkyl chains based on their supra-molecular interaction. Based on this new finding as well as the stronger ECL quenching effect of unmodified gold nanoparticles to luminol ECL, a highly sensitive ECL scheme for microRNA was developed as the model of analytical application. Under optimum condition, the 3.0 fM detection limit for miRNA was achieved. It is anticipated that the proposed strategy will lay a foundation for miRNA expression to be profiled in a decentralized setting such as at point-of-care.

EXPERIMENTAL SECTION Materials and Reagents. 1,6-hexanedithiol (HS(CH2)6SH), trisodium citrate dihydrate and hydrogen tetrachloroaurate (III) hydrate (HAuCl4·3H2O) were used as received (Sigma-Aldrich). RNase-free water was purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). 3



Page 4 of 18

HPLC-purified miRNA and all synthetic oligonucleotides were obtained from Sangon Biotech (Shanghai, China). The sequences of all RNA and DNA used were available in Table 1. Trizol Reagent was purchased from Invitrogen (Beijing, China). Chloroform and isopropyl alcohol were obtained from Tianjin Fuyu Fine Chemical Co., Ltd. All other chemicals were of analytical grade. All aqueous solutions were prepared using 18.3 MΩ-cm water with total organic carbon (TOC)≤5ppb from the Milli-Q Advantage A10 system. The buffer solution used in this work were as follows: DNA stock solutions buffer (10 mM Tris-HCl containing 100 mM NaCl, pH 7.4), Fe(CN)63-/4- solution (5.0 mM Fe(CN)63-/4- in 0.1 M phosphate buffer solution containing 0.1 M KCl, pH 7.4). Table 1. Sequence of Synthesized Oligonucleotides Probes Used in This Work oligonucleotide

sequence (from 5′ to 3′)

probe

AACTATACAACCTACTACCTCA

Target miRNA (let-7a)

UGAGGUAGUAGGUUGUAUAGUU

let-7b

UGAGGUAGUAGGUUGUGUGGUU

let-7f

UGAGGUAGUAGAUUGUAUAGUU

let-7g

UGAGGUAGUAGUUUGUACAGU

let-7i

UGAGGUAGUAGUUUGUGCUGUU

Probe is completely complementary with the 5′ end of TD. The underlined bases are the mismatched. bases.

Instrumentals. Electrochemical experiments were performed at room temperature with an electrochemical analyzer (CHI 660C, Chenhua Inc., China) using a three-electrode cell (capacity, 5 mL; diameter, 25 mm). Bare or modified gold working electrode, Ag/AgCl reference electrode, and platinum counter electrode were used for all electrochemical measurements. The ECL experiments were carried out with a MPI-A ECL analytical system (Xi’an remax electronic science Tech. Co. Ltd. China) with a R456 photomultiplier (PMT) (Xi’an remax electronic science Tech. Co. Ltd. China) for transforming ECL emission into electrical signals. Transmission Electron Microscopy (TEM) image of the gold nanoparticles was performed using a JEM-2100 TEM (Hitachi, Japan). The interaction between gold nanoparticles and ssDNA or dsDNA was characterized by a UV-vis spectrophotometer (TU1901, China). Total RNA extration. The human breast adenocarcinoma cells (MCF-7) which were cultured in DMEM were used in this study. Total RNA samples were isolated from these cell lines by using Trizol Reagent according to the manufacturer’s recommended protocol. The total RNA was 4


Page 5 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dispersed into 1.0 mL 10 mM Tris-HCl buffer solution containing 0.1 M NaCl (pH 7.4) prepared by RNase-free water. Preparation of Au nanoparticles. Au nanoparticles (Au NPs) were prepared by the citrate reduction of HAuCl4 method as previously reported.38 All glassware used in these preparations was soaked in aqua regia (VHNO3 : VHCl = 1:3), thoroughly rinsed in distilled H2O, and oven-dried prior to use. In a typical experiment, a 2.5 mL of 38.8 mM sodium citrate was rapidly added to boiling solution of HAuCl4 (25 mL, 1.0 mM). After the solution color changed from pale yellow to burgundy, the reaction mixture was allowed to reflux for 15 min. Then the solution reached room temperature, filtered, and stored in amber laboratory bottle at 4 °C before use. The concentrations of the Au NPs solutions were determined using the absorbance values in conjunction with the calculated extinction coefficient (ε520 ≈ 5.72×108 M-1 cm-1) using a method reported previously.39 The final particle concentration for this preparation was 2.7 nM. Preparation of the 1,6-hexanedithiol modified Au electrode (HMAE). Gold electrodes (2 mm in diameter, GSRL Instruments Inc.) were first polished with 0.3 μm and 0.05 μm alumina powder, then sonicated in ethanol and ultrapure water for 5 min, respectively. Finally, the well-polished electrodes were subjected to electrochemical pretreatment by cycling the potential between -0.2 and 1.5 V in H2SO4 (0.5 M) at a scan rate of 100 mV·s-1 until a stable cyclic voltammogram was obtained. Afterwards, cleaned Au electrodes were immersed into water-ethanol solution containing 1,6-hexanedithiol (10 mM) overnight at room temperature. The HMAEs were thoroughly rinsed with ethanol and doubly ultrapure water before electrochemical measurement. Au NPs-ssDNA or Au NPs-DNA/RNA heteroduplex solution assembled on the HMAE. The treatment, hybridization and assemble of oligonucleotides were performed as previously reported.38 Measurement procedure. The resulting electrode was inserted into the ECL cell including 3 mL of luminol solution, and the relating ECL signals were recorded when the electrode potential was scanned from 0 to 0.5 V at the scan rate of 100 mV• s−1. The voltage of PMT was set at -800 V in the process of detection.

RESULTS AND DISCUSSION The preparation of the pinhole film modified Au electrodes. The preparation of the pinhole film modified electrode was carried out by self-assembly of a suitable concentration of 5



Page 6 of 18

1,6-hexanedithiol on Au electrode. The CV behaviors of the modified electrode were characterized using the Fe(CN)63-/4- as the electrochemical probe. As shown in Figure 1, a couple of quasi-reversible, well defined redox peaks of Fe(CN)63-/4- were observed on the bare Au electrode (curve a in Figure 1). While the higher concentration 1,6-hexanedithiol was used to prepare the pinhole film electrode, no voltammetric peaks were recorded at the HMAE (curve f in Figure 1). This results suggested that the compact and pinhole-free self-assembled monolayers (SAMs) was formed onto the Au substrate with alkanethiols due to the formation of strong Au-S bond and the strong hydrophobic interactions between the hydrocarbon chains.

Figure 1. Cyclic voltammograms of bare Au electrode (a) and 1,6-hexanedithiol modified electrode with different 1,6-hexanedithiol concentration (b-f) in 5.0 mM Fe(CN)63-/4- solution. The concentration of 1,6-hexanedithiol from curve b to curve f was 10 μM, 30 μM, 70 μM, 90 μM and 1 mM, respectively. Scan rate: 100 mV·s-1.

However, while different lower concentration of 1,6-hexanedithiol were used to prepare the pinhole film electrode, our results showed that, as the decreasing of 1,6-hexanedithiol concentration, the CV responses of the resulting electrodes gradually increased obviously (curve b-e in Figure 1). The possible reason may be explained as followings: while the lower concentration 1,6-hexanedithiol was used to prepare the modified electrode, due to the strong interaction between thiol group and gold substrate, the 1,6-hexanedithiol molecules could be strongly self-assembled on the gold electrode. However, since the lower concentration of 1,6-hexanedithiol used, these self-assembled state 1,6-hexanedithiol molecules were seperated from each other. In this case, some bare gold substrate was not occupied by 1,6-hexanedithiol molecules and exposed to Fe(CN)63-/46


Page 7 of 18

molecules, so the higher current response was observed. So our above-mentioned results indicated that the lower concentration 1,6-hexanedithiol could be used to prepare the pinhole film electrode. The ECL reaction potential choice of luminol on the pinhole film electrode surface. Due to the easily electro-oxidation feature of thiol groups on 1,6-hexanedithiol at gold electrode, we focus on the studies of the luminol’s ECL stability with different applied potentials. The CV results in Figure 2A showed that while the end potential range was changed from the 0.3 V to 0.5 V and the starting potential was fixed at 0 V, an irreversible oxidation peak was occurred at about 0.2 V. This is corresponding to the electro-oxidation of luminol at basic gold electrode. Meanwhile, the related ECL signals were also observed, and the ECL intensities increased with the increasing of the end potential (as shown in a, b, c of Figure 2B); Above 0.5 V of end potential, two new irreversible oxidation peaks, generated at about 0.35 V and 0.65 V, were also observed. Of note, at this high potential range, the background current was also greatly increased. These results suggested that, except for the electrochemical oxidation of luminol, the thiol groups on 1,6-hexanedithiol were also partly electro-oxidation. The self-assembled film was partly destroyed at 0.65 V potential. In this case, the related ECL signals presented the poor stability (as shown in d, e, f of Figure 2B) since the self-assembled film structure was destroyed and the micro-environment of ECL reaction was changed. All of these results above indicated that: although the luminol molecules could permeate these pinholes structure film to do their ECL reaction at the basic gold electrode, the applied potentials should be lower than 0.6 V. In this case, this modified electrode could produce the stable ECL signals. Thus, the 0.5 V end potential was further used to explore the ECL behaviors of luminol at

-6

8.0x10

A

-7

2.0x10 0.0

Current/A

-5

1.0x10

-6

6.0x10

-6

4.0x10

-6

2.0x10 0.0 -6

-2.0x10

-6

-4.0x10

The relative ECL intensity

self-assembled film electrode in the subsequent work.

Current/A

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


-2.0x10

-7

-4.0x10

-7

-6.0x10

-7

-8.0x10

-7

-1.0x10

-6

-1.2x10

-6

-1.4x10

-6

-1.6x10

-6

-1.8x10

-6

0.0

0.1

0.2

0.3

0.4

0.5

Potential/V

a

f

-6

-6.0x10

-6

-8.0x10

-5

-1.0x10

-0.1 0.0 0.1

0.2 0.3 0.4 0.5 0.6

2500

B

1500

e

1000

f

b

500

a

0 0

0.7 0.8 0.9

d

c

2000

20

40

60

80

Time/s

Potential/V

7


100

120

140


Figure 2. The electrochemical (A) and ECL performances (B) of luminol at the 1,6-hexanedithiol modified electrode with different applied end potentials. The end potential of a-f was 0.3, 0.4, 0.5, 0.6, 0.7 and 0.8 V, respectively.

The ECL enhancement of luminol on 1,6-hexanedithiol modified electrode.. The effect of 1,6-hexanedithiol self-assembled time and the pinhole structure on the ECL of luminol at the resulting electrodes was studied. Firstly, the relationship between the ECL signals and the 1,6-hexanedithiol self-assembling time on electrode was studied by ranging self-assembling time from 12 h to 20 h. 1.5

B a

1.2

-6 Current / 10 A

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 18

0.9 0.6 0.3

f

0.0 -0.3 -0.6 0.0

0.1

0.2

0.3

0.4

Potential / V

0.5

0.6

0.7

Figure 3. The ECL signals (A) and the corresponding cyclic voltammograms (B) of luminol on the 1,6-hexanedithiol modified Au electrode upon self-assembly of 1,6-hexanedithiol with different time from curve a to curve f was 0, 12, 14, 16, 18 and 20 h, respectively. Scan rate: 100 mV·s-1.

As shown in Figure 3A, the modified electrodes produced the higher obviously ECL signals than that of bare electrode while the 1.0×10-5 M of 1,6-hexanedithiol self-assembled time was changed from 12 h to 20 h. The modified electrode using 16 h self-assembling time presented the strongest ECL signal, which was about 13 times higher than that of bare gold electrode. Whereas, their related CV response of these investigated electrodes was also recorded in Figure 3B. These CV results showed that, as the 1,6-hexanedithiol self-assembling time increasing, the irreversible electrochemical oxidation currents of luminol on these modified electrodes were obviously decreased. The main reason should be ascribed to the decreasing of gold electrode surface, because a lots of 1,6-hexanedithiol molecules were immobilized on gold electrode surface with the self-assembled time increasing from 12 h to 20 h and occupied lots of gold electrode surface based on the stronger S-Au chemistry. In this case, based on the stronger hydrophobic carbon chains supra-molecular interaction between 1,6-hexanedithiol molecules, the pinhole structural 8


Page 9 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1,6-hexanedithiol film were formed on gold electrode surface. Due to the typical hydrophobic property of pinhole channel, some luminol molecules could go through this pinhole channel to reach the gold electrode surface because of the hydrophobic property of luminol molecules. So the electro-oxidation currents of luminol on these pinhole structure films electrode surface was decreased, respectively, especially compared to that of bare gold electrode. However, compared to that of bare gold electrode, the ECL signals on these pinhole structural films electrode surface enhanced greatly although the amount of luminol electrochemical oxidation on these self-assembled film electrodes was decreased. This result indicated that, the ECL reaction micro-environment on pinhole structural film electrode was changed. While a suitable number of 1,6-hexanedithiol molecules were self-assembled on gold electrode surface, the formed pinhole structure was favorable to the luminescence micro-environment of luminol ECL emitter, which should similar to that of the chemiluminescence reaction of luminol in hydrophobic medium. However, as the self-assembling time was further increased from 16h to 20h, the stronger hydrophobic electrode surface micro-environment is unfavorable for the access of luminol to electrode, thus the ECL signals decreased slowly. In this case, this ECL enhancing mechanism could be

described in scheme 1. We measured the relative ECL quantum yield by the ratio of the ECL intensity/the number of the electrochemically oxidized luminol molecules using the bare electrode as the standard. Specifically, the voltammetric responses of luminol at bare and 1,6-hexanedithiol modified gold electrode were obtained, respectively. The amount of charge for the oxidation of luminol has been integrated for both bare and modified electrode. According to the equation (1), the number of the electrochemically oxidized luminol molecules was roughly calculated using the difference of the integrated charge between luminol and blank solutions (Q):

Scheme 1. Illustration of the luminol ECL enhancing mechanism on the 9



Page 10 of 18

1,6-hexanedithiol self-assembled Au electrode.

nlu min ol 

Q zF

(1)

Where nluminol is the number of luminol molecules, z is the number of electrons transferred per molecule, F is Faraday’s constant. According to the equation (2), the ECL quantum yield (Φ) was calculated using the luminol ECL intensity obtained at bare and modified gold electrode.

 k

I ECL

(2)

nlu min ol

The results of the relative ECL quantum yield of luminol were shown in table 2, which indicated the ECL quantum yield obtained at 1,6-hexanedithiol modified electrode was about 3 times higher than that obtained at the bare electrode. Table 2 the relative ECL quantum yield of luminol ΔECL

Q

Bare electrode

178

0.67

1,6-hexanedithiol modified electrode

550

0.56

Φ’(Φmodified/Φbare) 3.70

To clarify the fact that the enhanced ECL signal resulted from the favorable micro-environment for luminol ECL reaction provided by hydrophobic pinhole channel rather than the catalyst effect of the thiol of 1,6-hexanedithiol. 1,6-hexanedithiol was replaced by CTAB molecules. The amino terminal end of the CTAB molecule is a binding site for gold electrode and the carbon chain provide a hydrophobic interface. The electrochemical and ECL behaviors of luminol at CTAB modified electrode were investigated. Figure S1 showed that the ECL intensity of luminol at CTAB modified electrode was obvious higher than that at bare electrode, while the current of luminol gradually decreased with the increasing of CTAB concentration. This results indicate the increasingly hydrophobicity from CTAB contribute to the enhancement of luminol ECL because the CL quantum yield of luminol in hydrophobic solvents is higher than in aqueous solution. In addition, in the present work, the end potential was lower than 0.6V, in this case, the thiol group on the gold electrode in stable, they did not take part in the ECL reaction. The effect of the carbon chain length of alkanethiolates on luminol ECL behaviors. To 10


Page 11 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


investigate the effect of the carbon chain length of alkanethiolates on luminol ECL behaviors, 1,3-dimercaptopropane (C3), 1,6-hexanedithiol (C6), and 1,9-Dimercaptononane (C9) were used to prepare the pinhole film and the corresponding lumonl ECL behaviors were studied, respectively (as shown in figure S2). The results showed that luminol ECL intensity was enhanced greatly at C3 and C6 modified gold electrode compared with that obtained at bare gold electrode, which can be ascribed to the formation of hydrophobic microenviroment. However, the luminol ECL intensity was inhibited at C9 modified gold electrode because the compact C9 film made it difficult for luminol molecules to access to the electrode surface. Compared with C3, the stronger hydrophobility of C6 resulted in the greater enhancement of luminol ECL signal. So, in this work, 1,6-hexanedithiol (C6) was selected to modify gold electrode and form hydrophobic microenviroment. The stronger ECL decreasing effect of gold nanoparticles to luminol at the pinhole film modified electrode. Because the gold nanoparticles (NPs) owned the strong chemical adsorption at the 1,6-hexanedithiol self-assembled electrode surface based on the S-Au chemistry, so the gold NPs could be self-assembled to the modified electrode to either close the gates of the pinhole channels or quench the luminescence signal of luminol ECL on modified electrode due to the large size and excellent luminescence quenching ability of gold NPs with 13 nm in diameter. The electrochemical impedance spectra (EIS) and CV were used to monitoring the electron transfer ability tunneling through the 1,6-hexanedithiol layer between the electroactive probes and gold electrode. Figure 4b showed the EIS results corresponding with that of CV. The self-assemble of 1,6-hexanedithiol film caused the reduction of current of Fe(CN)63-/4- and the increase of RCT, which confirmed the successful assemble of 1,6-hexanedithiol on Au electrode surface. The increase of current and the decrease of RCT after the immersing of the 1,6-hexanedithiol modified Au electrode in AuNPs solution indicated the successful assemble of AuNPs.

11



Page 12 of 18

Figure 4 Characterization of the self-assembled 1,6-hexanedithiol and AuNPs by CV (a) and EIS (b) at Au electrode.

The surface morphology of pinhole film electrode was investigated by SEM as shown in figure S3. The results indicated that the self-assemble of 1,6-hexanedithiol film made the electrode surface more smooth than that of bare gold electrode. In figure S3 c, gold NPs can be obvious observed after the immersing of the 1,6-hexanedithiol modified Au electrode in AuNPs solution, which further demonstrated the successful assemble of AuNPs. The effect of gold NPs on the ECL of luminol on HMAE was investigated. Our results was shown in Figure 5A, it could be found that, compared to the 1,6-hexanedithiol self-assembled electrode (curve a, in Figure 5A), after the amount of gold NPs on electrode was continuous increased as the increase of self-assembling time, the ECL signals (curves b, c and d of Figure 5A) at the Au NPs/1,6-hexanedithiol film electrode (Au NPs/HMAE) was greatly decreased. At the same time, the ECL-potential curve of luminol on Au NPs/HMAE showed that, the ECL electro-oxidation potential of luminol at the Au NPs self-assembled HMAE electrode still occurred at 0.45 V. It obviously suggested that these ECL signals were generated from the electro-oxidation of luminol at the basic Au electrode through the pinholes inside the self-assembled film, but not from the self-assembled state Au NPs on HMAE. In this case, because the excellently luminescence signal quenching ability of Au NPs to electro-generated excited state luminol, the ECL signal was obviously decreased. Meanwhile, the CV changes were also recorded in Figure 5B. These CV results showed that the current of electrochemical-oxidation luminol on gold NPs modified HAEM electrodes were obviously decreased, compared to that of HAEM electrode. Of note, the decreasing amount of currents was obviously smaller than that of relating ECL signals. This result indicated that, except for the capping effect of gold NPs to these pinhole channels, the ECL quenching effect of the gold NPs to luminol ECL signal on basic electrode was the main reason.

12


1600 1400

A

5.00E-008

a

1200 1000

d

800 600 400 200

Current intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Page 13 of 18

0 -200

B

0.00E+000

d

-5.00E-008

a

-1.00E-007

-1.50E-007

0.0

0.1

0.2

0.3

0.4

0.0

0.5

0.1

0.2

0.3

0.4

0.5

Potential/V

Potential/V

Figure 5. ECL (A) and CV (B) responses of the HMAE to the gold nanoparticles with different self-assembling time on HMAE. (a) 0 min, (b) 40 min, (c) 80 min, (d) 120 min. Luminol concentration was 1.0×10-4 M, gold nanoparticles concentration was 2.0 nM. Scan rate: 100 mV·s-1.

Thus, the luminol ECL signal decreasing effect by gold nanoparticles on HMAE could be used to sensitively detect the miRNA based on our previously designed scheme38 and this new ECL sensing platform for miRNA could be described in Scheme 2. When the concentration of the ssDNA probe was constant, the number of the ssDNA/miRNA duplex would be increased with increasing the concentration of the target miRNA, which could result in the increasing of the free-state Au NPs in solution. In this case, more free-state Au NPs could be pre-concentrated onto the HMAE. Furthermore, due to the closing gate effect and the ECL quenching effect of Au NPs, an ECL signal amplification platform for detecting miRNA was developed. On the contrary, as there was no target miRNA in ssDNA probe solution, the added Au NPs reacted with ssDNA probe and were protected by ssDNA probe, which could not be pre-concentrated on the HMAE. Thus, a stronger ECL signal was observed.

13



Scheme 2. Cartoon Representation of the proposed method for ECL detection of miRNA.

Analytical performances of the assay. Under the optimized conditions (as shown in Figure S4 and S5), the linear range for the determination of target miRNA (let-7a) was investigated. The ECL intensity of different concentration of standard let-7a in the proposed sensing platform were observed and recorded in Figure 6 and Figure S6. The results indicated that when the target miRNA concentration changed from 10 fM to 9.0 pM, the ECL signals (from curve a to curve f) at the HMAE in luminol solution gradually decreased. Meanwhile, the decreasing ECL intensity was linear to the concentration of target miRNA (as shown in the insert of Figure 6, Figure S6). The related regression equation of ECL signals to the concentration of let-7a at 0.1 pM to 0.9 pM and 10 fM to 90 fM was IECL=982.7-106.3Clet-7a (R=0.9838) and IECL=731.8-73.2Clet-7a (R=0.9833), respectively, and a 3.0 fM (S/N = 3) detection limit for let-7a was achieved.

1800

a

1500

800



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 18

1200 900

b

600

600

400

200

0

0

2

4

6

8

10

-14

[let-7a]/1.0*10 M

c

d

300

e

f

0 0

20

40

60

80

100

120

Time/s

Figure 6. ECL responses of the HMAE to 10-13 M ssDNA probe in the presence of different concentration of target let-7a miRNA: (a) 0, (b) 10 fM, (c) 30 fM, (d) 50 fM, (e) 70 fM, (f) 90 fM in 1.0×10-4 M luminol solution. Scan rate: 100 mV·s-1. The resulting calibration plot of insert was Clet-7a vs ECL intensity.

Several let-7 miRNA family members, including let-7b, let-7f, let-7g and let-7i (their sequences was showed in Tabel 1) were selected to evaluate the specificity of the proposed method for miRNA detection. As can be seen from Figure 7, only let-7a induced a great ECL decline and the other four miRNA sequences failed to generate significant ECL signals. It was attributed to Au NPs as indicator presented the good selectivity to distinguish the ssDNA and DNA/miRNA.38,39 These results suggested that our proposed protocol possessed a high specificity to discriminate the complementary target miRNA sequences from nontarget sequences even with only one base difference. 14


Page 15 of 18

100

Relative detection(%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


80 60 40 20 0

let-7a

let-7b

let-7f

let-7g

let-7i

miRNAs

Figure 7. The specificity of the proposed ECL assay under the same conditions. The relative detection of let-7a is normalized to 100%. The concentration of each let-7 miRNA is 100 fM.

Analysis of real samples and evaluation of method trueness. Let-7a extracted from the human breast adenocarcinoma cells (MCF-7) was chosen as the model miRNA target to validate the applicability of the proposed ECL method for the determination of miRNA. The cell samples were pretreated by a total RNA extraction kit after cell counting. The relating ECL signals of the let-7a in sample were tested three times. The concentration of let7a in 3 samples was shown in Table 3 and the relative standard deviation was 3.33%，indicating the high sensitivity and good reproducibility of the proposed ECL method for the determination of let7a. In addition, the standard added method was applied to evaluate its accuracy. The recoveries were ranged from 96.00 % to 106.00% and its RSD was 5.0%, suggesting the good accuracy and acceptable precision of the proposed method. Therefore, our detection mechanism could be considered as an optional scheme for let-7a detection in clinical diagnostics. Table 3. Detection and recoveries results of let-7a in MCF-7 samples Sample No. 1

2

3

addition (10-13 M)

found (10-13 M)

0

2.53

1.0

3.56

0

2.70

1.0

3.76

0

2.65

1.0

3.59

15


recovery %

103.00

106.00

96.00


Page 16 of 18

CONCLUSION In summary, a new strategy of using hydrophobic pinhole film to improve luminol ECL reaction micro-environment for enhancing luminol ECL reaction quantum yield was firstly proposed in this work. Our results demonstrated that the modification of ECL reaction micro-environment on electrode surface was a useful route to greatly enhance ECL signal, and this new idea offered a new angle to design the electrode surface for improving ECL performances, which may be used to design different ECL sensing platforms by using different electrode modifiers. Thus, the proposed idea demonstrated in here could open up a new way for enhancing ECL analytical performances of conventional ECL reagents.

ASSOCIATED CONTENT Supporting Information. The electrochemical and ECL behaviors of luminol at CTAB modified electrode, the investigation on carbon chain length of alkanethiolates, Au NPs concentration and assemble time, the SEM images of bare and modified gold electrode, the calibration curve of let-7a miRNA to 10-12 M ssDNA probe and the comparison of sensitivity. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *Phone/fax: +86-29-81530791. E-mail: [email protected], [email protected]

ACKNOWLEDGMENT This work was financially supported by the projects from National Natural Science Foundation of China (No. 21375085, 21575085).

REFERENCES (1) Shi, C. G.; Shan, X.; Pan, Z. Q.; Xu, J. J.; Lu, C.; Bao, N.; Gu, H. Y. Anal. Chem. 2012, 84, 3033-3038. (2) Dong, Y. P.; Gao, T. T.; Zhou, Y.; Zhu, J. J. Anal. Chem. 2014, 86, 11373-11379. (3) Xu, S.; Liu, Y.; Wang, T.; Li, J. Anal. Chem. 2011, 83, 3817-3823. 16


Page 17 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(4) Wang, J. X.; Zhuo, Y.; Zhou, Y.; Wang, H. J.; Yuan, R.; Chai, Y. Q. ACS Appl. Mater. Interfaces 2016, 8, 12968-12975. (5) Carrara, S.; Aliprandi, A.; Hogan, C. F.; De, Cola, L. J. Am. Chem. Soc. 2017, 139, 14605-14610. (6) Scoot A. M.; Pyati, R. J. Phys. Chem. B 2001, 105, 9011-9015. (7) Yuan, J.; Li, T.; Yin, X. B.; Guo, L.; Jiang, X.; Jin, W.; Yang, X.; Wang, E. Anal. Chem. 2006, 78, 2934-2938. (8) Dang, J.; Guo, Z.; Zheng, X. Anal. Chem. 2014, 86, 8943-8950. (9) Wang, H.; Yuan, Y.; Zhuo, Y.; Chai, Y.; Yuan, R. Anal. Chem. 2016, 88, 2258-2265. (10) Chang, Z.; Wang, Y.; Zheng, X. J. Electroanal. Chem. 2016, 780, 201-208. (11) Yao, X.; Guo Z.; Zheng, X. Anal. Methods 2017, 9, 312. (12) Kitte, S. A.; Gao, W.; Zholudov, Y. T.; Qi, L.; Nsabimana, A.; Liu, Z.; Xu, G. Anal. Chem. 2017, 89, 9864-9869. (13) Zhang, H. R.; Wu, M. S.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2014, 86, 3834-3840. (14) Wang, W.; Xiong, T.; Cui, H. Langmuir 2008, 24, 2826-2833. (15) Gao, W.; Liu, Z.; Qi, L.; Lai, J.; Kitte, S. A.; Xu, G. Anal. Chem. 2016, 88, 7654-7659. (16) Dong, Y.; Zhou, N.; Lin, X.; Lin, J.; Chi, Y.; Chen, G. Chem. Mater. 2010, 22, 5895-5899. (17) Zhang, L.; Zou, X.; Ying, E.; Dong, S. J. Phys. Chem. C 2008, 112, 4451-4454. (18) Zhou, H.; Han, T.; Wei, Q.; Zhang, S. Anal. Chem. 2016, 88, 2976-2983. (19) Zhao, M.; Chen, A. Y.; Huang, D.; Chai, Y. Q.; Zhuo, Y.; Yuan, R. Anal. Chem. 2017, 89, 8335-8342. (20) Haghighi, B.; Tavakoli, A.; Bozorgzadeh, S. J. Electroanal. Chem. 2016, 762, 80-86. (21) Lee. J.; Seliger, H. H. Photochem. Photobiol. 1972, 15, 227-237. (22) Zhang, H. R.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2013, 85, 5321-5325. (23) Cui, H.; Wang, W.; Duan, C. F.; Dong, Y. P.; Guo, J. Z. Chem.—Eur. J. 2007, 13, 6975-6984. (24) Xu, G.; Dong, S. Anal. Chem. 2000, 72, 5308-5312. (25) Dong, Y. P.; Cui, H.; Wang, C. M. J. Phys. Chem. B 2006, 110, 18408-18414. (26) Xiong, H.; Zheng, X. Microchimica Acta 2017, 184, 1781-1789. (27) Khalid, W.; Helou, M. E.; Murböck, T.; Yue, Z.; Montenegro, J. M.; Schubert, K.; Göbel, G.; Lisdat, F.; Witte, G.; Parak, W. J. ACS Nano 2011, 5, 9870-9876. (28) Gao, X.; Geng, M.; Li, Y.; Wang, X.; Yu, H. Z. Anal. Chem. 2017, 89, 2464-2471. (29) Yang, S.; Xu, B., Zhang, J.; Huang, X.; Ye, J.; Yu, C. J. Phys. Chem. C 2010, 114, 4389-4393. (30) Gambardella, A. A.; Feldberg, S. W.; Murray, R. W. J. Am. Chem. Soc. 2012, 134, 5774-5777. (31) Imahori, H.; Hasobe, T.; Yamada, H.; Nishimura, Y.; Yamazaki, I.; Fukuzumi, S. Langmuir 2001, 17, 4925-4931. (32) Speets, E. A.; Ravoo, B. J.; Roesthuis, F. J. G.; Vroegindeweij, F.; Blank, D. H. A.; Reinhoudt, D. N. Nano Lett. 2004, 4, 841-844. (33) Hou, K. Y.; Yu, L.; Severson, M. W.; Zeng, X. J. Phys. Chem. B 2005, 109, 9527-9531. (34) Samanta, D.; Sarkar, A. Chem. Soc. Rev. 2011, 40, 2567-2592. (35) Li, F.; Yu, Y.; Cui, H.; Yang, D.;Bian, Z. Analyst 2013, 138, 1844-1850. (36) Zhang, P.; Wu, X.; Yuan, R.; Chai, Y. Anal. Chem. 2015, 87, 3202-3207. (37) Tian, D.; Duan, C.; Wang, W.; Cui, H. Biosens. Bioelectron. 2010, 25, 2290-2295. (38) Li, Y.; Tian, R.; Zheng, X.; Huang, R. Anal. Chim. Acta 2016, 934, 59-65. (39) Taton, T. A.; Mirkin, C. A.; Letsinger, R. L. Science 2000, 289, 1757-1760. 17



for TOC only

18


Page 18 of 18

Enhancing Electrochemiluminescence of Luminol by Chemically

Recommend Documents