Enhancing the Cell-Biological Performances of Hydroxyapatite

Subscriber access provided by Kaohsiung Medical University

Characterization, Synthesis, and Modifications

Enhancing the cell-biological performances of hydroxyapatite bioceramic by constructing silicate-containing grain boundary phases via sol infiltration Yubin Xu, Teliang Lu, Fupo He, Ning Ma, Jiandong Ye, and Tingting Wu ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.8b00697 • Publication Date (Web): 10 Aug 2018 Downloaded from http://pubs.acs.org on August 11, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Enhancing the cell-biological performances of hydroxyapatite bioceramic by constructing silicate-containing grain boundary phases via sol infiltration Yubin Xu, a,b Teliang Lu, a,b Fupo He, c Ning Ma, a,b Jiandong Ye,*, a,b Tingting Wu d a

School of Materials Science and Engineering, South China University of Technology,

Guangzhou 510641, China b

National Engineering Research Center for Tissue Restoration and Reconstruction, Guangzhou

510006, China c

School of Electromechanical Engineering, Guangdong University of Technology, Guangzhou

510006, China d

Center of Joint Surgery and Sports Medicine, Institute of Orthopedic Diseases, The First

Affiliated Hospital, Jinan University, Guangzhou 510630, China *Corresponding author. E-mail address: [email protected] (J. Ye)

Abstract

Hydroxyapatite (HA) is well-known as one of excellent bone repair biomaterials because of its chemical similarity with biological apatite. However, weak bioactivity obstructs its application. Although the bioactivity of HA bioceramic could be enhanced by the incorporation of bioactive glass (BG), dramatic decrease of its mechanical property always is a disturbance to the reliable efficacy of traditional modified HA bioceramic. In this study, HA bioceramic was modified by

ACS Paragon Plus Environment

1

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

infiltration of BG sol and formation of silicate-containing grain boundary phases during subsequent sintering. The phase compositions, microstructure, mechanical performance, in vitro degradation behaviors and osteogenesis of the bioceramic were investigated. The modified HA bioceramic exhibited an interesting phenomenon that the HA grains were uniformly enveloped by the small silicate-containing grains in the boundaries of HA grains. The microporosity of modified HA bioceramics was up to 25.27% ± 0.01%, much higher than that of unmodified HA bioceramic (1.74% ± 0.27%). The compressive strength of the modified HA bioceramic via BG sol infiltration was much higher than that of the HA bioceramic modified by BG via mechanical blending method, though slightly lower than that of the blank. Moreover, mouse bone mesenchymal stem cells (mBMSCs) cultured on modified bioceramic displayed better adhesion morphology and proliferation, and had an enhanced expression of osteogenesis-related genes. This study offers a new strategy to improve the bioactivity of HA bioceramic without obvious deterioration in mechanical strength.

Keywords Hydroxyapatite; silicate; grain boundary phase; microporous; osteogenesis. 1. Introduction Hydroxyapatite (HA) has been extensively applied to clinical bone defects repair, by virtue of its chemical similarity with biological apatite in the human bone.1 The intrinsic bioactivity of HA bioceramic allows for forming chemical bonding in the tissue-HA implant interface.2 However, this bonding is built very slowly due to the thermodynamic stability and poor biodegradation of HA.3 Even implanted in patients for 6-7 years, no visible signs of the biomaterial reabsorption were detected.4 Moreover, the sintered HA bioceramic lacks the ability to simulate bone regeneration.


2

Page 3 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The bioactivity of HA bioceramic can be improved by various methods, such as trace elements doping5 and introduction of bioactive factors,6 biopolymer7 and bioactive glass (BG),8 etc. The silicate-based BG is also a well-known bone repair material, and it presents higher bioactivity than calcium phosphate materials.9 The excellent bioactivity of BG is ascribed to the role of silicon in the surface reaction, which is closely associated with crystallization of carbonate hydroxyapatite.10 As soon as BG is soaked in the liquid, the ions begin to escape from BG quickly. Benefiting from the role of silicon, bioactive reactions between the bone tissue and implant occur quickly in a few minutes,10 while it requires several days for HA bioceramic.11 In the early stages of biological mineralization, silicon plays as an active site for bone calcification;12 this favors the adhesion and proliferation of osteoblast-like cells and collagen production.13 Moreover, it has been proved that silicon plays an important role in stimulating osteogenic differentiation of primary human osteoblast cells into the mature phenotype.14 However, the noticeably high pH value of microenvironment induced by BG restricts the wide application of single BG. R , was first introduced into HA by Santos et al.15 Since The silicate-based BG, 45S5 Bioglass○

then, intense interest of numerous researchers has been aroused to combine HA with silicate-based BG to enhance the bioactivity HA bioceramic. Demirkiran et al.16 sintered HA ceramics with the R ; they found that bioceramics with 10 wt.% and 25 wt.% bioglass had addition of 45S5 Bioglass○

the highest cell proliferation rate and ALP activity, respectively. Padilla et al.17 reported that an apatite-like layer could be formed on the surface of composites of HA and silicate-based BG when soaking in simulated body fluid for 3 days, and the osteoblastic-like cells cultured on the surface of composites exhibited preferable attachment, spread and proliferation. However, the introduction of silicate-based BG would lead to a sharp decrease in the mechanical strength of the composite HA ceramics. In general, these composites are prepared by the mechanical blending of HA and


3


Page 4 of 28

BG. The non-uniform dispersion and poor bonding between HA and BG are responsible for the deteriorated mechanical strength.8 This study aimed to enhance the bioactivity of HA bioceramic while maintaining appropriate mechanical strength with the aid of silicate-containing grain boundary phases. BG sol was infiltrated into the pre-sintered HA matrix, and subsequently subjected to sintering at high temperatures. The effects of silicate-containing grain boundary phases on the phase, microstructure, mechanical performance, in vitro degradation behaviors and osteogenesis of silicate-containing boundary phases modified HA (SiHA) bioceramic were investigated. 2. Materials and methods 2.1 Preparation of SiHA bioceramics 58S-BG sol was synthesized following the protocol by Lei et al.18 In brief, 25 g tetraethyl orthosilicate (Aladdin Industrial Corporation) was hydrolyzed in 20 mL deionized water, and the pH value was kept in 1-2 by adding HNO3 solution (0.1 M, Guangzhou Chemical Reagent Factory). Then, 2.9 g triethyl phosphate (Aladdin Industrial Corporation) and 17 g Ca(NO3)2·4H2O (Guangzhou Chemical Reagent Factory) were successively added into the solution with stirring until the solution was clarified. The BG sol was obtained. The HA powder was obtained by mixing the solutions of (NH4)2HPO4 (0.3 M, Guangzhou Chemical Reagent Factory) and Ca(NO3)2·4H2O (0.5 M) under constant stirring conditions (350 rpm). The reaction solution was adjusted to be alkaline (pH 10-11) using NH3·H2O (Guangzhou Chemical Reagent Factory). After being aged for 24 h and lyophilized, the obtained precursor was calcined in a muffle furnace with a heating rate of 5 °C min−1, and dwelled at 900 °C for 2 h, then cooled down to the room temperature, and the HA powers were obtained. The HA powder was filled in a columnar die and pressed at a pressure of 30 MPa and the obtained columned samples were isostatically pressed with a pressure of 200 MPa for 2 min. Then the green


4

Page 5 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bodies were calcined at 1000 °C and 300 °C respectively to get pre-sintered bodies with different porosities. The pre-sintered bodies were immersed in BG sol for 60 min under -100 kPa. After being dried at room temperature, 60 °C and 120 °C each for 24 h, the samples were sintered at 1150 °C for 120 min. The HA bioceramic, which was neither pre-sintered nor infiltrated, was named HA-0. The SiHA bioceramics pre-sintered at 1000 °C and 300 °C were labelled as SiHA1000 and SiHA-300, respectively. 2.2 Physicochemical characterization The phase composition of bioceramic was characterized by an X-ray diffractometer (XRD; X′Pert PRO, PANalytical, the Netherland). The diffraction angle (2θ) ranging from 10° to 60° was scanned with a step size of 0.0166°. The morphology of the bioceramics after polished and thermally etched at 1000 °C was observed by scanning electron microscopy (SEM; Merlin, Zeiss, Germany) with an energy disperse spectroscope (EDS; X-MaxN20, Oxford, England). The chemical composition and element content were determined with Fourier transform infrared spectroscopy (FTIR; Avatar 360, Nicolet, USA) and X-ray fluorescence (XRF; AXIOS, PANalytical the Netherlands), respectively. Compressive strength of the samples (5 mm × 5 mm × 12 mm) was measured by a universal material testing machine (Instron 5567, Istron, USA) with a cross head speed of 0.2 mm min-1. The apparent porosity and bulk density of the bioceramics were determined by a specific gravity balance (Sartorius, Germany). At first, the dry weight (𝑊1 ) of a sample was measured. Then the sample was placed in water and vacuumized for 30 min. The sample was suspended in water with a halter, and the weight of suspended sample was recorded as W2. Subsequently, the sample filled with water was lightly wiped with a moistened cotton, and its weight was recorded as W3. The apparent porosity (𝑃) and bulk density (𝐷) were calculated using follow formulas, respectively: 𝑃 = (𝑊3 − 𝑊1 )⁄(𝑊3 − 𝑊2 ) × 100% ACS Paragon Plus Environment

(1) 5


𝐷 = 𝑊1 × 𝜌0 ⁄(𝑊3 − 𝑊2 )

Page 6 of 28

(2)

𝜌0 : The density of water, 𝜌0 = 0.9982 𝑔 ∙ 𝑐𝑚−3 at 20 C. 2.3 In vitro degradation After measurement of the initial weight (𝑊0 ), HA bioceramic disks (Ф7 mm × 1.5 mm) were immersed in Tris–HCl buffer solution (0.5 M; pH = 7.4) with a sample weight to liquid volume ratio of 0.02 g/mL. The samples were then continuously shaken in a shaker (THZ-103B, Yiheng, China) at a rate of 60 rpm and at 37 °C for 1, 3, 5, 7, 14 and 21 days. At each time point, the pH value of the soak solution was measured using a pH meter (PB-10, Sartorius, Germany) and the desiccated bioceramic disks were weighted as 𝑊𝑑 . The weight loss (𝑊𝐿 ) was calculated as follow: 𝑊𝐿 = (𝑊0 − 𝑊𝑑 )⁄𝑊0 × 100%

(3)

Each measurement was executed with six replicates and the average value was calculated. 2.4 In vitro cell experiment Cell culture and material preparation. Mouse bone mesenchymal stem cells (mBMSCs, ATCC CRL-1224) at passage 4-6 were used to study the cell adhesion, viability, proliferation and osteogenic-related genes expression on the bioceramics. The mBMSCs were cultured in an incubator with 5% CO2 and 95% humidity at 37 °C. The complete culture medium used for cell culture consisted of 90 vol% High-glucose Dulbecco’s modified Eagle’s medium (H-DMEM; Gibco, USA) and 10 vol% fetal bovine serum (FBS; Gibco, USA). The medium was refreshed every 2 days. The bioceramic disks (Ф7 mm × 1.5 mm and Ф17.5 mm × 1.5 mm) were sterilized by gamma irradiation. The disks were placed in the wells of a plate (Corning, USA) and immersed in culture medium for 4 h before cell seeding.


6

Page 7 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cell adhesion. The cells cultured on the bioceramic disks (Ф7 mm × 1.5 mm) for 24 h were fixed by 2.5 vol% glutaraldehyde solution at 4 °C for at least 4 h. Then the samples were dehydrated with gradient ethanol (30, 50, 70, 80, 90, 95 and 100 vol%). After air dried, the samples were sputter-coated with platinum and observed by SEM. For cytoskeletal and nuclei staining, after permeabilized for 5 min with 0.1% Triton X-100, the cells were stained with Alexa Fluor488phalliodin (AAT Bioquest) for 1 h and DAPI (Sigma, USA) for 10 min. Fluorescent images of cytoskeletal organization and nuclei of cells were captured by a confocal laser scanning microscope (CLSM; SP5, Leica, Germany). Cell proliferation. A Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Japan) assay was used to evaluate the metabolic activity of cells on the bioceramic disks (Ф7 mm × 1.5 mm). The cell density for the detection is 5 × 103 cells/disk. At day 1, 3 and 7, the disks were transferred into a new 48-well plate. 250 μL of CCK-8 working solution was added into each well and the plate was incubated at 37 °C for 1 h. 100 μL of supernatant was transferred into a new 96-well plate and the absorbance was read at 450 nm using an enzyme-linked immunosorbance assay reader (ELISA; Thermo 3001, Thermo, USA). Alkaline phosphatase (ALP) activity assay. Cells were seeded on the bioceramic disks (Ф7 mm × 1.5 mm) with a density of 4 × 104 mL-1. Osteogenic induction medium used for cell culture contained 90 vol% H-DMEM, 10 vol% FBS, 10 mM sodium β-glycerophosphate, 100 nM dexamethasone, and 50 μM vitamin C. The osteogenic medium was refreshed every two days. After the cells were cultured for 7, 10 and 14 days, the bioceramic disks with cells were transferred into a new 48-well plate, then washed three times with phosphate buffer solution (PBS). 300 μL of lysis buffer (0.1 vol. % Triton X-100 in 10 mM Tris–HCl buffer solution) was added into each well. The cells were soaked at 4 °C for 2 h. After ultrasonic treatment for 6 times, 200 μL of 5 mM


7


Page 8 of 28

p-nitrophenyl phosphate (pNPP, Sigma, USA) was mixed with 20 μL of cell lysate at 37 °C for 15 min. After that, 200 μL of 1 M NaOH solution was added to terminate the reaction. 100 μL of reaction mixture was transferred into a 96-well plate to measure the p-nitrophenol concentration at 405 nm using the ELISA reader. To assess the total protein content, 160 μL of BCA Protein Assay Kit (Thermo Scientific, USA) working reagent was mixed with 20 μL of cell lysate at 37 °C for 30 min. Then the absorbance was read at 562 nm using an ELISA reader. ALP activity was calculated as enzyme activity unit per milligram of total protein content. Osteogenesis-related gene expression. Real-time quantitative polymerase chain reaction (RTqPCR) method was employed to analyze the osteogenesis-related gene expression. Cells were cultured on the bioceramic disks (Ф17.5 mm × 1.5 mm) with a density of 4 × 105 cells/well in the 12-well plates. Osteogenic induction medium was also used in RT-qPCR test and was refreshed every two days. After being cultured for 7 and 14 days, the total RNA was extracted using Hipure Total RNA Kits (Magen, China) and transcribed into complementary DNA (cDNA) with an iScript cDNA Synthesis Kit (Bio-Rad, USA). Then, PCR was carried out on Bio-Rad Chromo4 (Bio-Rad, USA) to examine the gene expression of collagen-I (Col-I), ALP, and osteocalcin (OCN). The glyceraldehydes-3-phosphatedehydrogenase (GAPDH) was used as the house keeping gene. SYBR green assay (iQTM SYBR Green Supermix, Bio-Rad, USA) was used for qPCR. The level of gene expression was presented by 2−∆∆𝐶𝑡 , where Ct represents the cycle number when an arbitrarily placed threshold was reached and ∆∆Ct = sample group(𝐶𝑡target gene − 𝐶𝑡GAPDH ) − control group(𝐶𝑡target gene − 𝐶𝑡GAPDH ) . The forward and reverse primer sequences of osteogenesis-related genes used in the RT-qPCR method are listed in Table 1. Table 1. Validated primer sequences for RT-qPCR. Gene

Direction

Sequence (5′-3′)


8

Page 9 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


GAPDH

Col-I

ALP

OCN

Forward

TGTGTCCGTCGTGGATCTGA

Reverse

TTGCTGTTGAAGTCGCAGGAG

Forward

ATGCCGCCACCTCAAGATG

Reverse

TGAGGCACAGACGGCTGAGTA

Forward

TGCCTACTTGTGTGGCGTGAA

Reverse

TCACCCGAGTGGTAGTCACAATG

Forward

AGCAGCTTGGCCCAGACCTA

Reverse

TAGCGCCGGAGTCTGTTCACTAC

2.5 The real-time released ions. The replaced cell culture medium in the test of RT-qPCR was collected and then digested by boiling with concentrated nitric acid. The dynamic concentrations of calcium, silicon and phosphorus ions in the medium were carefully monitored using inductively coupled plasma atomic emission spectroscopy (ICP-AES; Perkin Elmer, Optimal 5300DV, USA). 2.6 Statistical analysis. The statistical study was carried out by analysis of variance which expressed the data by means ± standard deviations. Student’s t-test was used for evaluations of statistical differences among groups. A statistical significance difference was used to make comparison between two means. 3. Results 3.1 Phase composition and morphology The content of silicon in the bioceramics pre-sintered at 1000 °C and 300 °C were 1.96 mol% and 2.69 mol%, respectively. It implied that the amount of BG sol infiltrated into bioceramics could be controlled by altering the pre-sintering temperature.


9


Page 10 of 28

Figure 1. X-ray diffraction patterns (A, B) and FTIR spectra (C) of HA-0 and SiHA bioceramics. The XRD patterns of HA-0, SiHA-1000 and SiHA-300 are presented in Figs. 1A-1B. The phase of HA-0 was pure HA (JCPDS no.09-0432). Other than HA, some sharp peaks of β-tricalcium phosphate (β-TCP; JCPDS No. 09-0169) and relatively weak peaks of α-tricalcium phosphate (αTCP; JCPDS No. 09-0348) were found in the patterns of SiHA-1000 and SiHA-300. Meanwhile, XRD pattern of SiHA-300 showed the peaks of silicocarnotite [Ca5(PO4)2SiO4, JCPDS No. 400393]. Fig. 1C displays the FTIR spectra of HA-0, SiHA-1000 and SiHA-300. In the spectra of


10

Page 11 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


all the samples, the bands at 600-400 cm-1 (bending vibration), 962 cm-1 (symmetrical stretching vibration), 1040 cm-1 and 1092 cm-1 (asymmetrical stretching vibration) were attributed to PO43group.19 The peaks at 3600-3500 cm-1 corresponding to the characteristic bands of OH- were gradually weakened as the per-sintering temperature decreased. The absorption peaks assigned to SiO44- group appeared at 795 cm-1 (bending vibration) and 499 cm-1 (bending vibration)20 in the FTIR spectra of SiHA-1000 and SiHA-300. Moreover, the peak of SiO32- appeared at 718 cm-1 17 in the FTIR spectra of SiHA-1000 and SiHA-300. SiO32- might be derived from CaSiO3 formed in the sintering process, which could not be detected by XRD probably due to its amount under the detection limit. Fig. 2A shows the microstructure of original surface and sectioned surface of HA-0, SiHA-1000 and SiHA-300. It could be observed that HA-0 after sintered at 1150 °C for 2 h had the densest microstructure without visible pores. For SiHA-1000 and SiHA-300, which were infiltrated with BG sol, lots of micropores (0.7 μm) were enveloped by the small grains (

Enhancing the Cell-Biological Performances of Hydroxyapatite

Recommend Documents