Enzymatic Production of Ascorbic Acid-2-phosphate by Recombinant

May 8, 2017 - School of Pharmaceutical Sciences, Jiangnan University, Wuxi 214122, Jiangsu Province, China. ‡ State Key Laboratory of Food Science a...
0 downloads 16 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Enzymatic Production of Ascorbic Acid-2-phosphate by Recombinant Acid Phosphatase Kai Zheng,† Wei Song,‡ Anran Sun,‡ Xiulai Chen,‡ Jia Liu,‡ Qiuling Luo,‡ and Jing Wu*,† †

School of Pharmaceutical Sciences, Jiangnan University, Wuxi 214122, Jiangsu Province, China State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, Jiangsu Province, China

‡

S Supporting Information *

ABSTRACT: In this study, an environmentally friendly and efficient enzymatic method for the synthesis of L-ascorbic acid-2phosphate (AsA-2P) from L-ascorbic acid (AsA) was developed. The Pseudomonas aeruginosa acid phosphatase (PaAPase) was expressed in Escherichia coli BL21. The optimal temperature, optimal pH, Km, kcat, and catalytic efficiency of recombinant PaAPase were 50 °C, 5.0, 93 mM, 4.2 s−1, and 2.7 mM−1 min−1, respectively. The maximal dry cell weight and PaAPase phosphorylating activity reached 8.5 g/L and 1127.7 U/L, respectively. The highest AsA-2P concentration (50.0 g/L) and the maximal conversion (39.2%) were obtained by incubating 75 g/L intact cells with 88 g/L AsA and 160 g/L sodium pyrophosphate under optimal conditions (0.1 mM Ca2+, pH 4.0, 30 °C) for 10 h; the average AsA-2P production rate was 5.0 g/ L/h, and the AsA-2P production system was successfully scaled up to a 7.5 L fermenter. Therefore, the enzymatic process showed great potential for production of AsA-2P in industry. KEYWORDS: enzymatic production, L-ascorbic acid-2-phosphate, acid phosphatase, Pseudomonas aeruginosa

■

INTRODUCTION L-Ascorbic acid (AsA), also known as vitamin C, is a well-known antioxidant that maintains organoleptic quality and protects other components from oxidation.1,2 It also has vital roles in radical scavenging, carnitine synthesis, and iron absorption and functions as a cofactor in a number of enzyme systems.3−6 However, AsA is unstable in solution owing to the oxidation of hydroxyl groups at C2 and C3, which results in the formation of dehydroascorbic acid, especially in the presence of heat, light, metal ions, and oxygen.7−9 Therefore, many AsA derivatives have been synthesized to improve stability, particularly those combined with a protecting group at the C2 position, such as sodium ascorbate,10 calcium ascorbate,11 L-ascorbic acid-2phosphate (AsA-2P),12,13 L-ascorbic acid-2-glucoside (AsA2G),14 L-ascorbic acid-2-sulfate,15 L-ascorbyl 2,6-dipalmitate,16 and 2-O-octadecylascorbic acid.17 Among these, sodium ascorbate and calcium ascorbate are unstable in acid solution, L-ascorbyl 2,6-dipalmitate and 2-O-octadecylascorbic acid are fatsoluble, and AsA-2G demonstrates remarkable stability and ready release of glucose and AsA by the action of α-glucosidase.18 AsA2G has been approved by the Japanese government as a quasidrug and principal ingredient in skin care products. In addition, it is used in commercial cosmetics and as an additive in food.19 However, AsA-2P is considered superior among AsA derivatives because of its stability in aqueous solution and simple hydrolysis to AsA and phosphate by phosphatase in vivo. Moreover, AsA-2P, like AsA, is widely used in foods, pharmaceuticals, cosmetics, and fodders. In addition to its robust nature, AsA-2P increases myogenin gene expression, promotes differentiation in L6 muscle cells,20 and enhances proliferation and collagen synthesis in perisinusoidal stellate cells and skin fibroblasts.21−23 Currently, AsA-2P is produced by either a chemical or a biological method. The chemical method has been conducted on an industrial scale,24 which involves the © 2017 American Chemical Society

intermediate 5,6-O-isopropylidene-L-ascorbic acid (IAA) being prepared by reacting AsA with acetone (the ratios of acetone and catalyst toluene-p-sulfonic acid to AsA were 10:1 and 0.8:1, respectively). Thereafter, the AsA-2P is synthesized from IAA and POCl3 (ratios of pyridine and POCl3 to IAA were 7.5:1 and 1.6:1, respectively).25 The high consumption of chemicals and organic solvents and reaction temperatures of −10 to −25 °C result in increased costs and byproducts that are disadvantageous for product separation, making the chemical method complicated and expensive.26 Conversely, biological synthesis of AsA-2P is more interesting owing to its simple processing, enzymatic specificity, and environmental friendliness. Efforts have been made to produce AsA-2P via enzymatic conversion. For example, Shin et al. isolated bacteria from soil samples and achieved a conversion rate of 19.7% and yield of 27.5 g/L of AsA-2P using Brevundimonas diminuta after optimizing the cell growth and transformation conditions.27 In addition, Maruyama et al. achieved a conversion rate of 27.6% and yield of 31.6 g/L of AsA-2P using Pseudomonas azotocolligans (reclassified in genus Sphingomonas as Sphingomonas trueperi sp.28), which was selected from 715 strains of microorganisms as it demonstrated the highest productivity for AsA-2P.29 It is difficult to accumulate acid phosphatase (APase; EC 3.1.3.2) in cells of such wild strains, and it is unlikely that a superior acid phosphatase, which converts AsA to AsA-2P efficiently on a large-scale, will be found. According to a previous study, the natural substrate of Pseudomonas aeruginosa APase (PaAPase) is phosphorylcholine,30 and Pseudomonas aeruginosa acid phosphatase exists in an Received: Revised: Accepted: Published: 4161

February 9, 2017 May 4, 2017 May 8, 2017 May 8, 2017 DOI: 10.1021/acs.jafc.7b00612 J. Agric. Food Chem. 2017, 65, 4161−4166

Article

Journal of Agricultural and Food Chemistry anionic site with one subsite with affinity for methyl groups.31 However, in this study, an APase encoding gene from Pseudomonas aeruginosa was screened and expressed in Escherichia coli for AsA-2P preparation. The enzyme production was enhanced by high-cell-density cultivation to improve conversion of AsA to AsA-2P. Moreover, optimal conversion conditions that further enhance AsA-2P production were identified, and an efficient bioconversion system was developed.

■

Liquid Chromatography System with a 5 mL HisTrap FF column (GE Healthcare Life Science, Piscataway, NJ, USA) using a linear gradient imidazole (0−500 mM). The fractions with phosphorylation activity were collected and analyzed by SDS-PAGE.32 Measurement of PaAPase Phosphorylation Activity. The 2.0 mL reaction mixture consisted of 50 mM phosphate buffer (pH 5.0), 400 mM L-ascorbic acid, 500 mM sodium pyrophosphate, and 100 μL of enzyme solution. The reaction was incubated at 50 °C for 30 min. The phosphorylation activity of the purified enzyme was measured by the yield of AsA-2P using the HPLC system (Agilent, USA) with an APS-2 HYPERSIL column (150 mm × 4.6 mm, 5 μm). The mobile phase consisted of a one-third acetonitrile and two-thirds 0.1 M KH2PO4 solution, with the pH adjusted to 3.0 with phosphoric acid. The flow rate was at 1 mL/min. The compounds were detected at an absorbance of 254 nm, using a variable-wavelength UV detector. One unit of APase phosphorylating activity was defined as the amount of the protein that formed 1 μmol of AsA-2P per minute. The concentration of protein was determined according to the Bradford33 protein assay. Biochemical Characterization of PaAPase. The effect of pH on the phosphorylation activity of recombinant PaAPase was determined at pH values from 2.5 to 6.0, using citrate phosphate buffer with the substrate solution consisting of 400 mM AsA and 500 mM sodium pyrophosphate. The effect of temperature on the phosphorylation activity of recombinant PaAPase was evaluated in 50 mM citrate phosphate buffer, pH 7.4, under different temperatures ranging from 25 to 60 °C. The stability of the recombinant enzyme under different pH values was tested by measuring the enzyme activity after PaAPase incubated at 4 °C for 12 h under different pH values (2.5−8.0). The thermal stability of the recombinant enzyme was determined by measuring its residual activity following exposure to different temperatures (0−50 °C) in 50 mM citrate phosphate buffer (pH 7.4) for 1 h. The maximum phosphorylation activity was considered to be 100% in each experiment. Purified recombinant enzyme was incubated in 50 mM citrate phosphate buffer (pH 7.4) containing various bivalent cations (Zn2+, Mn2+, Mg2+, Cu2+, Fe2+, Ca2+, chloride forms) with a final concentration of 1 mM at 25 °C for 10 min. The enzyme activity was then measured under the optimal conditions. All of the reactions, including 50 mM phosphate buffer (pH 5.0), 100 μL of the purified PaAPase, and various concentrations of AsA (from 10 to 200 mM) and sodium pyrophosphate (from 1 to 50 mM) AsA-2P (from 1 to 50 mM) were carried out in a total volume of 2 mL at 50 °C for 20 min. Initial reaction rates were determined at conversions below 10%. The kinetic constants were calculated using the Michaelis− Menten equation. Feeding Strategies To Increase Cell Density. In the fermentation tank, soy peptone and Angel yeast (Angel Yeast Co., Ltd., Hubei, China) were used as substitutes for peptone and yeast extract, respectively, in the TB medium. Batch fermentations were performed in 5 L bioreactors (Baoxing, Shanghai, China) in a 2 L working volume. The temperature, agitation rate, and aeration rate were initially adjusted to 37 °C, 200 rpm, and 1.0 vvm, respectively, following inoculation with 100 mL of the seed culture. When cultivated for 10 h, lactose was added to a final concentration of 4 g/L after the temperature had been reduced to 25 °C, and the induction continued for 6 h. The obtained cells were used for the following research. Optimization and Amplification of the Transformation System. To improve the yield of AsA-2P, the process variables related to production rate were evaluated. Substrates of AsA (17.6−105.6 g/L) and sodium pyrophosphate (120−173 g/L), wet cell weight (10−100 g/ L), Ca2+ (10−6−10−2 mM), pH, and temperature were tested by a singlefactor experiment. Thereafter, the biotransformation reaction was carried out by adding 75 g/L intact cells in 2 mL of reaction solution (pH 4.0) containing 88 g/L AsA, 160 g/L sodium pyrophosphate, and 0.1 mM Ca2+. Subsequently, the reaction was incubated at 30 °C for 2−14 h and terminated by adding 1 mL of phosphoric acid. Finally, 1 L of reaction solution was incubated in a 7.5 L fermenter with optimum conditions, and the agitation rate was 200 rpm. The titer of AsA-2P was measured by using the HPLC method as described above.

MATERIALS AND METHODS

Chemicals and Enzymes. The expression plasmid pET-28a (+) and the host strain E. coli BL21 (DE3) were obtained from Novagen (Madison, WI, USA). The T-vector, restriction enzymes (BamHI and HindIII), T4 DNA ligase, plasmid miniprep kit, bacterial DNA kit, and agarose gel DNA purification kit were supplied by TAKARA Bio, Inc. (Otsu, Japan). Standard production L-ascorbic acid-2-phosphate trisodium salt was purchased from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals used were of analytical grade. Gene Manipulation and Strain Construction. The strains and primers used in this study are summarized in Table 1. All recombinant

Table 1. Main Strains and Primers Used in This Study strain Bacillus licheniformis Bacillus megaterium Bacillus subtilis Bacillus thuringiensis Brevibacillus brevis Cellumomonas f lavigena Gluconobacter oxidans Sphingomonas trueperi Staphylococcus aureus Pseudomonas aeruginosa

primer

sequence (5′−3′)

Bl1 Bl2 Bm1 Bm2 Bs1 Bs2 Bt1 Bt2 Bb1 Bb2 Cf1 Cf 2 Go1 Go2 St1 St2 Sa1 Sa2 Pa1 Pa2

cgcggatccgccgggtgtaaaatgtttaaaaac cccaagcttctacttttgtcgaacaagcgggtac ccgggatccgactttaatgtacttcataccattg ccgaagcttctatttttggttatataggcgtttag ccgggatccgcagatgaagcaataagcaaggcag ccgaagctt ctatttttgtcgaaaccgcttaatc ccgggatccggtggcgttacagtgatggatac ccgaagcttctatctctctttattaagccctaatctc ccgggatccgcggggaaagtggccggtatggatc ccgaagcttttatctggaatgaggtacggggtcgacg ccgggatccgagacgggcgtcaacgcctggc ccgaagcttgccctgccggcgccgc ccggaattcgcgcatacgtccgctaccgcccaag ccgaagcttttacggttcgctgagcagggaatggatc ccgggatccagtgacacggcgccgtacctc ccgaagcttctaccaggggcggacgcgaag ccgggatcccacgaatcaagactagggaaatg ccgaagcttttaatttattaatttatttctaagtaataac ccgggatccgagaccgccgccgcgccctatc ccgaagcttctactggagtttcggcaaccccag

strains were derived from the E. coli BL21(DE3) strain. Ten APase genes were obtained from different bacterial genomes by polymerase chain reaction, performed under the following conditions: 95 °C for 3 min followed by 30 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 5 min. The amplified genes were cloned into the pET-28a (+) vector with an N-terminal hexa-histidine tag, and the recombinant plasmid was transformed into E. coli BL21 (DE3) for further expression of APase and screening. All recombinant E. coli strains grown at 37 °C in LB medium were supplemented with 50 μg/mL kanamycin until the optical density at 600 nm (OD600) reached 0.6−0.8. Protein expression was induced by the addition of 0.4 mM isopropyl-βD-1-thiogalactopyranoside (IPTG), and the culture was grown for 16 h at 25 °C. Enzyme Purification and Sodium Dodecyl Sulfate−Polyacrylamide Gel Electrophoresis (SDS-PAGE) Analysis. Cells were collected by centrifugation and washed twice using 50 mM phosphate buffer (pH 7.4) containing 0.5 M NaCl and 1% glycerol. The suspension was ultrasonicated (power, 285 W; ultrasonication, 4 s; pause, 4 s; total, 20 min), and the cell-free supernatant was obtained by centrifugation at 12000g for 30 min at 4 °C and filtered using a 0.2 μm filter membrane. Recombinant PaAPase was purified by using an AKTA Prime Plus 4162

DOI: 10.1021/acs.jafc.7b00612 J. Agric. Food Chem. 2017, 65, 4161−4166

Article

Journal of Agricultural and Food Chemistry Table 2. Activities of Homologous Enzymes of StAPase and BbAPase sequence identity (%)

a

recombinant strain

protein

CDS region

protein accession

StAPase

BdAPase

activitya (U/L)

FMMEAP01 FMMEAP02 FMMEAP03 FMMEAP04 FMMEAP05 FMMEAP06 FMMEAP07 FMMEAP08 FMMEAP09 FMMEAP10

BlAPase BmAPase BsAPase BtAPase BbAPase CfAPase GoAPase StAPase SaAPase PaAPase

CP000002.3 CP001983.1 NC_000964.3 NC_005957.1 AP008955.1 CP001964.1 CP000009.1 HW430070.1 BA000018.3 NC_002516.2

AAU23813 ADE71040 NP_389846 YP_035516 BAH43217 ADG75055 AAW61365

11.5 13.3 15.2 15.7 16.6 14.4 26.5 100 10.7 25.4

15.4 13.2 13.3 14.7 15.8 12.2 32.6 35.5 12.2 26.7

− − − − − − − 95 89 147

BAB42510 NP_248880

The amount of enzyme that produced 1 μmol of AsA-2P per minute↓.

■

RESULTS AND DISCUSSION Cloning and Overexpression of Acid Phosphatase Genes in E. coli. BdAPase and StAPase from Brevundimonas

Recombinant strains FMMEAP08 (APase gene from Sphingomonas trueperi HW430070), FMMEAP09 (APase gene from Staphylococcus aureus strain ATCC 12600), and FMMEAP10 (APase gene from Pseudomonas aeruginosa PAO1) showed phosphorylation activities of 74, 85, and 147 U/L, respectively. No activity was observed in other recombinant strains. Thereafter, the AsA-2P titer of the three recombinant strains demonstrating phosphorylation was tested. Among them, FMMEAP10 showed an AsA-2P conversion of 30.5% and a titer of 31.1 g/L, which were higher than those of FMMEAP08 (21.2%, 22.1 g/L) and FMMEAP09 (19.7%, 20.1 g/L). Therefore, the recombinant FMMEAP10 strain was selected to further produce AsA-2P. The calculated molecular weight of wild PaAPase from Pseudomonas aeruginosa was 26 kDa, and the isoelectric point (pI) was predicted to be 5.9 (http://www. expasy.org/). Enzymatic Properties of the Recombinant PaAPase. The recombinant PaAPase was purified with a yield of 31.6% and a specific activity of 14.8 U/mg. The results of the purification are summarized in Table 3. Additionally, SDS-PAGE analysis of the recombinant protein showed a single polypeptide band with a mass of approximately 29 kDa (Figure 1), which is concordant after wild PaAPase (26 kDa) added a polypeptide (∼3.2 kDa) containing hexa-histidine at the N terminus. As shown in Figure 2A, the maximal phosphorylation activity of recombinant PaAPase is obtained at 50 °C, and the enzyme is stable at low temperatures (90% of the initial activity after incubation for 12 h at 4 °C (Figure 2D). Moreover, the maximum enzyme activity was 18.6 U/mg under the optimal temperature (50 °C) and pH (5.0). Effects of different metal ions on the enzyme activity are shown in Figure S1. Among the bivalent cations, only Cu2+ showed inhibition of enzyme activity (nearly 25%), which is consistent with the finding reported by Min et al.24 Conversely, Ca2+

Table 3. Purification of Recombinant PaAPase from E. coli step crude extract purified enzyme

total activity (U)

total protein (mg)

specific activity (U/mg)

434.6

74.0

5.8

137.6

9.3

14.8

yield (%) 100 31.6

fold purification 1 8

Figure 1. SDS-PAGE analysis of purified PaAPase. The purified enzyme was boiled, mixed with 4× protein SDS-PAGE loading buffer, and electrophoresed on a 10% polyacrylamide gel. Lanes: M, bovine serum albumin protein maker; 1, supernantant of cell-free extract; 2, penetration peak; 3, purified enzyme.

diminuta27 and Sphingomonas trueperi,29 respectively, phosphorylated AsA at the C2 position. To identify the superior enzyme, BdAPase and StAPase were selected as probes, and 10 APase proteins with 10%-40% sequence identity to BdAPase and StAPase were selected (Table 2). APase genes of these strains were successfully cloned into plasmid pET28a with T7 RNA polymerase promoter and transformed into E. coli to give the new recombinant strains FMMEAP01−FMMEAP10. These recombinant strains were cultured in 20 mL of LB medium (50 μg/mL kanamycin) overnight and inoculated 1% (v/v) into 100 mL of LB medium (50 μg/mL kanamycin) until OD600 of 0.6− 0.8 was achieved, induced with 0.4 mM IPTG, and grown for 16 h at 25 °C. After induction, the AsA phosphorylation activities of the recombinant strains were tested in 2 mL of substrate (400 mM AsA and 500 mM PPi, 50 mM phosphate buffer, pH 4.0). 4163

DOI: 10.1021/acs.jafc.7b00612 J. Agric. Food Chem. 2017, 65, 4161−4166

Article

Journal of Agricultural and Food Chemistry

Figure 2. Effect of temperature and pH on the activity of recombinant PaAPase: (A) optimum temperature; (B) temperature stability; (C) optimum pH; (D) pH stability.

recombinant PaAPase for AsA was 4.2 s−1, and the catalytic efficiency kcat/Km was 2.7 mM−1 min−1. Optimization Strategies To Enhance PaAPase Production. To enhance PaAPase production, IPTG and lactose were added to induce enzyme production at an OD600 of 0.6, and the results are shown in Figure S2A. Activity of 238.6 U/L was achieved using 2 g/L lactose, which is a 53.1% increase compared to 0.4 mM IPTG (155.8 U/L). Furthermore, after lactose induction for 8 h, a dry cell weight (DCW) of 1.0 g/L was achieved (OD600 = 3.0), which is nearly 3-fold more than the DCW following IPTG induction (0.3 g/L, OD600 = 1.0). Thereafter, enzyme production conditions were optimized, and the results showed that optimal lactose concentration, temperature, and induction time were 4 g/L (Figure S2B), 25 °C (Figure S2C), and 14 h (Figure S2D), respectively. Following optimization, the total enzyme activity and DCW were 331.7 U/ L (39% improvement) and 1.7 g/L (74% improvement), respectively. To further improve enzyme production, a high-cell-density cultivation strategy was used to increase cell density and PaAPase activity. A 5% (v/v) seed culture of strain FMMEAP10 was inoculated into a 5 L bioreactor with a 2 L working volume of TB medium. When glycerol was completely exhausted or the dissolved oxygen (DO) level increased rapidly (after about 5 h of growth), glycerol (500 g/L) was added into the fermenter to maintain the DO value below 30% of saturation until the agitation rate reached its maximum set value of 600 rpm. Cells were induced with 4 g/L lactose when the OD600 was stable (after about 10 h of growth), whereas the growth temperature was adjusted to 25 °C. After 18 h of growth and 6 h of induction, the highest PaAPase activity (1127.2 U/L) was achieved (Figure 3B) and DCW was 8.5 g/L (OD600 = 25.7) (Figure 3A), which were 3.4- and 4.8-fold increases compared to that of shake flask cultivation, respectively. The obtained cells were used for the following research.

Figure 3. Time course of high-cell-density cultivation: (A) cell DCW (arrow showed the point of induction); (B) production of PaAPase activity.

showed a slight activation; however, Zn2+, Mn2+, Mg2+, and Fe2+ did not show any significant effects on enzyme activity. The Km values of recombinant PaAPase for AsA and AsA-2P of 93 and 23.8 mM, respectively, indicated that dephosphorylation of AsA-2P is strong. The fact that a majority of AsA-2P was decomposed by recombinant PaAPase without phosphate donor proved that a strong reverse reaction exists. The kcat of the 4164

DOI: 10.1021/acs.jafc.7b00612 J. Agric. Food Chem. 2017, 65, 4161−4166

Article

Journal of Agricultural and Food Chemistry

on the AsA-2P titer (Figure S3E). In addition, the AsA-2P production by resting cells was measured at different temperatures (30, 40, and 50 °C) (Figure S3F). In conclusion, under optimal conditions (88 g/L AsA, 160 g/L sodium pyrophosphate, 75 g/L intact cells, 0.1 mM Ca2+, pH 4.0), the highest amount of AsA-2P (50.0 g/L, conversion rate 39.2%) was obtained when the mixture was cultivated at 30 °C for 10 h. Thereafter, the AsA-2P production system was scaled up to a 7.5 L fermenter with the optimal conditions. At 30 °C, it was found that the initial AsA-2P synthesis rate (0−4 h) was about 12.5 g/L/h, and the average synthesis rate was 5.0 g/L/h after 10 h of incubation. At 10 h, the AsA-2P titer reached 50.2 g/L and subsequently showed little change (Figure 4A); the AsA titer declined from 88 to 52.1 g/L (Figure 4B), which is a loss rate of 40.7%, whereas the AsA-2P conversion rate was 39.4% (Figure 4C), similar to the rate of shake flask cultivation. The results indicate that the FMMEAP10 strain has the potential to produce AsA-2P on an industrial scale. At present, multistep chemical synthesis of AsA-2P has been applied in industry, but the chemical method has inherent disadvantages. However, there are only a limited number of studies focusing on the production of AsA-2P by biotransformation methods. In previous studies, the space−time yield of AsA2P ranged from 0.5 to 1.1 g/L/h by biocatalysis; however, in this study, a higher space−time yield of 5.0 g/L/h was achieved. Furthermore, in comparison to other biotransformation methods that exhibit catalysis times of 27 h,29 32 h,35 and 36 h,27 the biotransformation method in this study showed only a 10 h catalysis time for the wet cell and an incubation temperature of 30 °C. The use of a moderate temperature has the following advantages: slower oxidation of AsA, prolonged cell survival time, and reduced production costs. Finally, AsA-2P synthesis was successfully carried out in a 7.5 L fermenter, indicating that the FMMEAP10 strain has the potential to produce AsA-2P on an industrial scale.

■

ASSOCIATED CONTENT

S Supporting Information *

Figure 4. Fermentation profiles of AsA-2P production in a 7.5 L fermentor: (A) AsA-2P production curve; (B) AsA consumption curve; (C) AsA-2P transformation rate curve.

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.7b00612. Isolation of the sample; identification of the product; effects of different metal ions on the phosphorylating activity of purified PaAPase; optimization of enzyme production conditions; effects of conversion conditions on AsA-2P production; HPLC chromatogram of standard samples consisting of AsA and AsA-2P; HPLC chromatogram of quantifying the product of AsA-2P; 1H NMR spectra of the reference 2-phospho-L-ascorbic acid trisodium salt and the sample; 13C NMR spectra of the reference 2-phospho-L-ascorbic acid trisodium salt and the sample (PDF)

Transformation for Producing AsA-2P. As the recombinant PaAPase protein is an intracellular protein, the cells were collected by centrifugation (6000g for 5 min) and then used for AsA-2P biotransformation. The effects of substrate concentration on phosphorylating AsA were investigated; the AsA-2P titer increased to the highest value (39.4 g/L) with an increase in the total AsA titer to 88 g/L (Figure S3A). A higher titer of AsA2P (41.6 g/L) was attained when the sodium pyrophosphate titer was 160 g/L (Figure S3B). Thus, the titers of AsA and sodium pyrophosphate were controlled at 88 and 160 g/L, respectively, in the subsequent experiments. Different concentrations (10− 100 g/L) of intact cells were employed, and the maximum AsA2P titer was 43.7 g/L when 75 g/L intact cells were used (Figure S3C). As exogenous Ca2+ ions exhibited a positive effect on the recombinant PaAPase activity, their effects on AsA-2P production were tested. As shown in Figure S3D, when 0.1 mM Ca2+ was added to the broth, a titer of AsA-2P (46.3 g/L) was detected, which was 5.9% higher than that of the control (without Ca2+ addition). An AsA-2P titer of 48.6 g/L was achieved at pH 4.0 in 50 mM phosphate buffer and decreased by >50% when pH was 4.5, indicating that pH has a strong influence

■

AUTHOR INFORMATION

Corresponding Author

*(J.W.) Phone: + 86-510-85197875. Fax: + 86-510-85197875. Email: [email protected] ORCID

Kai Zheng: 0000-0001-7131-5729 Xiulai Chen: 0000-0002-5154-3860 Funding

This work was financially supported by Social Development Project of Jiangsu Province, China (BE2015307), Surface Project 4165

DOI: 10.1021/acs.jafc.7b00612 J. Agric. Food Chem. 2017, 65, 4161−4166

Article

Journal of Agricultural and Food Chemistry

(19) Takebayashi, J.; Tai, A.; Gohda, E.; Yamamoto, I. Characterization of the radical-scavenging reaction of 2-O-substituted ascorbic acid derivatives, AA-2G, AA-2P, and AA-2S: a kinetic and stoichiometric study. Biol. Pharm. Bull. 2006, 29, 766−771. (20) Mitsumoto, Y.; Liu, Z.; Klip, A. A long-lasting vitamin C derivative, ascorbic acid 2-phosphate, increases myogenin gene expression and promotes differentiation in L6 muscle cells. Biochem. Biophys. Res. Commun. 1994, 199, 394−402. (21) Senoo, H.; Hata, R. Extracellular matrix regulates and L-ascorbic acid 2-phosphate further modulates morphology, proliferation, and collagen synthesis of perisinusoidal stellate cells. Biochem. Biophys. Res. Commun. 1994, 200, 999−1006. (22) Hata, R.; Senoo, H. L-Ascorbic acid 2-phosphate stimulates collagen accumulation, cell proliferation, and formation of a threedimensional tissuelike substance by skin fibroblasts. J. Cell. Physiol. 1989, 138, 8−16. (23) Tsutsumi, K.; Fujikawa, H.; Kajikawa, T.; Takedachi, M.; Yamamoto, T.; Murakami, S. Effects of L-ascorbic acid 2-phosphate magnesium salt on the properties of human gingival fibroblasts. J. Periodontal Res. 2012, 47, 263−271. (24) Min, J. A.; Moon, J. Y.; Kang, D. O.; Yong, K. C. Purification and characterization of ascorbic acid 2-kinase from Flavobacterium devorans ATCC 10829. Biochimie 2004, 86, 151−156. (25) Chen, H. L.; Seib, P. A.; Liang, Y. T.; Hoseney, R. C.; Deyoe, C. W. Chemical synthesis of several phosphoric esters of L-ascorbic acid. Carbohydr. Res. 1978, 67, 127−138. (26) Fujio, T.; Maruyama, A., Process for the preparation of ascorbic acid-2-phosphate. U.S. patent US5578471[P], 1996. (27) Shin, W. J.; Kim, B. Y.; Bang, W. G. Optimization of ascorbic acid2-phosphate production from ascorbic acid using resting cell of Brevundimonas diminuta. J. Microbiol. Biotechnol. 2007, 17, 769−773. (28) Kämpfer, P.; Denner, E. B.; Meyer, S.; Moore, E. R.; Busse, H. J. Classification of Pseudomonas azotocolligans Anderson 1955, 132, in the genus Sphingomonas as Sphingomonas trueperi sp. nov. Int. J. Syst. Bacteriol. 1997, 47, 577−83. (29) Maruyama, A.; Koizumi, S.; Fujio, T. Enzymatic production of ascorbic acid-2-phosphate. Ann. N. Y. Acad. Sci. 1990, 613, 730−733. (30) Domenech, C. E.; Lisa, T. A.; Salvano, M. A.; Garrido, M. N. Pseudomonas-aeruginosa acid-phosphatase − activation by divalentcations and inhibition by aluminum ion. FEBS Lett. 1992, 299, 96−98. (31) Garrido, M. N.; Lisa, T. A.; Domenech, C. E. Pseudomonas aeruginosa acid phosphatase contains an anionic site with a trimethyl subsite. Kinetic evidences obtained with alkylammonium ions. Mol. Cell. Biochem. 1988, 84, 41−49. (32) Schagger, H. Tricine-SDS-PAGE. Nat. Protoc. 2006, 1, 16−22. (33) Kruger, N. J. The Bradford method for protein quantitation. Methods Mol. Biol. (Clifton, N.J.) 1994, 32, 9−15. (34) Koizumi, S.; Maruyama, A.; Fujio, T. Purification and characterization of ascorbic acid phosphorylating enzyme from Pseudomonas azotocolligans. Agric. Biol. Chem. 1990, 54, 3235−3239. (35) Kwon, K. S.; Lee, S. H.; Bang, W. G. Production of ascorbic acid-2phosphate from ascorbic acid by Pseudomonas sp. Korean J. Appl. Microbiol. Biotechnol. 2000, 28, 33−38.

of National Natural Science Foundation of China (21576117), and Development of Functional Mining and Analysis Platform for Industrial Enzyme Preparation (863 Program, 2014AA021501). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Han, R. Z.; Liu, L.; Shin, H. D.; Chen, R. R.; Li, J. H.; Du, G. C.; Chen, J. Systems engineering of tyrosine 195, tyrosine 260, and glutamine 265 in cyclodextrin glycosyltransferase from Paenibacillus macerans to enhance maltodextrin specificity for 2-O-D-glucopyranosylL-ascorbic acid synthesis. Appl. Environ. Microbiol. 2013, 79, 672−677. (2) Mason, S. A.; Della Gatta, P. A.; Snow, R. J.; Russell, A. P.; Wadley, G. D. Ascorbic acid supplementation improves skeletal muscle oxidative stress and insulin sensitivity in people with type 2 diabetes: findings of a randomized controlled study. Free Radical Biol. Med. 2016, 93, 227−238. (3) Colven, R. M.; Pinnell, S. R. Topical vitamin C in aging. Clin. Dermatol. 1996, 14, 227−234. (4) Crisóstomo, F. P.; Martı ́n, T.; Carillo, R. Ascorbic acid as an initiator for the direct C-H arylation of (hetero)arenes with anilines nitrosated in situ. Angew. Chem., Int. Ed. 2014, 53, 2181−2185. (5) Meng, H. M.; Zhang, X. B.; Yang, C.; Kuai, H.; Mao, G. J.; Gong, L.; Zhang, W.; Feng, S.; Chang, J., Efficient two-photon fluorescence nanoprobe for turn-on detection and imaging of ascorbic acid in living cells and tissues. Anal. Chem. 2016, 88.6057606310.1021/acs.analchem.6b01352 (6) Berger, M. M.; Oudemans-van Straaten, H. M. Vitamin C supplementation in the critically ill patient. Curr. Opin. Clin. Nutr. Metab. Care 2015, 18, 193−201. (7) Yuan, J.-P.; Feng, C. Degradation of ascorbic acid in aqueous solution. J. Agric. Food Chem. 1998, 46, 5078−5082. (8) Robertson, G. L.; Samaniego, C. M. L. Effect of initial dissolved oxygen levels on the degradation of ascorbic acid and the browning of lemon juice during storage. J. Food Sci. 1986, 51, 184−187. (9) Van den Broeck, I.; Ludikhuyze, L.; Weemaes, C.; Van Loey, A.; Hendrickx, M. Kinetics for isobaric-isothermal degradation of L-ascorbic acid. J. Agric. Food Chem. 1998, 46, 2001−2006. (10) Fukushima, S.; Uwagawa, S.; Shirai, T.; Hasegawa, R.; Ogawa, K. Synergism by sodium L-ascorbate but inhibition by L-ascorbic acid for sodium saccharin promotion of rat two-stage bladder carcinogenesis. Cancer Res. 1990, 50, 4195−4198. (11) Andersen, F. A. Final report of the safety assessment of L-ascorbic acid, calcium ascorbate, magnesium ascorbate, magnesium ascorbyl phosphate, sodium ascorbate, and sodium ascorbyl phosphate as used in cosmetics. Int. J. Toxicol. 2005, 24, 51−111. (12) Sieb, P. A.; Deyoe, C. W.; Hoseney, R. C., Method of preparation of 2-phosphate esters of ascorbic acid. U.S. patent US4179445[P]. 1979. (13) Fujio, T.; Maruyama, A., A process for the preparation of ascorbic acid-2-phosphate. EP patent EP0272064[P]. 1993. (14) Kwon, T.; Kim, C. T.; Lee, J. H. Transglucosylation of ascorbic acid to ascorbic acid 2-glucoside by a recombinant sucrose phosphorylase from Bif idobacterium longum. Biotechnol. Lett. 2007, 29, 611−615. (15) Gniot-Szulzycka, J. L-Ascorbic acid 2-sulphate. Postepy Biochemii 1982, 28, 137−143. (16) Moribe, K.; Limwikrant, W.; Higashi, K.; Yamamoto, K., Drug nanoparticle formulation using ascorbic acid derivatives. J. Drug Delivery 2011, 2011.1910.1155/2011/138929 (17) Tada, H.; Kutsumi, Y.; Misawa, T.; Shimamoto, N.; Nakai, T.; Miyabo, S. Effects of pretreatment with 2-O-octadecylascorbic acid, a novel free radical scavenger, on reperfusion-induced arrhythmias in isolated perfused rat hearts. J. Cardiovasc. Pharmacol. 1990, 16, 984−91. (18) Yamamoto, I.; Muto, N.; Murakami, K.; Suga, S.; Yamaguchi, H. L-ascorbic acid alpha-glucoside formed by regioselective transglucosylation with rat intestinal and rice seed alpha-glucosidases: its improved stability and structure determination. Chem. Pharm. Bull. 1990, 38, 3020−3023. 4166

DOI: 10.1021/acs.jafc.7b00612 J. Agric. Food Chem. 2017, 65, 4161−4166