Expression and Secretion of Bacterial Thermophilic Hemicellulases in

Chapter 14

Expression and Secretion of Bacterial Thermophilic Hemicellulases in Kluyveromyces lactis 1

2

1,2

D. J. Walsh , M . D. Gibbs , and P. L . Bergquist 1

Centre for Gene Technology, University of Auckland, Private Bag 92019, Auckland, New Zealand School of Biological Sciences, Macquarie University, North Ryde, Sydney, New South Wales 2109, Australia

Downloaded by UNIV LAVAL on July 11, 2016 | http://pubs.acs.org Publication Date: March 31, 1998 | doi: 10.1021/bk-1998-0687.ch014

2

The yeast Kluyveromyces lactis has been developed as a host for extracellular production of thermophilic hemicellulases employing expression vectors based on the 2μ-like plasmid pKD1 of Kluyveromyces drosophilarium, Α β-1,4-xylanase gene (xynA) from Dictyoglomus thermophilum strain Rt46B.1 was fused in-frame with a synthetic secretion signal derived from the K. lactis killer toxin and expressed under control of the Κ. lactis LAC4 (β-galactosidase) promoter. Correctly processed xylanase enzyme with full biological activity on Oat Spelt Xylan was secreted during shake-flask cultivation of Κ. lactis transformants. Yield was found to be dependent on the strain and the composition of the growth medium. The transcriptional activity of the LAC4 promoter dramatically affected mitotic stability of the expression vector under non-selective conditions. However, one isolate combined higher plasmid stability and good yield and has been employed for scaled-up production of XynA and other thermostable hemicellulases in chemostat culture. Similar results have been obtained for expression of a fusion of the xynA gene of Thermotoga strain FjSS3.B1 cloned into the same secretion vectors.

The utilization of hemicellulases in the pulp and paper industry is one of the most important new fields of bulk industrial enzymology. In the kraft process (the major pulping method worldwide), about 95% of the lignin present in wood fibre is removed by alkaline sulphate cooking. Residual lignin gives pulp a brown colour and is removed by bleaching with a variety of chemical agents, mainly chlorine and chlorine dioxide. Effluents contain toxic chlorinated organic compounds and must be treated before discharge. Enzymatic pretreatment of kraft pulp with hemicellulases, especially endo-p-1,4xylanases, allows paper of comparable brightness to be produced using up to 30% less chlorine (7,2) and is now used in several mills worldwide. However, the mesophilic

168

©1998 American Chemical Society

Eriksson and Cavaco-Paulo; Enzyme Applications in Fiber Processing ACS Symposium Series; American Chemical Society: Washington, DC, 1998.


169 enzymes currently used require cooling and pH adjustment of the pulp prior to addition. Ideally, enzymes used in kraft mills should be active above 60°C and pH >7. In collaboration with the Thermophile Unit, University of Waikato, we have been successful in isolating a number of thermophilic, alkaline-active hemicellulases from microorganisms found in thermal areas (3,4), and work by the Pulp and Paper Research Organisation of New Zealand (PAPRO) demonstrates that some of these do improve the bleachability of Pinus radiata pine kraft pulp (5). We now aim to produce recombinant enzymes in sufficient quantity for large-scale mill trials. Heterologous production of candidate enzymes is necessary due to low yields from the native organisms which are themselves difficult to grow in the laboratory, generally requiring anaerobic conditions and high temperatures. In order to simplify purification, it is preferable to engineer recombinant thermophilic enzymes for secretion into the growth medium, allowing removal of contaminating mesophilic proteins by simple heat treatment. We have employed the yeast Kluyveromyces lactis as a host organism due to its capacity for high level secretion of foreign proteins (6) and have developed episomal vectors for hemicellulase gene expression based on the 2μ-πΊίβ p K D l plasmid of Kluyveromyces drosophilarium (7). In our system, xylanase genes are amplified by PCR from bacterial genomic D N A and cloned in-frame with the signal sequence of the K. lactis killer toxin a-subunit for expression under control of either the S. cerevisiae P G K promoter or the Κ lactis L A C 4 promoter. The presence of a kanamycin resistance cassette on vectors containing the entire p K D l sequence extends the spectrum of accessible host strains to all wildtype isolates of Κ lactis. Here we illustrate some aspects of our work on expression of thermostable bacterial xylanases from Dictyoglomus thermophilum strain Rt46B.l, originally isolated from a hot pool in Rotorua, New Zealand, and Thermotoga sp. strain FJSS3B.1, which was enriched from a hot spring on Savu-Savu beach in Fiji. Materials and Methods Strains and media. The E. coli strain used for routine cloning manipulations was JM101 [F' traD36 lacI4A(lacZ)M15 proA+B+/supE thi%lac-proA,B)]. Bacterial strains were grown at 37°C in Luria broth, supplemented with ampicillin (60 μg/ml) or kanamycin (30 μg/ml) where required for plasmid selection. K. lactis strains used as hosts for gene expression were MD2/1 (MATa uraA, argA lysA K+, p K D l ) and wild-type strains CBS 1065 and CBS2359. Strain MD2/1 was transformed to uracil prototrophy by the lithium acetate procedure (8). Transformants were selected on SD minimal agar medium (0.67% yeast nitrogen base without amino acids, 40 mg/ml L lysine, 40 mg/ml L-arginine, 2% glucose and 2% agar) and grown at 30°C in shakeflasks containing three different media: Y N B , Y N B supplemented with 1% Casamino acids (YNB-C) and Y E P (1% yeast extract, 2% bactopeptone and 2% glucose or galactose, as indicated). Wild-type strains were transformed via selection for resistance to G418 (Geneticin, Life Technologies, Gaithersburg, MD) as described by Bianchi etal (9). +

t

t

Plasmid constructions. The structures of the Κ lactis shuttle vectors used in this study are shown in Figure 1. Plasmid p S P G K l contains the replication origin of the Kluyveromyces plasmid p K D l (10) and a promoter-terminator cassette derived from the S. cerevisiae PGK gene, as described by Mellor et al. (11). A synthetic secretion signal derived from the pre-region of the Κ foctis killer toxin a-subunit (12) is situated downstream of the PGK promoter and is followed immediately by a unique EcoRL site. Plasmid pCXJ-kanl (9) contains the entire sequence of p K D l and the kanamycin resistance gene (Kan) of Tn903, which confers resistance to G418 in yeast. Plasmid p C X J l was derived from pCXJ-kanl by recircularization following removal of the



170 Kan gene on a Sail fragment. Plasmid pNZ2931 (4) was used as the source of the xynA gene of Dictyoglomus thermophilum strain Rt46B.l. The nucleotide sequence encoding the mature xylanase (codons 30 to 353) was amplified by P C R with the introduction of EcoRI sites (underlined) at each end of the gene, as shown in Figure 2. Following digestion with EcoRI, the PCR product was inserted into ZscoRI-digested p S P G K l and recombinant plasmids were digested with HinaUl and Ndel in order to identify those containing xynA in the required orientation. The resulting plasmid was denoted pSPGK-xyn. A n expression cartridge in which the promoter and terminator regions of the K. lactis LAC4 gene flank the secretion signal-jty/iA fusion region from pSPGK-xyn was constructed in pUC19 and transferred to p C X J l according to the strategy summarized elsewhere (Walsh and Bergquist, submitted). The completed expression cartridge was recovered from pLAC-3 on a 2.7 kb SaWHinaUl fragment and inserted into Sa/I/Hindlll-digested p C X J l to create pCXJ-xyn (Figure IB). Finally, the Kan gene was inserted on a 1.3 kb Sail fragment to give plasmid p C X J K xyn. Plasmids pSPGK-xyn and pCXJK-xyn were the xynA expression vectors used to transform K. lactis.

Figure 1. Recombinant plasmids expressing Dictyoglomus xylanase. The leader sequence of the K. lactis killer toxin α-subunit gene is shown as the filled portion of the circle in front of the xynA gene. Plasmid pSPGK-xynA was introduced into K. lactis strain MD2/1 (a, uraA, lys A, argA, p K D l ) via selection of U r a transformants. Plasmid pCXJ-xynA was introduced into K. lactis strain MW98-8C (a, uraA, lys A , argA, pKDl°) via selection of U r a transformants and into K. lactis wildtype strains CBS 1065, CBS2359 and CBS683 via selection for resistance to the antibiotic G418. +

+

+

The xynA gene of Thermotoga FJSS3.B1 was amplified by P C R from plasmid pNZ2824 (5) using the upstream primer T F 1 : 5 ' - G G T T C A ACQCGXGTTCCCTTGAGAGTG-3* and the downstream primer TF2: 5'-CGCTGA C G C G T T T A T C T T T C C T T C A G - 3 ' so introducing Mlul sites (underlined) at each end of the gene. Following digestion with M l u l the PCR product was inserted into Af/wl-digested p C X J l to generate plasmid for transformation into K. lactis essentially as described above for the Dictyoglomus xyn gene. The secretion signal/xylanase junctions are shown in Figure 2. T

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and zymogram analysis. Samples were subjected to electrophoresis in SDS-12% (wt/vol)


171


polyacrylamide gels according to Laemmli (12). Protein bands were visualised by staining with Coomassie brilliant blue G-250 and sized by comparison with high range protein molecular weight standards (200-14.3 kDa, Life Technologies) and with purified Dictyoglomus XynA expressed in E. coli. Protein bands with xylanase activity were localized in situ in 12% polyacrylamide gels containing 0.1% (wt/vol) oat spelts xylan (Sigma Chemical Co., St. Louis, MO). Following electrophoresis, SDS was removed by washing the gel in three changes of 25% isopropanol, 25 m M sodium acetate, pH 6.0, each for 30 min at room temperature. Proteins were renatured by soaking the gel overnight at 4°C in 25 m M bis Tris propane, adjusted to pH 6.5 at 85°C. The gel was then immersed in a fresh sample of the same buffer and incubated in a sealed container at 85°C for 30 min. Zones of xylanase activity were then visualized by the Congo Red assay of Teather and Wood (13).

Dictyoglomus xynA construct do. Bcli

ICTCATCGAGAACTGATCATT ATG AAT ATA TTT Μ Ν I F TAC ATA TTT TTG TTT TTG CTG TCA TTC GTT CAA

I f J F L F L L S F V Q +

R

I

R M Ε •

TAC ATA TTT TTG TTT TTG CTG TGA TTC GTT CAA

I

F L F L L S F V Q

Expression and Secretion of Bacterial Thermophilic Hemicellulases in

Recommend Documents