Extratelomeric Binding of the Telomere Binding Protein TRF2 at the

Subscriber access provided by - Access paid by the | UCSB Libraries

Extra-telomeric binding of the telomere binding protein TRF2 at the PCGF3 promoter is G-quadruplex motif dependent Gunjan Purohit, Anand Kishor Mukherjee, Shalu Sharma, and Shantanu Chowdhury Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.8b00019 • Publication Date (Web): 28 Mar 2018 Downloaded from http://pubs.acs.org on March 28, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

ExtraExtra-telomeric binding of the telomere binding protein TRF2 at the G-quadruplex motif dependent PCGF3 promoter is GGunjan Purohit1,2, Anand Kishor Mukherjee1,2, Shalu Sharma1,2, Shantanu Chowdhury1,2,3* 1Genomics 3G.N.R.

and Molecular Medicine Unit, 2Academy of Scientific and Innovative Research (AcSIR) and

Knowledge Centre for Genome Informatics, CSIR- Institute of Genomics and Integrative Biology,

Mathura Road, New Delhi, 110025, India. * all

correspondence to be addressed to SC at [email protected]

Abstract Telomere repeat binding factor 2 (TRF2) is critical for the protection of chromosome ends. Mounting evidences suggest that TRF2 associates to extra-telomeric sites and TRF2 functions may not be limited to telomeres. Here, we show that the PCGF3 promoter harbors a sequence capable of forming the DNA secondary structure G-quadruplex motif, which is required for binding of TRF2 at the PCGF3 promoter. We demonstrate that promoter binding by TRF2 mediates PCGF3 promoter activity, and both the N-terminal and C-terminal domains of TRF2 are necessary for promoter activity. Together, this shows for the first time that a telomere-binding factor may regulate a component of the polycomb group of proteins.

Key Words TRF2, G-quadruplex, PCGF3, Telomere, Extra-telomeric, Protein-quadruplex binding

ACS Paragon Plus Environment

1

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 27

Introduction TRF2 binds to double-stranded telomeric DNA through its C-terminal Myb domain1. Telomeric association of TRF2 plays a critical role in telomere end protection by helping to evade detection of chromosomal ends as double stranded breaks2. TRF2 is also required for the inhibition of nonhomologous end joining and formation of t-loop at the telomeres3,4. Interestingly, recent studies suggest possible role(s) of TRF2 beyond telomeres wherein 'extra-telomeric' associations of TRF2 have been identified5–9. Characteristics of such interactions – for instance, a distinct binding motif or other cofactors that dictate extra-telomeric binding of TRF2 - remain to be fully understood.

Telomeres are known to comprise of guanine rich repeats that can adopt a four stranded DNA Gquadruplex structure in solution10–13. In order to maintain the telomere length by telomerase, resolution of telomeric G-quadruplex structure is essential14. Several proteins are required to maintain and protect telomeres out of which few, for example (TRF2 and POT1-TPP1 complex) can bind and modulate these telomeric G-quadruplex structures15–18. Interestingly, TRF2 not only binds to telomeric DNA G-quadruplex but it can also binds to G-quadruplex structure formed by telomere repeat-containing RNA (TERRA)19. Moreover, we recently found G-quadruplexdependent binding of TRF2 to the CDKN1A promoter8. Other groups have reported extratelomeric binding of TRF2 to telomere-like repeats throughout the genome called interstitial telomeric sequences (ITS)6,7, which, as expected from telomere repeats, are putative Gquadruplex forming regions. Interestingly, we found that the promoter of the gene encoding a component of the polycomb group of proteins, the polycomb group ring finger protein 3 (PCGF3) had an ITS. In addition, we noted that in an earlier ChIP-seq study, using a G-quadruplex-specific antibody, enriched signal was observed within the PCGF3 promoter20.

Based on these, we asked whether, and if so how, TRF2 associates within the PCGF3 promoter. Results show TRF2 associates with the PCGF3 promoter and the binding involves presence of


2

Page 3 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

an intact G-quadruplex-forming sequence. Moreover, both N-terminal basic domain and Cterminal DNA binding domains of TRF2 are required for the interaction between TRF2 and the

PCGF3 promoter G-quadruplex. Using reporter assays we further find that this extra-telomeric binding of TRF2 impacts promoter activity of PCGF3.

Materials and Methods 2.1 Cells and culture conditions HT-1080 cells were obtained from the American type cell culture (ATCC, USA) and immortalized MRC5 cells were obtained as a kind gift from Dr. Sagar Sengupta, NII, India. Both Cell lines were maintained in Modified Eagle medium (MEM) with Earles modification and supplemented with 10% fetal bovine serum at 37 0C in 5% CO2.

2.2 Circular Dichroism spectroscopy The circular dichroism (CD) spectra were recorded on a Jasco-810 spectropolarimeter equipped with a Peltier temperature controller. Experiments were carried out using a 1 mm path-length cuvette over a wavelength range of 200-320 nm. Oligos were synthesized commercially from Sigma-Aldrich. 5 µM oligos were diluted in sodium cacodylate buffer (10 mM sodium cacodylate and 100 mM KCl/100 mM LiCl, pH 7.4) and denatured by heating to 95 °C for 5 min and slowly cooled to 15 °C for several hours. The CD spectra reported here are representations of three averaged scans taken at 20 °C and are baseline corrected for signal contributions due to the buffer.

2.3 UV melting spectroscopy Oligos used in circular dichroism were further used for UV melting spectroscopy21. 650 µl of 5 µM oligonucleotide was taken in 1 cm path-length quartz cuvette. Readings were taken at 295 nm for


3

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 27

G-quadruplex structure. The samples were heated from 20 0C to 95 0C and then again cooled at 20 0C with heating and cooling ramp rate of 0.2 0C per minute. The absorbance values were normalized by using the following formula: (Final absorbance – A1) / (Final absorbance – Initial absorbance) where A1 is the first data point. Further smoothening of melting curve was done by averaging method using the origin7 software.

2.4 Chromatin immuneimmune-precipitation (ChIP) and Dot blot assay The ChIP assay was performed for endogenous TRF2 or after TRF2, TRF2 delBdelM mutant overexpression as per the protocol provided by Upstate Biotechnology with modifications as suggested in the Fast ChIP protocol22. In brief, 4 million cells were harvested 48 hour after the seeding or plasmid transfection in a T25 culture flask. Cells were fixed with formaldehyde (Final concentration 1%) for 10 minutes and lysed with SDS lysis buffer. Chromatin was sheared using a Bioruptor (Diagenode). 1% of the total sheared chromatin was used as an input chromatin. After sonication, 4 µg antibody against TRF2 protein (Novus) was used to immunoprecipitate chromatin with overnight incubation at 4 0C. As an isotypic control, 4 µg Rabbit IgG was used. Immune complexes were extensively washed with low and high salt buffer. To extract DNA from immunoprecipitated beads, Chelex-100 resin was used. For dot blot analysis, ChIP DNA was denatured at 95 °C and dot blotted on N+ hybond membrane (Amersham) in pre -wetted in 2X SSC buffer. Rapid-Hyb buffer (Amersham) was used for blocking and hybridization as per manufacturer’s protocol. Following primers were used for ChIP-qRT PCR: PCGF3 G4 MOTIF 1 primer 1 fwd =

AGGGTTGGGTTTAGGTTTAG

PCGF3 G4 MOTIF 1 primer 1 rvs =

ACCCCTAATCCTGACCCTAA

PCGF3 G4 MOTIF 2 primer 2 fwd =

GTCTGGTCTAGGGTTAGGGTT


CCCTAACCCTAAATCCAGTCC

PCGF3 G4 MOTIF 3 primer 3 fwd =

AAACATGACCAGACCCGAAC


4

Page 5 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry


GTCAGAGTTAGGGGTTAGGTTTA

PCGF3 genic fwd =

AAGACACTACCAGCACCACG

PCGF3 genic rvs =

GTTGCCTGGAGCATCACTCT

2.5 ELISA assay Biotinylated oligonucleotides (Sigma-Aldrich) were used at 5 µM concentration in 10 mM sodium cacodylate and 100 mM KCl buffer and denatured at 95 0C for 5 minutes, followed by slow cooling to room temperature to induce G-quadruplex formation. 384-well streptavidin coated preblocked plates from Thermo Scientific (Pierce) were used for ELISA assay. Biotinylated oligos were diluted to 5 pmol in 1X PBST buffer and loaded into each well. Oligos were incubated at 37 0C

on a shaker for 2 hours to allow streptavidin and biotin binding and then washed 3 times with

1X PBST buffer. TRF2 protein was diluted in 1X PBST buffer and incubated with oligos for 2 hours on a shaker at 4 0C and washed 3 times with 1X PBST buffer. In the competition assay, TRF2 was added along with competitor oligo. Anti-TRF2 antibody (Novus NB110-57130) was used in 1:1000 dilution (60 µl per well) and incubated for 1 hour at room temperature on a shaker. Wells were washed three times with 1X PBST. Alkaline phosphatase conjugated antiIgG antibody (Sigma) was used in 1:1000 dilution (60 µl/well) and incubated for 45 minutes at room temperature on a shaker and then wells were washed once with 1X PBST and twice with 1X PBS. 10 µl BCIP/NBT substrate was added into each well and absorbance was recorded at 610 nm wavelength for 1 hour with 10-minute interval on TECAN multimode reader. Two controls were used in ELISA assay to subtract background binding of antibody and protein. Protein negative control= Except TRF2 protein; all other reagents were added to determine the background binding of antibodies Oligo negative control = Except oligo, all other reagents along with increasing concentration of protein were added to determine background binding of protein. The absorbance obtained from control wells were subtracted from absorbance obtained from experiment wells to get specific binding. The curve was fitted by non-linear regression using


5

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 27

GraphPad Prism6 software (trial version). The equation used for curve fitting was Y = Bmax*X/(Kd + X), where Y is normalized absorbance and X is protein concentration. The mean value of 3 independent experiments was plotted with standard error.

2.6 Vector constructs Two bacterial expression vectors, pTRC-hisTRF2 and pTRC-hisTRF2_delB mutants were received as a gift from Dr. Giraud Panis, CNRS, France. In order to clone TRF2_delBdelM vectors, the delBdelM domain was PCR amplified and cloned within HindIII and XhoI restriction enzyme site of the pTRC-hisTRF2 vector. For the construction of pTRC-his TRF2 delM vector, pTRC-his TRF2 vector was digested with PvuII enzyme and re-ligated. The promoter region of

PCGF3 harboring TRF2 binding peak was cloned into pGL3 vector between KpnI and HindIII restriction sites. The pCMV6-TRF2, pCMV6-TRF2 delB, pCMV6-TRF2 delM, and pCMV6-TRF2 delBdelM vectors were procured from Origene.

2.7 Protein purification purification TRF2 wild type (Uniprot ID: Q15554) and mutant proteins were purified by using E.coli Rosetta Gami2 cells. In brief, transformed cells were inoculated in 5 ml culture with ampicillin antibiotic and kept at 37 0C overnight in a shaker incubator. Next day, 1 ml culture inoculated in 500 ml fresh LB with antibiotic and allowed to grow till 0.8 OD. Then culture was induced with 0.1 mM final concentration of IPTG and kept overnight in a shaker incubator at 18 0C. Next day, the culture was pallet down and sonicated in lysis buffer. 200 µl His-pure nickel NTA beads (Thermo scientific) were added and incubated at 4 0C in a rotatory shaker. Beads were washed with 20 ml solution of 20 mM, 30 mM, 40 mM and 60 mM imidazole. Protein was eluted with 4 ml 250 mM imidazole solution. Concentration of purified protein and buffer exchange to remove imidazole was done by using Millipore 4 ml concentrator columns. Purified protein was quantified by BCA method (Thermo scientific BCA kit).


6

Page 7 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

2.8 Oligonucleotide pullpull-down assay Oligo pull-down was performed either with purified TRF2 protein or HT1080 cell lysate. The oligos were provided appropriate conditions to fold into a G-quadruplex structure. Next, 500 µg protein lysate or 2 µg purified TRF2 protein was incubated with 20 pmol oligonucleotide for 16 hours at 4 0C on a rotatory shaker. 50 µl streptavidin-sepharose beads were used to pull down biotinylated oligo. Beads were washed three times with 500 µl wash buffer (50 mM Tris-HCl [pH 7.5], 2 mM MgCl2, and 150 mM NaCl). The bound proteins were then eluted by boiling in 2X SDS sample buffer (20 mM Tris-HCl [pH 6.8], 12% glycerol, 4% SDS, 100 mM dithiothreitol, 4 mM EDTA, and 0.004% Coomassie brilliant blue R250) and subjected to western blot analysis using anti-TRF2 antibody (Novus). 20 µl cell lysate was used as input and bead without oligonucleotide was used as a negative control.

2.9 Luciferase assay The wild and mutant TRF2 vectors were co-transfected with PCGF3 reporter construct in HT1080 cells by using lipofectamine 2000 (Invitrogen). Plasmid (pGL 4.73) containing CMV promoter driving renilla luciferase was co-transfected as an internal control. After 48 hours, cells were harvested and luciferase activities of cell lysate were measured by dual-luciferase reporter assay system (Promega).

2.9 RNA isolation and qRT PCR For RNA isolation, 1X106 cells were re-suspended in Trizol reagent (Invitrogen) and processed according to manufacturer protocol. RNA was converted into cDNA by high capacity cDNA reverse transcription kit (Applied Biosystem). Following primers were used for qRT PCR: PCGF3_qRT_Fwd primer = AGGACAACGACTACCACCGCAG PCGF3_qRT_Rev primer = TCTTCAGATGCAAGACGGTCGC GAPDH_qRT_Fwd primer = GTCTCCTCTGACTTCAACAGCG GAPDH_qRT_Rev primer = ACCACCCTGTTGCTGTAGCCAA ACS Paragon Plus Environment

7

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 27

Results 3.1 GG-quadruplex formation in the promoter of PCGF3 The PCGF3 gene located in the sub-telomeric region of chromosome 4 has a guanine rich promoter. Interestingly, a closer look at 2 kb upstream sequence (from transcription start site (TSS)) of PCGF3 promoter using the G-quadruplex-finding algorithm Quadbase23 showed the presence of several non-overlapping potential G-quadruplex sequences (of the G3L1-7 type (Supplementary Figure S1A)). We prioritized study of a 21-mer sequence (based on G-score and similarity to the telomeric G-quadruplex sequence, see Supplementary Figure S1B for details), with high similarity to the telomeric G-rich repeats, from the guanine-rich promoter region of

PCGF324, and examined its potential to adopt a G-quadruplex structure in solution by circular dichroism (CD) spectroscopy. The CD spectra of the oligomer showed a strong positive peak at 264 nm and a negative peak at 240 nm (a weak positive peak at 290 nm was also observed) suggesting formation of a parallel type of G-quadruplex structure primarily (Fig. 1A). Further, the substitution of particular guanine bases by adenine bases in PCGF3 promoter G-quadruplex sequence showed a decrease in the amplitude of the characteristic peaks for quadruplex formation (Fig. 1A). This signified the requirement of the guanine bases for the structure formation, further reaffirming the observation of G-quadruplex formation by the 21-mer oligonucleotide.


8

Page 9 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 1. (A) CD spectra of PCGF3_G4 and PCGF3_G4_Mut oligonucleotide in 10 mM sodium cacodylate and 100 mM KCl buffer (solid line). Substitution of guanine bases by adenine causes disruption of G-quadruplex signature (dashed line). (B) UV melting spectra of PCGF3_G4 oligonucleotide. Thermal denaturation (black line) and renaturation (gray line) spectra is showing the formation of stable G-quadruplex with a melting temperature of 63 0C.

Next, we determined the stability of the G-quadruplex structure by UV melting spectroscopy. The changes in absorption spectra were recorded at 295 nm by subsequent heating and cooling of the oligonucleotide. This showed high stability with a melting temperature of 63 0C (Fig. 1B). We also noted significantly low hysteresis in the superimposed curves of heating and cooling cycles supporting formation of an intra-molecular G-quadruplex structure with fast folding kinetics. Replacement of potassium salt with 100 mM LiCl in the buffer showed a reduction in the Gquadruplex signature, and a relatively low melting temperature (37 0C) (Supplementary Fig. S1C, S1D). However, in LiCl containing buffer, we observed a weak antiparallel G-quadruplex signature (Supplementary Fig. S1C).


9

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 27

3.2 TRF2 binds to the PCGF3 promoter GG-quadruplex structure with high affinity TRF2 was reported to interact with the G-quadruplex formed by telomeric DNA in solution15, and recently, we found that TRF2 binds to a G-quadruplex formed within the p21 promoter8. Herein, we performed enzyme-linked immunosorbent assay (ELISA) to check if TRF2 directly interacts with the PCGF3 promoter G-quadruplex. Biotinylated oligomers (PCGF3_G4 or PCGF3_G4_mut) (Fig. 2A) were allowed to fold into G-quadruplex structure, immobilized on streptavidin-coated microwells and treated with purified recombinant TRF2 (see Methods). We observed higher affinity of TRF2 for the G-quadruplex formed by PCGF3_G4 sequence compared to mutant or the double stranded sequence: Kd values for TRF2 interaction with PCGF3_G4 and PCGF3_G4_mut sequence were 5.918 ± 2.05 nM and 7.659 ± 3.67 nM, respectively (Fig. 2A). We next examined the possibility of interaction between TRF2 and the double-stranded form of the PCGF3_G4 oligomer: relative decrease in affinity was noted between TRF2 and the double-stranded (Kd = 7.98 ± 6.65 nM) sequence compared to the G-quadruplex structure (Fig. 2A). Competition assays were performed to further confirm specificity of the interactions using nonbiotinylated PCGF3 G-quadruplex at ten-fold higher concentration. Independently, nonbiotinylated

mutant

(PCGF3_G4_mut)

or

non-specific

oligonucleotides

(10-fold

higher

concentration than biotinylated sequence), which do not form G-quadruplex were used as a negative control. We observed that the addition of non-biotinylated competitor G-quadruplex almost completely disrupted the interaction between TRF2 and PCGF3 G-quadruplex (Fig. 2B). Whereas, a ten-fold excess of non-biotinylated mutant, or non-specific oligonucleotide, did not show any effect on the TRF2-G-quadruplex interaction. Together these results suggest specific interaction between TRF2 and the PCGF3 G-quadruplex structure.


10

Page 11 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. Binding of TRF2 to the G-quadruplex structure. (A) TRF2 binds to the G-quadruplex structure formed by PCGF3_G4 with higher affinity compared to the mutant sequence or the double-stranded sequence of the PCGF3_G4 oligonucleotide (p

Extratelomeric Binding of the Telomere Binding Protein TRF2 at the

Recommend Documents