Chem. Res. Toxicol. 2004, 17, 1057-1063
1057
Flanking Sequences Modulate Diepoxide and Mustard Cross-Linking Efficiencies at the 5′-GNC Site Gregory A. Sawyer, Elizabeth D. Frederick, and Julie T. Millard* Department of Chemistry, 5757 Mayflower Hill Drive, Colby College, Waterville, Maine 04901 Received March 25, 2004
Diepoxybutane, diepoxyoctane, and mechlorethamine are cytotoxic agents that induce interstrand cross-links between the N7 positions of deoxyguanosine residues on opposite strands of the DNA duplex preferentially at 5′-GNC sequences. We have systematically varied the identity of either the base 5′ to the cross-linked deoxyguanosine residues or the intervening base pair to determine flanking sequence effects on cross-linking efficiency. We used synthetic DNA oligomers containing four 5′-N1GN2C sites that varied either N1 or N2. Interstrand crosslinks were purified through denaturing polyacrylamide gel electrophoresis and then subjected to piperidine cleavage. The amount of cleavage at each deoxyguanosine residue, representative of cross-linking efficiency at that site, was determined by sequencing gel analysis. Our data suggest that cross-linking efficiency varies with the identity of N1 similarly (purines > pyrimidines) for diepoxybutane, diepoxyoctane, and mechlorethamine but that the effects of N2 differ for the three compounds.
Introduction DNA interstrand cross-linking agents such as the nitrogen mustards are double-edged swords. Mustards were originally synthesized for gas warfare; yet, autopsies of exposed soldiers during World War I suggested possible therapeutic benefits of mustards in the treatment of certain cancers due to extreme lowering of the white cell count in bone marrow (1). The development of the water soluble hydrochloride of the nitrogen mustard HN2 (1; Chart 1)1 for treatment of leukemias and lymphomas marked the beginning of cancer chemotherapy (2). Like HN2, DEB (2; Chart 1) is a bifunctional alkylating agent that can be both therapeutic and toxic. While DEB is postulated to be the active form of the antitumor prodrug treosulfan (Ovastat) used in the treatment of advanced ovarian cancer (3), it is carcinogenic in rats and mice (4, 5) and a suspect carcinogen in humans (6). DEB has also been implicated in the increased occurrence of leukemia following exposure to BD among workers in the synthetic rubber industry (7-10). BD is a colorless gas used in the production of rubber, nylon, and many other polymers. Worldwide, approximately 12 billion pounds are produced annually, three billion of which come from the United States (11). Almost four million pounds of BD are estimated to be incidentally emitted from U.S. production facilities annually (12), and it is also a component of cigarette smoke and automobile exhaust (13, 14). BD generally enters the body through inhalation and is metabolized by liver cytochrome P450 to produce the DNA reactive metabolites EB, DEB, and 3,4-epoxy1,2-butane-diol (15, 16). Of these oxidation products, DEB is about 2 orders of magnitude more mutagenic than * To whom correspondence should be addressed. Tel: 207-872-3311. Fax: 207-872-3804. E-mail:
[email protected]. 1 Abbreviations: HN2, mechlorethamine; DEB, 1,2,3,4-diepoxybutane; BD, 1,3-butadiene; EB, 1,2-epoxy-3-butene; DEO, 1,2,7,8-diepoxyoctane; OD260, optical density at 260 nm; TE, 10 mM Tris buffer and 1 mM EDTA (pH 7.5); PAGE, polyacrylamide gel electrophoresis; dPAGE, denaturing polyacrylamide gel electrophoresis.
Chart 1. Structures of the Cross-Linking Agents HN2 (1), Diepoxybutane (2), and Diepoxyoctane (3)
either EB or the diol epoxide, a property attributed to its ability to form DNA cross-links (17). We have been investigating DEB and related compounds, including the longer-chained DEO (3; Chart 1), in an attempt to elucidate the molecular determinants of cross-linking specificities. DEB and HN2 alkylate the N7 position of deoxyguanosine residues and were originally proposed to form interstrand linkages at 5′-GC sequences, which contain the minimal N7-to-N7 distance (18). However, more recent experimental evidence indicates that nitrogen mustards, DEB, and DEO cross-link distal deoxyguanosines on opposite strands at duplex 5′-GNC sequences (where N ) A, G, C, or T) in short oligomers (19-23), longer restriction fragments (24), and defined sequence nucleosomal core particles (25). While DEB, DEO, and HN2 share a preference for cross-linking the 5′-GNC sequence, they have different secondary preferences for cross-linking. For example, 5′-GNNC reacts at ∼50% of the frequency of 5′-GNC for DEB (22), ∼77% of the frequency of 5′-GNC for DEO (23), and ∼36%
10.1021/tx0499057 CCC: $27.50 © 2004 American Chemical Society Published on Web 07/09/2004
1058 Chem. Res. Toxicol., Vol. 17, No. 8, 2004 Table 1. Duplexes Varying Either the N1 or the N2 Base Pair within the 5′-N1GN2C Sitea duplex
sequence
N1-A
CAATGACAAACGACGTAGGACCATAGACTTAG GTTACTGTTTGCTGCATCCTGGTATCTGAATC CAACGACGTATGACAAAAGACTTAGGACCTAG GTTGCTGCATACTGTTTTCTGAATCCTGGATC CAATGACAAATGGCATATGTCAATTGCCATAG GTTACTGTTTACCGTATACAGTTAACGGTATC CAATGGCAAATGACATATGCCAATTGTCATAG GTTACCGTTTACTGTATACGGTTAACAGTATC
N1-B N2-A N2-B a
Bold bases show the sites of variance.
of the frequency of 5′-GNC for HN2 (26) when both sequences are present within a single DNA duplex. During the course of the nucleosome core particle studies, we noted that despite sharing the same consensus sequence for cross-linking, HN2, DEB, and DEO produced distinct patterns of interstrand cross-links when separated by dPAGE. We attributed these distinct patterns to subtle differences in the sites and efficiencies for cross-linking within the restriction fragment. The GNC potential sites of cross-linking in the DNA used in the core particle studies varied in the identity of the central “N” and the flanking sequences. Differences in the impact of flanking sequences for DEB, HN2, and DEO could contribute to the observed differences in the patterns of cross-linked bands. Modulation of the core sequence preference for cross-linking by a secondary influence of flanking sequences has been demonstrated for other agents. For example, mitomycin C cross-links deoxyguanosine residues on opposite strands exclusively at the sequence 5′-CG (27-29); yet, the efficiency of crosslinking is influenced by flanking sequences, with 5′-ACGT about twice as reactive as 5′-CCGG and 5′-TCGA (30, 31). Our goal in this study was to determine the impact of the bases flanking the GNC site on the cross-linking efficiencies of DEB, HN2, and DEO. We used a panel of DNA oligomers containing four different potential sites for cross-linking that varied in the identity of the bases adjacent to the cross-linked deoxyguanosines at the duplex sequence 5′-N1GN2C (Table 1). One set of duplexes varied the base immediately 5′ to the cross-linked deoxyguanosine residue (the N1 base), while the other set varied the base pair between the cross-linked residues (the N2 base and its complement). The order of the four different sites along the duplex was varied within each set to account for possible end effects or overalkylation. Presenting four different sites within the same duplex ensured that all sites experienced identical reaction conditions. We purified cross-links via dPAGE, subjected them to piperidine cleavage at the site of alkylation, separated products via further dPAGE, and used quantitative phosphorimagery to determine efficiencies of cross-linking at each site. Our data suggest that N1 and N2 impact cross-linking differently for each agent. Our findings were supported by the differing cross-linking efficiencies of a series of test duplexes containing “best” and “worst” combinations according to our initial data.
Experimental Procedures Preparation of Radiolabeled DNA Duplexes. Oligonucleotides were purchased from Integrated DNA Technologies, Inc. (Coralville, IA) and purified through 20% dPAGE (19:1 acrylamide:bisacrylamide; 40% urea) followed by the crush-and-soak
Sawyer et al. procedure (32). A single strand (0.25 OD260) was 5′-end radiolabled with [γ-32P]ATP (Amersham Biosciences) and T4 polynucleotide kinase followed by ethanol precipitation with 0.3 M NaOAc (32). The complementary strand (0.3 OD260) was added, and the volume was adjusted to (50 - volume of cross-linker to be added) µL with TE buffer (pH 7.4) for DEB/DEO or 40 mM sodium cacodylate (pH 8) for HN2. The samples were incubated at 65 °C for 15 min and then cooled at ambient temperature for 15 min to achieve duplex formation. Cross-Linking Reactions. Cross-linking was initiated by the addition of DEB (1 µL; final concentration, 250 mM), DEO (2 µL; final concentration, 250 mM), or HN2 (2.5 µL from a fresh 1 mM stock in sodium cacodylate; final concentration, 50 µM). Following an initial time course study to determine the optimal cross-linking time, incubation was at 37 °C for 45 min (DEB), 1 h (DEO), or 30 min (HN2), followed by ethanol precipitation and lyophilization. Separation of Cross-Links. Cross-linked samples were dissolved in 10 µL of 5 M aqueous urea/0.1% xylene cyanole and loaded onto a 20% polyacrylamide gel (19:1 acrylamide/bisacrylamide, 50% urea), run on a Hoefer Poker Face gel stand at 60 W and ambient temperature. For analysis of cross-linking, counts loaded onto the gels were equalized and the gels were dried and then phosphorimaged (BioRad GS-505 Imaging System with Molecular Analyst version 2.1.2). For purification of cross-links, low-mobility bands (approximately half the mobility of the corresponding single strands) were excised from wet gels following autoradiography and purified by the crush-andsoak procedure (32). Monoadducts were purified by excision of single-stranded DNA followed by crushing and soaking. Piperidine Cleavage of Alkylated DNA. Gel-purified cross-linked or monoalkylated DNA was cleaved at sites of guanine N7 alkylation by heating at 90 °C in 10% aqueous piperidine for 30 min (33). The samples were lyophilized, dissolved in 40 µL of water, lyophilized, dissolved in an additional 25 µL of water, and lyophilized again. Sequencing Gel Analysis. The samples were dissolved in 10 µL of 5 M urea/0.1% xylene cyanole and loaded onto a 25% polyacrylamide gel (19:1 acrylamide/bisacrylamide, 50% urea) run at 60 W and 55 °C. After the samples were dried and phosphorimaged, bands corresponding to cleavage at deoxyguanosine residues within 5′-GNC sites were quantitated through volume analysis. Volumes were expressed as percent of total, where the total represented the sum of the volumes for the four cross-linked deoxyguanosine residues within GNC sites. Statistical Analysis. Values for percent cross-linking at each of the four GNC sites were compared to determine the influence of each base. We used Analysis of Variance (StatView 4.5) with Fisher’s test for pairwise comparisons (T, C; T, G; T, A; C, G; C, A; and G, A) to determine significance.
Results Determining Reaction Conditions. We optimized the reaction times for each agent at concentrations previously determined (25) by performing a time course study on the N1-A duplex (Table 1). Aliquots of DEB (250 mM), DEO (250 mM), and HN2 (50 µM) reactions were ethanol precipitated and then analyzed by dPAGE. The gels showed a single predominant band corresponding to single-stranded DNA initially with a band of reduced mobility corresponding to interstrand cross-linked DNA first increasing and then decreasing over time (Figure 1). The loss of cross-links due to spontaneous depurination has been noted previously for HN2 (34). The reaction times were selected to achieve about 5% cross-linking (the maximum for DEO) for each agent and then used for all subsequent studies. Impact of the 5′ Neighbor on Cross-Linking at GNC Sites. The influence on cross-linking efficiency of the base immediately 5′ to the cross-linked deoxygua-
Diepoxide and Mustard Cross-Linking Efficiencies
Figure 1. Representative time course of cross-linking the N1-A duplex (see Table 1) with the top strand 5′-end radiolabeled. Aliquots of a reaction (250 mM DEO) were ethanol precipitated at the following times: 0 (lane 1), 15 (lane 2), 30 (lane 3), 45 (lane 4), 60 (lane 5), and 75 (lane 6) min. Single-stranded material contains both unmodified DNA and monoadducts. Interstrand cross-links (arrow) have about half the mobility of the corresponding single strands.
nosine residue was determined through analysis of the N1 pair of duplexes. The N1 duplexes each contained four putative sites for cross-linking (AGACT, GGACC, CGACG, and TGACA) with the order of these sites differing in the pair (Table 1). The N1-A duplex contained the N1 ) C and N1 ) G sites in the middle, whereas the N1-B duplex contained the N1 ) T and N1 ) A sites in the middle. Each duplex was independently labeled on the 5′-end of each strand and subjected to DEB, DEO, or HN2. Crosslinked material was purified from wet denaturing gels in order to quantitate the partitioning of cross-linker between the four sites. The samples of single-stranded DNA, containing both unreacted DNA and monoadducts, were also purified. Cross-links and monoadducts were cleaved at sites of N7 alkylation through incubation with 10% aqueous piperidine at 90 °C. The resulting fragments were resolved via dPAGE (Figure 2) followed by quantitative phosphorimagery. The intensities of the four bands corresponding to the cross-linked deoxyguanosine residues within each GNC site were summed to 100% with cleavage intensity at each band representing the cross-linking efficiency for that site. Means were compiled from four replicate trials for each duplex labeled on each strand (16 data points for each site; Table 2). Means for monoalkylation at the same deoxyguanosine residues were also compiled (Table 3). While each deoxyguanosine residue within the four N1GAC sites was monoalkylated approximately equally, cross-linking efficiencies varied considerably. The overall trend for all three compounds was that a purine immediately 5′ to the cross-linked deoxyguanosine residues led to greater amounts of cross-linking than a pyrimidine did, with N1 ) G significantly preferred over N1 ) A (for DEB, p ) 0.01; for DEO and HN2, p < 0.0001). This overall preference for G was the most pronounced for DEO, for which 58% of the total cross-linking was at the GGACC site. In general, the least preferred base was C, although the difference between N1 ) C and N1 ) T was not significant for DEB (p ) 0.0629). The difference between N1 ) A and N1 ) T was significant only for DEO (p ) 0.0006). The effects of the N1 base on cross-linking can be summarized as follows: for DEB, G > A g T g C; for DEO, G > A > T > C; and for HN2, G > A g T > C.
Chem. Res. Toxicol., Vol. 17, No. 8, 2004 1059
Figure 2. Denaturing gel separation of piperidine cleaved, cross-linked N1-B duplex (see Table 1) with either the top strand (lanes 1-3) or the bottom strand (lanes 4-6) 5′-end radiolabeled. The identity of the N1 base is indicated to the left of the image for lanes 1-3 and to the right of the image for lanes 4-6. Asterisks indicate cleavage at the GNNC secondary site; m indicates suspected monoalkylation. Lanes 1 and 4, DEB; lane 2 and 5, DEO; and lanes 3 and 6, HN2. Table 2. Mean % Cross-Linking with Varying N1 within the 5′-N1GAC Site mean % ( SD N1
DEB
DEO
HN2
A G C T
26.7 ( 8.29 32.0 ( 4.83 18.8 ( 6.07 22.6 ( 2.10
18.0 ( 3.17 58.0 ( 5.03 10.3 ( 1.53 13.8 ( 2.42
24.7 ( 6.99 34.3 ( 3.50 16.6 ( 4.01 24.4 ( 4.30
Table 3. Mean % Monoalkylation with Varying N1 within the 5′-N1GAC Site mean % ( SD N1
DEB
DEO
HN2
A G C T
22.7 ( 1.37 26.2 ( 0.909 24.6 ( 0.450 26.5 ( 1.58
23.7 ( 2.45 26.8 ( 2.97 23.8 ( 1.62 25.7 ( 3.64
24.6 ( 5.21 24.3 ( 5.74 24.5 ( 4.03 26.6 ( 5.17
Impact of the Intervening Base Pair on CrossLinking at GNC Sites. A similar set of experiments was conducted on the N2 pair of duplexes, which contained four TGN2CA sites varying in the identity of N2. Because of symmetry in the duplex, the N2 ) A site should be equivalent to the N2 ) T site. Likewise, the N2 ) G and N2 ) C sites should also be equivalent. These equivalences provide an internal control to test the accuracy of our measurements. Relative band intensities for the four deoxyguanosine residues at GNC sites determined through quantitative phosphorimagery of piperidine-cleaved fragments on denaturing gels were used as a measure of cross-linking for the four different sites (Figure 3). The mean of four replicate trials for each duplex labeled on each strand was again calculated to determine crosslinking efficiencies at each site (Table 4). Means for monoalkylation at the same deoxyguanosine residues were similarly established (Table 5). Again, while monoalkylation was fairly uniform, efficiencies of cross-linking varied depending on the intervening base pair between the cross-linked deoxyguanosines for the diepoxides. For DEB, the two sites
1060 Chem. Res. Toxicol., Vol. 17, No. 8, 2004
Sawyer et al.
Figure 4. Denaturing gel analysis of cross-linking for the test panel of duplexes (see Table 6). Interstrand cross-links are indicated by the arrow. Relative amounts of cross-linking, given in parentheses for each lane, were calculated by dividing the mean of replicate trials by the lowest mean for each agent. Lane 1, DEB-reacted GGCCC (6.3); lane 2, DEB-reacted TGCCA (4.2); lane 3, DEB-reacted CGTCG (1.0); lane 4, DEO-reacted GGCCC (3.5); lane 5, DEO-reacted TGCCA (1.0); lane 6, DEO-reacted CGTCG (2.6); lane 7, HN2-reacted GGCCC (1.3); lane 8, HN2reacted TGCCA (1.1); and lane 9, HN2-reacted CGTCG (1.0). Figure 3. Denaturing gel separation of piperidine cleaved, cross-linked N2-B duplex (see Table 1) with the top strand 5′end radiolabeled. The identity of the N2 base is indicated on the right of the image. The asterisk indicates cleavage at the GC secondary site. Lane 1, DEB; lane 2, DEO; and lane 3, HN2. Table 4. Mean % Cross-Linking with Varying N2 within the 5′-TGN2C Site mean % ( SD
Table 6. Duplexes Designed to Test Best and Worst Bases at the N1 and N2 Sites for Cross-Linking duplex
sequence
GGCCC
CGAAGGCCCAAGGCCCTAGGCCCATGC GCTTCCGGGTTCCGGGATCCGGGTACG CGAATGCCAAATGCCATATGCCAATGC GCTTACGGTTTACGGTATACGGTTACG CGAACGTCGAACGTCGTACGTCGATGC GCTTGCAGCTTGCAGCATGCAGCTACG
TGCCA CGTCG
N2
DEB
DEO
HN2
A G C T
5.18 ( 1.26 44.3 ( 5.21 45.4 ( 5.13 5.12 ( 2.87
28.8 ( 4.85 23.1 ( 4.27 22.1 ( 4.85 26.1 ( 3.61
24.7 ( 6.39 24.9 ( 4.00 26.9 ( 2.57 23.6 ( 6.30
Table 5. Mean % Monoalkylation with Varying N2 within the 5′-TGN2C Site mean % ( SD N2
DEB
DEO
HN2
A G C T
25.7 ( 3.19 25.0 ( 11.0 24.6 ( 9.89 24.8 ( 4.34
30.8 ( 4.80 21.8 ( 4.74 24.3 ( 4.52 23.3 ( 2.51
29.4 ( 2.86 23.7 ( 3.42 24.8 ( 2.70 22.2 ( 2.61
containing a G-C base pair accounted for 90% of the total cross-linking, with approximately equal partitioning between the two. For DEO, an A-T base pair was preferred by a small margin (about 55% of total crosslinking). Comparisons between noncomplementary bases showed significant differences for three of the four pairs (A, C; T, C; and A, G were significant, but T, G was not). In contrast, there was no significant difference between any of the bases in the N2 position for HN2. Verification with Test Oligomers. We used our findings for the impact of the N1 and N2 bases to design oligomers that contained a cross-linking site (present in triplicate to increase the overall amount of cross-linked material) containing extreme combinations of N1 and N2 bases (Table 6). For example, the duplex containing three GGCCC sites optimizes both N1 (G) and N2 (a G-C base pair) for DEB, while the duplex containing three CGTCG sites has the worst N1 (C) and N2 (an A-T base pair) for DEB. Because the optimal base combinations differ for the three agents, the order of cross-linking preference for these duplexes should vary for DEB, DEO, and HN2. Denaturing gels were used to assess relative cross-linking by each agent for each radiolabeled duplex (Figure 4).
For DEB, the order of cross-linking was GGCCC > TGCCA > CGTCG with about a 6-fold difference between the best and the worst. The observed differences were consistent with the general trends predicted from the N1 and N2 duplexes, with deoxyguanosine favorable at the 5′ position, deoxycytidine unfavorable at the 5′ position, and an intervening G-C base pair leading to an enhancement of cross-linking relative to an A-T base pair. For DEO, the order of cross-linking was GGCCC > CGTCG > TGCCA. The magnitude of the effect of the N1 and N2 bases was smaller than for DEB, with a 3.5fold difference between the best and worst duplexes. In this case, the presence of a favored intervening A-T base pair appeared to offset the unfavorable deoxycytidine at the 5′ position, leading to enhanced cross-linking of the CGTCG duplex relative to the TGCCA duplex. For HN2, the order of cross-linking was GGCCC > TGCCA > CGTCG. Although the order of cross-linking was similar to that for DEB, the difference between the best and the worst duplex was less than a factor of 2. Therefore, the flanking sequences appear to have a smaller impact on cross-linking by HN2 relative to DEB. Verification of Cross-Linked Residues in the GGCCC Duplex. Because the GGCCC sequence contains two GNC sites (AGGC and GGCC), we wished to verify sites of cross-linking in this duplex. Each strand was independently 5′-end radiolabeled, annealed to its cold complement, and cross-linked. The cross-linked material was purified from denaturing gels, piperidine cleaved, and analyzed on a sequencing gel. The second deoxyguanosine residue, corresponding to cross-linking with G at the N1 position rather than A, was cross-linked preferentially by all three agents (Figure 5). This preference was highest for DEO (about a factor of 2) and lowest for HN2 (about a factor of 1.5). All three deoxyguanosine residues of the complementary strand were alkylated to
Diepoxide and Mustard Cross-Linking Efficiencies
Chem. Res. Toxicol., Vol. 17, No. 8, 2004 1061
distinct GNC sites, changing the sequence context of the putative cross-linking sites systematically by varying either the 5′ base or the intervening base pair independently and holding the rest of the sequence constant. As we designed our test oligomers, symmetry in the duplex sequence (where the primes refer to the complementary
Figure 5. Mean relative percentages of cross-linking as a function of nucleotide position within the duplex containing the GGCCC site. Piperidine cleavage product band intensities from separate duplicate experiments in which either the top or the bottom strand was 5′-end radiolabeled were averaged.
some degree, suggesting modest amounts of cross-linking at the secondary sites 5′-GC and 5′-GNNC. Therefore, the enhanced cross-linking of the GGCCC duplex results from a combination of the most favorable base in the N1 position (G), the presence of two GNC sites, and additional cross-linking at the secondary sites 5′-GC and 5′-GNNC.
Discussion The base specificity of DNA damage impacts the mutational spectrum and genomic sites targeted, which in turn are likely to dictate the ultimate biological effects of an alkylating agent. DEB, administered as the prodrug treosulfan, and HN2 are both used in the treatment of cancer; yet, both are risk factors in the development of leukemia following treatment for Hodgkin’s disease (35, 36), with HN2 posing a greater risk than DEB. DEB has also been linked with ovarian toxicity and carcinogenicity in mice (37). While the mutagenic events leading to carcinogenesis remain unclear, characterizing the sequences targeted could provide information about the genomic sites damaged and insight into the molecular mechanisms of carcinogenesis. We undertook this study to determine the influence of the bases flanking the consensus sequence on the cross-linking of DEB, HN2, and DEO. While DEB, DEO, and HN2 share a core preference for cross-linking the 5′-GNC sequence, there are observable differences for the three agents in the pattern of cross-linked bands resolved by denaturing gels (25). The sequence context has previously been demonstrated to influence DNA reactivity for a number of agents. For example, nitrogen mustards show greater reactivity toward guanines within runs of contiguous guanines (38-40). This preference has been attributed to the negative electrostatic potential in G-rich regions exerting an attractive force on the activated form of nitrogen mustards, the positively charged aziridium intermediate (41). However, a systematic study of the influence of the bases flanking the GNC sites on cross-linking has not previously been undertaken for HN2 or either diepoxide. Our goal was to elucidate whether certain neighboring bases promote cross-linking by HN2, DEB, and DEO at GNC sites. We used DNA oligomers containing four
base) led us to conclude that N1 should be preserved at the position 5′ to the cross-linked deoxyguanosine residues (bold) on both strands of the duplex. Therefore, each site contained the complement of N1 as the base immediately following the deoxycytidine of GNC, as in AGACT. Furthermore, any base at the N2 position on one strand necessitates its complement on the other strand. Therefore, we would expect the percent cross-linking for complementary bases at the N2 position to be equivalent. We determined reaction times based on concentrations previously determined for each agent (25). HN2 is a much more efficient cross-linker than either diepoxide, inducing comparable amounts of cross-linking at 50 µM vs the 250 mM concentrations required for DEB and DEO. DEO is the least efficient of the three agents, requiring relatively long reaction times yet still having a slightly reduced overall yield of cross-link. We standardized based on the maximum yield of ∼5% for DEO, adjusting reaction times accordingly with the N1-A duplex and maintaining these conditions for all subsequent trials. Our methods are highly dependent on conditions of single hit because only the alkylation event closest to the radiolabel will be detected. Multiple alkylation events would lead to a diminishing of cleavage products as the distance from the radiolabel increases. We did not observe this phenomenon on any of the gels used to analyze cleavage products. However, to correct for any possible overalkylation, we 5′-end radiolabeled each strand independently so that the order of the sites was inverted, with the first site becoming the last. Hyperreactivity has been previously noted for duplex termini in short DNA oligomers (22), a factor that we wished to minimize. Thus, in the event that terminal cross-linking is facilitated, we also designed a second duplex to test the effects of both N1 and N2 in which the inside sites became the outside sites. Equal numbers of trials for all four cases (the two strands independently labeled for each duplex) were averaged to obtain cross-linking efficiencies for each site. We designed our test oligomers to contain a minimum number of deoxguanosine residues outside of the 5′-GNC site to limit the influence of secondary reactions at other guanine-containing sites. We did observe some cleavage products corresponding both to monoadducts and to cross-links at deoxyguanosines within GNNC and GC sites. However, we included only the cleavage products from the GNC sites in our calculations of the total intensity from which cross-linking efficiencies were calculated. Our findings for the N1 duplex were qualitatively similar for all three compounds. Monoalkylation was relatively random in each case, suggesting that specificity arises primarily at the second step, reaction of the second arm to form cross-link, rather than at the initial alkylation event. This is consistent with previous reports for
1062 Chem. Res. Toxicol., Vol. 17, No. 8, 2004
mustard (26), DEB (22), and diepoxyoctane (23). Furthermore, the deoxyguanosine immediately 5′ to the cross-linked deoxyguanosine led to significantly more cross-linking than any other base, and purines appeared to be more favorable for cross-linking than pyrimidines in the 5′ position. Part of this enhancement is likely to arise from secondary cross-linking at GNNC sites, which may contribute to the dramatic effect observed for DEO, with the N1 ) G site accounting for 58% of the total crosslinking. DEO has the greatest secondary preference for the GNNC site of the three agents, but it still cross-links the GNC site about 1.5 times more efficiently. Thus, secondary cross-linking alone cannot account for the 3-fold preference for the N1 ) G site. Moreover, the preference for N1 ) G was retained even for HN2, which showed little cleavage corresponding to cross-linking at GNNC sites. N1 ) A appeared to be modestly favored over N1 ) T, although this preference was significant only for DEO, suggesting that any enhancement by A relative to T is small. In general, the presence of deoxycytidine at the 5′ position to the cross-linked deoxyguanosine led to the least amount of cross-linking. Calculations suggest that the 5′ neighbor of a crosslinked base could influence reactivity through effects on base stacking, helical repeat angle, base pair buckling, and propeller twisting that change the distance between the relevant N7 positions of the cross-linked deoxyguanosines (42). The N7-to-N7 distance within the GNC sequence is 8.9 Å in B DNA (43), suggesting the necessity of local distortion to accommodate the relatively short tethers of DEB [4.0 Å (44)] and HN2 [7.5 Å (26)]. Bending has been confirmed for the HN2 cross-link, with the structural changes bringing the bridged N7 atoms closer together (43). The crystal structure of a dodecamer containing a central GGCC sequence displays a major groove-compressing bend (45), suggesting that deoxyguanosine as the 5′ neighbor of the GNC site could indeed facilitate cross-linking by decreasing the distance between reactive N7 atoms. The 5′ neighbor could also induce local changes in electrostatic potential that enhance the nucleophilic reactivity of the N7 sites, particularly toward the aziridinium intermediate of HN2. Electrostatic effects have been proposed to account for the flanking sequence effects for mitomycin C cross-linking (30), which is promoted by the O2 of pyrimidines adjacent to the cross-linked deoxyguanosine residues. Both guanine and adenine show negative potentials in the major groove (46), possibly contributing to an enhancement of cross-linking when they are in the N1 position. Thymine also has a zone of negative potential centered around O4 in the major groove whereas cytosine has a positive potential in the major groove (46), which could account for its negative impact on cross-linking. The intervening base pair (N2 and its complement) is likely to exert its effect on cross-linking through local structural or steric effects. DEB was the most influenced by the intervening base pair, with cross-linking increased by a factor of 9 with a G-C base pair relative to an A-T pair (Table 4). The structural features of the DEB crosslink have yet to be experimentally determined, but it is possible that an intervening G-C base pair promotes the conformational changes necessary for cross-linking due to the unusually fast base pair dynamics exhibited by tracts of G-C base pairs (47). The methyl group of thymine in the major groove could also exert an inhibi-
Sawyer et al.
tory steric effect on cross-linking, particularly by the relatively short alkyl chain of DEB. Interestingly, the N2 preference is inverted for DEO, with A-T being the more favorable base pair by a small margin. DEO, with its longer alkyl chain, is likely to induce less structural distortion than DEB and may be less affected by bridging a gap containing a methyl group. In fact, the potential exists for a favorable hydrophobic interaction between the alkyl chain of DEO and the methyl group of thymine. However, a complete description of the molecular factors accounting for the G-C preference of DEB and the A-T preference of DEO awaits a determination of the structural features of these cross-links. HN2, of intermediate chain length, appears to be ambivalent toward the intervening base pair, tolerating each equally as well. In conclusion, DEB, DEO, and HN2 share a qualitative preference for purines over pyrimidines at the position 5′ to the GNC site, with G > A and T > C. DEB crosslinking is favored by an intervening G-C base pair, while DEO prefers an A-T base pair, and both pairs are equivalent for HN2. The preferences of DEB, DEO, and HN2 for different flanking bases are likely to lead to different genomic regions targeted, thereby contributing to differences in the biological outcomes of these compounds. Other factors that may also play a role include the influence of chromatin structure on reactivity and differences in repair within the genome (48). An understanding of the factors governing lesion formation and processing could potentially be used to discern the differences between the therapeutic and the mutagenic effects of DEB and HN2, possibly leading to the design of improved candidate drugs.
Acknowledgment. This work was supported by NIH Academic Research Enhancement Awards 1R15CA77748-01 and 2R15CA077748-02A1 from the National Cancer Institute, the Colby College Natural Sciences Division, and an institutional award to Colby College from the Howard Hughes Medical Institute. We thank Justin Juskewitch, Keith Romano, Chuck Jones, and Arlene King-Lovelace for technical assistance, Professor Paul G. Greenwood for helpful comments, and Professor Russell R. Johnson for use of the phosphorimager.
References (1) Krumbhaar, E. B., and Krumbhaar, H. D. (1919) The blood and bone marrow in yellow cross gas (mustard gas) poisoning. J. Med. Res. 40, 497-509. (2) Lawley, P. D. (1995) DNA alkylation and its aftermath. BioEssays 17, 561-568. (3) Hartley, J. A., O’Hare, C. C., and Baumgart, J. (1999) DNA alkylation and interstrand cross-linking by treosulfan. Br. J. Cancer 79, 264-266. (4) McCammon, C. J., Kotin, P., and Falk, H. L. (1957) The cancerogenic potency of certain diepoxides. Proc. Am. Assoc. Cancer Res. 2, 229-230. (5) International Agency for Research on Cancer (IARC) (1976) IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Man; Cadmium, Nickel, and Some Epoxides, Miscellaneous Industrial Chemicals and General Considerations on Volatile Anaesthetics, Vol. 11, pp 115-123, IARC, Lyon, France. (6) International Agency for Research on Cancer (IARC) (1999) IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Man; Reevaluation of some Organic Chemicals, Hydrazine, and Hydrogen Peroxide, Vol. 71, pp 109-225, IARC, Lyon, France. (7) Divine, B. J. (1990) An update on mortality among workers at a 1,3-butadiene facility. Environ. Health Perspect. 86, 119-128.
Diepoxide and Mustard Cross-Linking Efficiencies (8) Mehlman, M. A., and Legator, M. S. (1991) Dangerous and cancercausing properties of products and chemicals in the oil refining and petrochemical industry- Part II: carcinogenicity, mutagenicity, and developmental toxicity of 1,3-butadiene. Toxicol. Ind. Health 7, 207-220. (9) Divine, B. J., Wendt, J. K., and Hartman, C. M. (1993) Cancer mortality among workers at a butadiene production facility. In Butadiene and Styrene: Assessment of Health Hazards (Sorsa, M., Peltonen, K., Vainio, H., and Hemminki, K., Eds.) pp 345362, IARC Scientific Publications No. 127, IARC, Lyon, France. (10) Macaluso, M., Larson, R., Delzell, E., Sathiakumar, N., Hovinga, M., Julian, J., Muir, D., and Cole, P. (1996) Leukemia and cumulative exposure to butadiene, styrene, and benzene among workers in the synthetic rubber industry. Toxicology 113, 190202. (11) Albertini, R., Clewell, H., Himmelstein, M. W., Morinello, E., Olin, S., Preston, J., Scarano, L., Smith, M. T., Swenberg, J., Tice, R., and Travis, C. (2003) The use of nontumor data in cancer risk assessment: reflections on butadiene, vinyl chloride, and benzene. Regul. Toxicol. Pharmacol. 37, 105-132. (12) Mullins, J. A. (1990) Industrial emissions of 1,3-butadiene. Environ. Health Perspect. 86, 9-10. (13) Rustemeier, K., Stabbert, R., Haussmann, H.-J., Roemer, E., and Carmines, E. L. (2002) Evaluation of the potential effects of ingredients added to cigarettes. Part 2: Chemical composition of mainstream smoke. Food Chem. Toxicol. 40, 93-104. (14) Jacobson-Kram, D., and Rosenthal, S. L. (1995) Molecular and genetic toxicology of 1,3-butadiene. Mutat. Res. 339, 121-130. (15) Malvoisin, E., and Roberfroid, M. (1982) Hepatic microsomal metabolism of 1,3-butadiene. Xenobiotica 12, 137-144. (16) Henderson, R. F., Bechtold, W. E., Sabourin, P. J., Maples, K. R., and Dahl, A. R. (1993) Species differences in the metabolism of 1,3-butadiene in vivo. In Butadiene and Styrene: Assessment of Health Hazards (Sorsa, M., Peltonen, K., Vainio, H., and Hemminki, K., Eds.) pp 57-64, IARC Scientific Publications No. 127, IARC, Lyon, France. (17) Cochrane, J. E., and Skopek, T. R. (1994) Mutagenicity of butadiene and its epoxide metabolites: I. Mutagenic potential of 1,2-epoxybutene, 1,2,3,4-diepoxybutane and 3,4-epoxy-1,2-butanediol in cultured human lymphoblasts. Carcinogenesis 15, 713717. (18) Brooks, P., and Lawley, P. D. (1961) The reaction of mono- and di-functional alkylating agents with nucleic acids. Biochem. J. 80, 496-503. (19) Ojwang, J. O., Grueneberg, D. A., and Loechler, E. L. (1989) Synthesis of a duplex oligonucleotide containing a nitrogen mustard interstrand DNA-DNA cross-link. Cancer Res. 49, 65296537. (20) Millard, J. T., Raucher, S., and Hopkins, P. B. (1990) Mechlorethamine cross-links deoxyguanosine residues at 5′-GNC sequences in duplex DNA fragments. J. Am. Chem. Soc. 112, 24592460. (21) Rink, S. M., Solomon, M. S., Taylor, M. J., Rajur, S. B., McLaughlin, L. W., and Hopkins, P. B. (1995) Covalent structure of a nitrogen mustard-induced DNA interstrand cross-link: an N7to-N7 linkage of deoxyguanosine residues at the duplex sequence 5-d(GNC). J. Am. Chem. Soc. 115, 2551-2557. (22) Millard, J. T., and White, M. M. (1993) Diepoxybutane cross-links DNA at 5′-GNC sequences. Biochemistry 32, 2120-2124. (23) Yunes, M. J., Charnecki, S. E., Marden, J. J., and Millard, J. T. (1996) 1,2,5,6-Diepoxyhexane and 1,2,7,8-diepoxyoctane cross-link duplex DNA at 5′-GNC sequences. Chem. Res. Toxicol. 9, 9941000. (24) Millard, J. T., Luedtke, N. W., and Spencer, R. J. (1996) The 5′GNC preference for mustard cross-linking is preserved in a restriction fragment. Anti-Cancer Drug Des. 11, 485-492. (25) Millard, J. T., and Wilkes, E. E. (2001) Diepoxybutane and diepoxyoctane interstrand cross-linking of the 5S DNA nucleosomal core particle. Biochemistry 40, 10677-10685. (26) Hopkins, P. B., Millard, J. T., Woo, J., Weidner, M. F., Kirchner, J. J., Sigurdsson, S. T., and Raucher, S. (1991) Sequence preferences of DNA interstrand cross-linking agents: importance of minimal DNA structural reorganization in the cross-linking reactions of mechlorethamine, cisplatin, and mitomycin C. Tetrahedron 47, 2475-2489. (27) Chawla, A. K., Lipman, R., and Tomasz, M. (1987) Covalent crosslinks and monofunctional adducts of mitomycin C in the minor groove of DNA: Effects on DNA conformation and dynamics. In Structure and Expression, Volume 2: DNA and Its Drug Complexes (Sarma, and Sarma, Eds.) pp 305-316, Adenine Press, Guilderland, NY.
Chem. Res. Toxicol., Vol. 17, No. 8, 2004 1063 (28) Teng, S. P., Woodson, S. A., and Crothers, D. M. (1989) DNA sequence specificity of mitomycin cross-linking. Biochemistry 28, 3901-3907. (29) Weidner, M. F., Millard, J. T., and Hopkins, P. B. (1989) Determination at single-nucleotide resolution of the sequence specificity of DNA interstrand cross-linking agents in DNA fragments. J. Am. Chem. Soc. 111, 9270-9272. (30) Borowy-Borowski, H., Lipman, R., and Tomasz, M. (1990) Recognition between mitomycin C and specific DNA sequences for cross-link formation. Biochemistry 29, 2999-3006. (31) Millard, J. T., Weidner, M. F., Raucher, S., and Hopkins, P. B. (1990) Determination of the DNA cross-linking sequence specificity of reductively activated mitomycin C at single-nucleotide resolution: deoxyguanosine residues at CpG are cross-linked preferentially. J. Am. Chem. Soc. 112, 3637-3641. (32) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (33) Maxam, A. M., and Gilbert, W. (1980) Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65, 499-560. (34) Bauer, G. B., and Povirk, L. F. (1997) Specificity and kinetics of interstrand and intrastrand bifunctional alkylation by nitrogen mustards at a G-G-C sequence. Nucleic Acids Res. 25, 1211-1218. (35) Kaldor, J. M., Day, N. E., Clarke, E. A., Van Leeuwen, F. E., Henry-Amar, M., Fiorentino, M. V., Bell, J., Pedersen, D., Band, P., Assouline, D., Koch, M., Choi, W., Prior, P., Blair, V., Langmark, F., Kirn, V. P., Neal, F., Peters, D., Pfeiffer, R., Karjalainen, S., Cuzick, J., Sutcliffe, S. B., Somers, R., PellaeCosset, B., Pappagallo, G. L., Fraser, P., Storm, H., and Stovall, M. (1990) Leukemia risk following Hodgkin’s disease. N. Engl. J. Med. 322, 7-13. (36) van Leeuwen, F. E., Chorus, A. M., van den Belt-Dusebout, A. W., Hagenbeek, A., Noyon, R., van Kerkhoff, E. H., Pinedo, H. M., and Somers, R. (1994) Leukemia risk following Hodgkin’s disease: relation to cumulative dose of alkylating agents, treatment with teniposide combinations, number of episodes of chemotherapy, and bone marrow damage. J. Clin. Oncol. 12, 10631073. (37) Doerr, J. K., Hollis, E. A., and Sipes, I. G. (1996) Species differences in the ovarian toxicity of 1,3-butadiene epoxides in B6C3F1 mice and Sprague-Dawley rats. Toxicology 113, 128136. (38) Grunber, S. M., and Haseltine, W. A. (1980) Use of an indicator sequence of human DNA to study DNA damage by methylbis(2chloroethyl)amine. Proc. Natl. Acad. Sci. U.S.A. 77, 6546-6550. (39) Mattes, W. B., Hartley, J. A., and Kohn, K. W. (1986) DNA sequence selectivity of guanine-N7 alkylation by nitrogen mustards. Nucleic Acids Res. 14, 2971-2987. (40) Hartley, J. A., Gibson, N. W., Kohn, K. W., and Mattes, W. B. (1986) DNA sequence selectivity of guanine-N7 alkylation by three antitumor chloroethylating agents. Cancer Res. 46, 1943-1947. (41) Kohn, K. W., Hartley, J. W., and Mattes, W. B. (1987) Mechanisms of DNA sequence selective alkylation of guanine-N7 positions by nitrogen mustards. Nucleic Acids Res. 15, 10531-10549. (42) Hausheer, F. H., Singh, U. C., Saxe, J. D., and Colvin, O. M. (1989) Identification of local determinants of DNA interstrand cross-link formation by cyclophosphamide metabolites. Anti-Cancer Drug Des. 4, 281-294. (43) Rink, S. M., and Hopkins, P. B. (1995) A mechlorethamineinduced DNA interstrand cross-link bends duplex DNA. Biochemistry 34, 1439-1445. (44) Van Duuren, B. L. (1969) Carcinogenic epoxides, lactones, and halo-ethers and their mode of action. Ann. N. Y. Acad. Sci. 163, 633-651. (45) Goodsell, D. S., Kopka, M. L., Cascio, D., and Dickerson, R. E. (1993) Crystal structure of CATGGCCATG and its implications for A-tract bending models. Proc. Natl. Acad. Sci. U.S.A. 90, 2930-2934. (46) Pullman, A., and Pullman, B. (1981) Molecular electrostatic potential of the nucleic acids. Q. Rev. Biophys. 14, 289-380. (47) Dornberger, U., Leijon, M., and Fritzsche, H. (1999) High base pair opening rates in tracts of GC base pairs. J. Biol. Chem. 274, 6957-6962. (48) Futscher, B. W., Pieper, R. O., Dalton, W. S., and Erickson, L. C. (1992) Gene-specific DNA interstrand cross-links produced by nitrogen mustard in the human tumor cell line Colo320HSR. Cell Growth Differ. 3, 217-223.
TX0499057
