Fluorescence Dye Adsorption Assay to Quantify Carboxyl Groups on

ARTICLE pubs.acs.org/ac

Fluorescence Dye Adsorption Assay to Quantify Carboxyl Groups on the Surface of Poly(methyl methacrylate) Microbeads Stefan R€odiger,†,‡ Mirko Ruhland,† Carsten Schmidt,† Christian Schr€oder,† Kai Grossmann,† Alexander B€ohm,† J€org Nitschke,† Ingo Berger,† Ingolf Schimke,‡ and Peter Schierack*,† † ‡

Department of Biology, Chemistry and Process Technology, University of Applied Sciences, Senftenberg, Germany Center for Cardiovascular Research, Charite
University Medicine Berlin, Germany

bS Supporting Information ABSTRACT:

Microbead-based assays have evolved into powerful tools for the multiplex detection of biomolecules. Analytes are captured by DNA or protein capture molecules which are coupled on microbead surfaces. A homogeneous carboxylation of microbeads is essential for the optimal and reproducible coupling of capture molecules and thus a prerequisite for an optimal multiplex microbead-based assay performance. We developed a simple fluorescence dye adsorption assay for the description of microbead carboxylation and for the prediction of coupling successes of capture molecules. Using the fluorescence dye SYTO-62 it is possible to quantify the degree of carboxylation of poly(methyl methacrylate) (PMMA) microbeads within 1 h in a multiplex format by fluorescence microscopy or flow cytometry. Compared to conventional bulk assays which only provide an average degree of carboxylation the main advantage of the SYTO-62 assay is the single microbead analysis and therefore the description of the qualitative distribution of carboxylation in microbead populations. The SYTO-62 assay is sensitive enough to even determine weak carboxylation. Also, the quality of microbeads can be evaluated. To our knowledge this is the first report which applies a reversible noncovalent fluorescent dye adsorption assay to quantify the degree of carboxylation on surfaces.

O

ver the past years, microbead-based assays have evolved into powerful tools for the simultaneous detection of multiple analytes such as oligonucleotides and proteins and are used for a broad variety of applications in pathogen identification, single nucleotide polymorphism analysis, and gene expression analysis.1
5 All multiplex microbead-based assays function by binding capture molecules (antigens, antibodies, oligonucleotides) to the microbead surface generating a measurable signal, which is correlated with quantities of bound analytes. The quality of such an assay depends on an optimal density and accessibility of the capture molecules. Covalent binding is the preferred method for immobilization of biomolecules to microbeads.6 Different reactive groups like amino, hydroxyl, thiol, and most importantly, carboxyl groups can be used for attachment to the surface. Binding success depends on an appropriate density of reactive groups readily accessible for capture molecules. r 2011 American Chemical Society

Quality control and quantification of surface carboxylation is time-consuming and laborious. A simple, cost-efficient, and broadly applied method is the toluidine blue O (TBO) dye adsorption assay. The assay includes the incubation of carboxylated matrixes with TBO in an alkaline buffer with subsequent washing followed by elution and quantification of eluted TBO via UV
vis spectrometry.7,8 Another simple quantitative and costefficient method is the titrimetric method.9 Other carboxyl group quantification methods are more expensive. Physical methods measure the ζ-potential, which is related to the surface charge density due to carboxylation, or determine the presence of carboxyl groups by FT-NMR or FT-IR spectroscopy.10,11 Chemical methods measure, e.g., fluorescence signals of covalently Received: December 16, 2010 Accepted: March 17, 2011 Published: March 17, 2011 3379

dx.doi.org/10.1021/ac103277s | Anal. Chem. 2011, 83, 3379–3385

Analytical Chemistry bound fluoresceinyl glycine amide. However, chemical methods assume 100% coupling efficiency, rely on optimal reproducible reaction conditions, and assume a smooth surface morphology.12
14 They do not take steric hindrances into consideration which vary among analytes and surface topologies.14 Most importantly, published protocols could not describe carboxylation of single microbeads and thus could not describe distribution of carboxylation in a microbead population with a simple fluorescence dye adsorption assay using a fluorescence dye. Carboxylated poly(methyl methacrylate) (PMMA) matrixes are widely used in life science and medical devices.12,13,15
17 Quantification of surface carboxyl groups (SCGs) on PMMA matrixes is very important since binding success of biomolecules to PMMA matrixes relies on PMMA carboxylation.9,11,18
20 In this study we established a very rapid and simple fluorescence dye adsorption assay for the determination of carboxylation of single PMMA microbeads. This enables (I) the quantification of the degree of carboxylation, (II) a quality control for a homogeneous carboxylation of microbeads of one population, and (III) the prediction of the coupling success of oligonucleotides or proteins to PMMA microbeads.

’ MATERIALS AND METHODS Microbeads. Carboxylated PMMA microbeads (PolyAn GmbH, Germany) were 10
20 μm in diameter. With one exception (undyed microbeads, see the “Fluorescence Dyes Applicable To Quantify Microbead Surface Carboxylation” section) all microbeads were dyed with a specific ratio of two fluorescence dyes (rhodamine 6G, excitation wavelength Ex 520 nm, emission wavelength Em 560 nm; coumarin 6, Ex 460 nm, Em 500 nm) to distinguish microbeads of different populations. Microbeads of one population had the same size, the same fluorescence dye ratio, and a certain degree of carboxylation. The microbead populations differed in degrees of carboxylation (DoC), ranging from 0 to 3 nmol mm
2 as assessed by TBO dye adsorption assay (TBO assay). Our calculations of DoCs with the unit nmol mm
2 base on the assumption that our microbeads were ideal spherules with a planar nanostructure. We calculated the ideal surface area since we do not precisely know the real surface nanostructure. According to the manufacturer information, we assume that surfaces of microbeads have a more micro/nanorough surface with dendronlike structures of the carboxymonomer or otherwise nonoptimal surfaces that interfere with direct calculations of surface area. Quantification of Surface Carboxyl Groups via TBO Dye Adsorption Assay. The DoC on microbead surfaces was determined by the TBO assay according to Sano et al.8 with following modifications. Microbeads (250
1000 μg) were incubated in 1000 μL of TBO solution (1 mM NaOH, 0.1% TBO (Sigma-Aldrich, Germany)) (15 min, 40 °C, shaken at 1300 rpm). Microbeads were pelleted by centrifugation (2250g, 3 min). Supernatants were removed. Microbeads were resuspended, washed in 1 mL of 1 mM NaOH (5 min, 40 °C, shaken at 1300 rpm) to remove excess of TBO, and pelleted again. The washing process was repeated until supernatants were clear. Finally, TBO was desorbed by incubation of microbeads in 1 mL of 20% SDS solution (30 min, 40 °C, shaken at 1300 rpm). Microbeads were pelleted by centrifugation. The TBO absorption of SDS supernatants was measured at 625 nm (UV
vis spectrophotometer UV-1650PC, Shimadzu, Japan). The DoC

ARTICLE

was determined as followed according to eq S-1 in the Supporting Information. Fluorescence Dyes. We tested seven fluorescence dyes widely used in laboratories which were compatible with standard fluorescence filters and light sources (Supporting Information Table S-1). Note: refer to the manufactures instructions for safe use as some dyes are known to be carcinogens. Fluorescence dyes were either dissolved in PBS
Tween (PBS
T) buffer (137 mM NaCl, 2.7 mM KCl, 2 mM KH2PO4, 100 mM Na2HPO4, 0.01% Tween-20, pH 7.4), MES
T buffer (0.1 M MES (2-(Nmorpholino)-ethanesulfonic acid, 0.01% Tween-20, pH 4.6), or staining buffer (2.5 mM MgCl2 3 6H2O, 16 mM (NH4)2SO4, 67 mM Tris
HCl, 0.01% Tween-20, pH 8.4). The nonionic surfactant Tween-20 was necessary to keep microbeads monodispersed and to facilitate the formation of compact pellets during centrifugation. Microbeads were stained with fluorescence dyes (see Supporting Information Table S-1 for final dye concentrations) for 1 h at 22 °C in reaction volumes of 100 μL. All reactions were done in the dark. After staining microbeads were washed three times in 200 μL of the same buffer without dyes (5 min, 22 °C, shaken at 900 rpm). Microbeads were pelleted by centrifugation (2250g, 3 min), and supernatants were removed. Finally microbeads were resuspended in 100 μL of staining buffer and visualized with the FI 100 fluorescence image analyzer (FI 100 FIA, Berthold Detection Systems GmbH, Germany). Fluorescence Dye Penetration Assay with Microbeads. Initially we screened for fluorescence dyes which (I) did not penetrate into the microbead matrix but remained on the surface and (II) showed a systematic difference of fluorescence intensity when incubated with undyed microbeads with different DoCs (0, 0.4 nmol mm
2). We generated microbead surfaces with different stages of protonation by using acidic (MES buffer, pH 4.6), neutral (PBS
T buffer, pH 7.4), or alkaline buffers (staining buffer, pH 8.4). Gray-scale images were made with the fluorescence microscope FI 100 FIA and filter sets as stated in Supporting Information Table S-1. Staining behavior of microbeads was analyzed using ImageJ.21 Fluorescence dyes which penetrated into the polymer matrix were rejected from further analyzes. Note: only SYTO-62 in staining buffer fulfilled the requirements (I) and (II) and was therefore exclusively used in further experiments. Determination of the Optimal Fluorescence Dye Concentration for the SYTO-62 Assay by Adsorption and Desorption Kinetics. Adsorption Kinetics. Microbeads were stained with SYTO-62 (SYTO-62 assay) to determine the time required for an optimal microbead staining and dye concentration. Three microbead populations (DoC: 0, 0.6, and 1.6 nmol mm
2) were simultaneously incubated with different SYTO-62 concentrations and incubation times. To standardize our experiments and to optimally compare our repeats from single experiments we prepared initially in bulk (2  105 microbeads). Microbeads were washed in 200 μL of staining buffer (5 min, 22 °C, shaking at 900 rpm), pelleted by centrifugation as above, and supernatants were removed. Subsequently, microbeads were incubated in 200 μL of staining buffer containing SYTO-62 (1, 2, 10 μM) (40 min, 22 °C). Microbeads incubated in staining buffer without SYTO62 served as negative control. After incubation microbeads were washed three times as described before. Finally, microbeads were resuspended in 100 μL of staining buffer. Approximately 300 microbeads were transferred into wells of a 96-well plate and analyzed with the FI 100 FIA. Equation S-2 in the Supporting 3380

dx.doi.org/10.1021/ac103277s |Anal. Chem. 2011, 83, 3379–3385

Analytical Chemistry Information was used to describe the time-dependent adsorption of SYTO-62 on the surface of microbeads. Staining Stability Assay. We tested long-term fluorescence signal stability of SYTO-62-stained microbeads. Approximately 2  105 microbeads of each population (DoC: 0, 0.6, and 1.6 nmol mm
2) were incubated in a multiplex format with SYTO-62 solutions. Microbeads were incubated in 200 μL of staining buffer containing 2 μM SYTO-62 (40 min, 22 °C). Nonadsorbed SYTO-62 was removed by washing microbeads as described above (see the “Adsorption Kinetics” section). Microbeads were resuspended in 2.4 mL of staining buffer. Finally, 25 μL of suspension was transferred to a 96-well plate, added to 100 μL of staining buffer, and analyzed with the FI 100 FIA. Covalent Coupling of Biomolecules to PMMA Microbeads. Covalent Coupling of Recombinant Streptavidin. Microbeads (2  105 of each population) were coated with recombinant streptavidin (SA) by covalent coupling using the 1-ethyl-3-(3dimethylaminopropyl)-carbodiimide (EDC) cross-linker. Streptavidin was prepared according to Gallizia et al.22,23 Microbeads were washed three times in 200 μL of PBS
T buffer (5 min, 22 °C, 500 rpm). Supernatants were discarded after centrifugation (2250g, 3 min). Microbead pellets were resuspended in 100 μL of EDC
MES buffer (5.2 mM EDC (Sigma-Aldrich, Germany), 0.1 M MES, pH 4.5) for 15 min at 25 °C. Microbeads were pelleted by centrifugation as above, and supernatants were discarded. Microbeads were immediately incubated with SA (final concentration 60 μg mL
1) in 150 μL of PBS
T buffer and shaken for 3 h at 1300 rpm. SAfunctionalized microbeads were washed three times in PBS
T buffer as described above in this section. Supernatants were discarded after centrifugation (2250g, 3 min). Microbead pellets were resuspended in 100 PBS
T buffer and stored at 4 °C for future use. SA-functionalized microbeads (6  104 of each population) were incubated (1 h, 25 °C, 500 rpm) with 0.5 μM 50 -terminal biotinylated and 30 -terminal Cy5-labeled 31 nt oligonucleotides (biotin
poly(T)10CCCTTGACATTGAGATTGCC
Cy5) in a total volume of 40 μL of PBS
T buffer. Nonbound oligonucleotides were removed by washing in PBS
T buffer as described above. Amounts of bound oligonucleotides were determined with the FI 100 FIA or flow cytometer. Coupling of Oligonucleotides. A 31 nt oligonucleotide (NH2
C6
poly(T)10CCCTTGACATTGAGATTGCC
Atto647N) was synthesized with a 50 -terminal amino C6 linker modification for coupling and with a 30 -terminal Atto647N label for fluorescence signal detection (IBA GmbH, Germany). The oligonucleotide was covalently coupled to microbeads (2  105 of each population) by EDC cross-linking.22 We dissolved 200 mg of EDC in 1 mL of MES buffer (0.1 M MES, pH 4.6, Sigma-Aldrich, Germany). An amount of 10 μL of this solution containing the oligonucleotide (0.5 μM final concentration) was added to 5  105 microbeads in 30 μL of MES buffer. The suspension was briefly vortexed and incubated (30 min, 22 °C). Further 10 μL of EDC solution was given to the mixture. The reaction was stopped after additional 90 min by adding 200 μL of staining buffer. Microbeads were pelleted by centrifugation (2250g, 3 min), and supernatants were discarded. Pellets were washed in 200 μL of staining buffer by vortexing and centrifugation as described in the “Adsorption Kinetics” section. Finally, microbead pellets were resuspended in 100 μL of staining buffer and analyzed with the FI 100 FIA or flow cytometer.

ARTICLE

Figure 1. Staining of PMMA microbeads with different fluorescence dyes. PMMA microbeads were incubated in PBS buffer (pH 7.4), staining buffer (pH 8.4), and MES buffer (pH 4.6), with PI, EtBr, FITC, EvaGreen, GelRed, DAPI, or SYTO-62. Left: only SYTO-62 stained carboxylated microbead surface selectively by forming a circular ligand fluorescence signal (A). Other dyes did not stain microbead surfaces or penetrated into the PMMA matrix of defective microbeads as exemplarily shown for GelRed (B). Quality control of SYTO-62-stained microbeads: (C) intact microbeads and (D) defective microbeads (arrows) with aggregates. All microbeads showing homogeneous staining and greater signal intensity were microscopically inspected. These microbeads always showed physical damage, whereas microbeads with homogeneous circular corona showed no surface damage. Microbead samples correspond to Figure 3, parts B and C, respectively.

Flow Cytometer Analysis of SYTO-62-Stained Microbeads. Initially, we generated all data of the SYTO-62 assay with the FI 100 FIA. As flow cytometer analysis is the de facto standard in microbead analysis we applied our findings also to the flow cytometer (BD FACSCantoII, BD Biosciences, U.S.A.). Microbeads (5  104 of each population) were stained with SYTO-62 as described in the “Adsorption Kinetics” section. Subsequent microbeads were pelleted by centrifugation (2250g, 3 min). After removing supernatants pellets were resuspended in 100 μL of staining buffer and kept in dark conditions until flow cytometer analysis. Prior to analysis microbead suspensions were mixed with 200 μL of FacsFlow (BD Biosciences, U.S.A.). For each microbead population 3000
5000 events were recorded. Single microbeads were distinguished from aggregates by size (forward scatter) and fluorescence (Alexa 488 channel). Red fluorescence mediated by SYTO-62 was measured with the Cy5 filter channel. Raw data were extracted with FCS extract (v. 1.02; http://research.stowers-institute.org/efg/ScientificSoftware/Utility/FCSExtract/index.htm), and the mean fluorescence (MFI) was determined. All data were normalized to the average microbead population surface area. Random data samples (n = 300 per population) from flow cytometer experiments were drawn by the sample function from the R base package. 3381

dx.doi.org/10.1021/ac103277s |Anal. Chem. 2011, 83, 3379–3385

Analytical Chemistry

ARTICLE

Statistical Analysis. Ligand fluorescence intensities (compare Figure 1A) of single microbeads obtained with the FI 100 FIA report arbitrary units. The values were normalized to the microbead surface area. For staining kinetics data were fitted by nonlinear regression with Supporting Information eq S-2 using QtiPlot (v. 0.9.7.13; http://soft.proindependent.com/qtiplot.html). All analyses were done as independent experiments. Error bars show standard deviations. Statistical calculations were performed with RKWard (http://rkward.sf.net; R v. 2.10.1). Pearsons’s rank correlation coefficient (r) was used to quantify the strength of linear dependence between two variables.

’ RESULTS Fluorescence Dyes Applicable To Quantify Microbead Surface Carboxylation. Initially, we screened seven fluores-

cence dyes (Supporting Information Table S-1) for detection of carboxyl groups on microbead surfaces. Undyed microbeads with different DoC (0, 0.3, 0.4 nmol mm
2) were exposed to the fluorescence dyes at pH 4.6, 7.4, and 8.4. Fluorescence dyes penetrating into the microbead matrix render continuously stained microbeads independent of the degree of microbead surface carboxylation. Propidium iodide (PI), ethidium bromide (EtBr), fluorescein isothiocyanate (FITC), EvaGreen, GelRed, and 40 ,6-diamidino-2-phenylindole (DAPI) did not stain intact microbeads or microbead surfaces and were excluded from further experiments. However, carboxylated defective beads were homogeneously stained by PI, EtBr, GelRed, and DAPI (Figure 1B). Only SYTO-62 did not penetrate into the PMMA microbead matrix but stained the surface selectively (Figure 1A). The fluorescence intensity of stained microbeads increased with an elevated level of microbead surface carboxylation, and uncarboxylated microbeads remained unstained (not shown). Microbeads could be stained in neutral PBS buffer (pH 7.4) and alkaline staining buffer (pH 8.4) but not in acidic MES buffer (pH 4.6). Defective carboxylated microbeads were continuously stained by SYTO-62 in MES buffer too. According to the dye manufacturer (Invitrogen, U.S.A.) it is recommended to work with phosphate-free buffers. Therefore, we used exclusively staining buffer for further SYTO-62 experiments. Staining of microbeads under these conditions was named SYTO-62 assay during the following further experiments. Determination of the Optimal SYTO-62 Concentration and Incubation Time for the SYTO-62 Assay. To find the optimal SYTO-62 staining concentration and incubation time for the SYTO-62 assay we incubated three microbead populations with different DoC in a triplex format with three SYTO-62 concentrations. Half-maximum saturation of SYTO-62 staining was accomplished within ca. 5 min. Staining equilibrium (maxima of fluorescence signals, MFImax) was reached after ca. 20 min in 1 μM and after ca. 10 min in 2 μM SYTO-62 solutions. Uncarboxylated microbeads remained unstained. With the use of 10 μM SYTO-62 solution microbeads were stained immediately, but staining intensities dropped slightly faster over time. Uncarboxylated microbeads were also slightly stained at 10 μM SYTO-62 (Supporting Information Figure S-1). We defined the concentration of 2 μM as optimal concentration for the SYTO-62 assay. The adsorption rates (MFI min
1) for 1 and 2 μM SYTO-62 increased with increasing DoC (Supporting Information Table S-2). This shows that the adsorption rate is dependent on the initial dye concentration and DoC. However, all three SYTO-62 concentrations resulted in an equal maximum

Figure 2. Linear correlation between data obtained using the SYTO-62 or the TBO assay. DoCs of 36 microbead populations (DoC 0 nmol mm
2, n = 7; DoC 0.1
3 nmol mm
2, n = 29) were determined with the SYTO-62 or the TBO assay.

labeling level within one microbead population. Staining kinetics showed an initial convex curve shape with subsequent flattening. We presume flattening is due to saturation and suggest a surfacerestricted binding of SYTO-62 on microbead surfaces (Supporting Information Figure S-1). Stability of SYTO-62 Staining under Alkaline Conditions. We demonstrated that the SYTO-62 staining process is reversible since it is presumably driven by weak ionic forces. As staining stability is a crucial part of the SYTO-62 assay, we monitored the dye desorption from microbead surfaces in staining buffer. We found that fluorescence signal of SYTO-62stained microbeads were stable for at least 6 h in staining buffer (Supporting Information Figure S-2). SYTO-62 Assay for the Quantification of Microbead Surface Carboxyl Groups. The degree and quality of carboxylation of microbeads affect coupling of biomolecules. Therefore, quantification and control of homogeneous distribution of carboxyl groups is essential for high assay quality. The TBO assay is an established dye adsorption assay for carboxyl group quantification. We investigated the agreements between the SYTO-62mediated fluorescence signal and the microbeads DoC as assessed by the TBO assay. We quantified carboxyl groups of 36 PMMA microbead populations with a broad range of DoCs with the SYTO-62 and TBO assay. Figure 2 shows that an increase of the SYTO-62 fluorescence intensity is linear correlated with increased DoCs determined with the TBO assay. The SYTO-62 signal of uncarboxylated microbeads (MFI 0.03 ( 0.0) was well distinguishable from the lowest DoC (MFI 0.16 ( 0.1). In conclusion, the SYTO-62 assay can replace TBO assays to quantify carboxylation according to our TBO standard curve in Figure 2. SYTO-62 Assay as Quality Control for Microbead Populations. Using the SYTO-62 assay we analyzed the distribution of surface carboxylation in microbead populations. Analysis of approximately 250
300 microbeads was found to be representative for analysis of the whole microbead population. Distribution was described by an index plot. If fluorescence signals of microbeads (FI) were sorted according to increasing fluorescence intensities (Figure 3) then the following conclusions can be drawn: (i) the shape of the curve should be expected to be linear except in the range of the outliers, (ii) the range of the 3382

dx.doi.org/10.1021/ac103277s |Anal. Chem. 2011, 83, 3379–3385

Analytical Chemistry

ARTICLE

Figure 3. Quality control of microbeads by the SYTO-62 assay: distribution of carboxylation. Fluorescence signal events of single microbeads (abscissa) were ordered according to increasing fluorescence intensities (FI) (ordinate). The insets show the density function (h, probability density) of the microbead surface carboxylation of single microbead populations. (A) Shape of a curve, range of outliers, and slope of a curve through the zero point of the log10 (FI/mFI) give information about the distribution of carboxylation in one microbead population. Optimal homogeneous microbead populations show linear and flat curves. The range of outliers is small, and the slope of a curve through the zero point of the quotient FI/mFI is low. (B) Microbead population which is less homogeneously carboxylated than microbead population in panel A. Carboxylations of microbead populations in panel C show bimodal distributions. Such microbead populations should be excluded from microbead assays. Identification of microbeads coupled homogeneously with oligonucleotides by the SYTO-62 assay. A fluorescence-labeled oligonucleotide (ALO) was covalently coupled to microbeads. Distribution of coupling signals was compared to the homogeneity of SYTO-62 staining: (D) if the SYTO-62 assay indicated a homogeneous carboxylation within the microbead population then coupling of ALO also appeared homogeneous; (E) less homogeneously carboxylated microbead population predicted by the SYTO-62 assay showed a less homogeneous coupling signal compared to microbead population shown in panel D; (F) insufficient carboxylation of a microbead population predicted by the SYTO-62 assay resulted in a bad coupling signal. One dot represents one microbead.

outliers should be small, and (iii) the slope of a curve through the zero point (FI/mFI) should be closed to zero. The steeper the increase of a curve and the broader the range of the outliers, the more heterogeneously carboxylated are microbeads of one population. During analysis the FI 100 FIA automatically captures twodimensional images. Therefore, it is also possible to check quality of single microbeads afterward since images keep stored. As shown in Figure 1D defects in microbead shapes as well as microbead aggregates were easily detectable. Prediction of Coupling Success of Proteins and Oligonucleotides. Microbeads are used for multiplex detection of diverse biomolecules. Nucleic acid analytes like polymerase chain reaction (PCR) products or cDNA fragments are hybridized to microbead-coupled oligonucleotide probes, and microbeadcoupled proteins are used for antibody detection or to bind other biomolecules like biotin. Therefore, we tested the prediction of the coupling success of an oligonucleotide (31bp, ALO) and a protein (SA) to microbead surfaces by our SYTO-62 assay. ALO and SA were covalently coupled to two rows of microbead populations. Microbead populations of one row differed only in DoCs but not in diameter or fluorescence coding. As shown in Figure 4A coupling success of ALO and SA is similarly predictable. In the range between MFI 0 and 4 (0
1.5 nmol mm
2) we found an approximately linear correlation between the SYTO-62 signal and the ALO or SA signal. For microbeads with

MFI > 4 SYTO-62 signals did not correlate with ALO or SA signals but flattened in a plateau (Figure 4A). We compared the findings with the TBO assay and found the same functional relation (Figure 4B). Presumably the maximum binding capacity by ALO or SA was reached. Both molecules have similar spatial expansions but are noticeably larger than SYTO-62 and TBO molecules. The SYTO-62 assay is an easy to perform method to predict coupling success of oligonucleotides and SA to the surface of microbeads. Uniform staining by SYTO-62 reliably predicts functional homogeneous coupling of biomolecules to all microbeads of one population (Figure 3D
F). Flow Cytometer Analysis. Flow cytometer analysis is the de facto standard for multiplex microbead suspension arrays. Therefore, we compared results generated with the FI 100 FIA (microscope) with experimental outcome generated with the flow cytometer BD FACSCantoII (BD Biosciences, U.S.A.). With the use of flow cytometer technology it is possible to process and quantify various parameters of large sample quantities within a short time frame, but it cannot visualize single microbeads directly but rather reconstructs single microbead events from digitalized parameters (scatter light, fluorescence signals). In contrast, the FI 100 FIA automatically captures and processes two-dimensional images. We investigated the agreement of fluorescence intensities between the FI 100 FIA and flow cytometer of SYTO-62-stained microbeads of 20 populations with different DoCs. Measurement 3383

dx.doi.org/10.1021/ac103277s |Anal. Chem. 2011, 83, 3379–3385

Analytical Chemistry

Figure 4. Prediction of coupling successes of oligonucleotides and proteins by the SYTO-62 assay. Microbeads were coupled with either an amino-modified Atto647N-labeled ALO or a biotinylated Cy5labeled oligonucleotide bound to SA. (A) SYTO-62 assay: oligonucleotide as well as protein binding success was predictable in the MFI range of 0
4. MFI values above 4 resulted in a signal plateau suggesting a reach in the maximum loading capacity of the bead population. (B) TBO assay: the TBO assay reflects the same predictions like the SYTO-62 assay. Microbead populations of one of four rows differed only in DoCs but not in diameter or fluorescence coding.

Figure 5. Comparison of mean fluorescence intensities (MFI): (A) SYTO-62-stained microbeads; (B) covalently coupled ALO and SA. The MFI was determined with the FI 100 FIA (MFI (FI 100)) and a flow cytometer (MFI (BD FACSCantoII)). Both methods show the same signal increase. The slope of SA-loaded microbeads is lower, which was shown in the experiments before.

was done in parallel with both systems to minimize experimental errors. Figure 5 shows that an increase of SYTO-62 fluorescence intensities shows the same behavior on both systems (Figure 5A). The same applied to fluorescence intensities mediated by covalently coupled with ALO or SA (Figure 5B). The linear correlation between the FI 100 FIA and the flow cytometer indicates that both systems can equally be used to analyze microbead populations.

’ DISCUSSION On the basis of the proprietary fluorescence dye SYTO-62 we developed a simple dye adsorption assay for the quantification of carboxyl groups on the surface of PMMA microbeads as well as for the characterization of distribution of carboxylation within microbead populations by standard fluorescence detection technologies. Fluorescence dyes have a sensitivity usually not achieved by procedures based on UV
vis spectrometry.24 Homogeneous and sufficient carboxylation of microbeads is a

ARTICLE

prerequisite for optimal coupling of DNA probes or proteins on microbead surfaces which enables subsequent homogeneous hybridization of DNA targets or binding of antibodies. Consequently, characterization of carboxylation is one of the first steps for optimal microbead assay performance. Dufva25 identified morphology (shape and homogeneity of a spot), probe density (number of immobilized molecules in a specific area), and hybridized density (number of molecules available for hybridization in a specific area) as three important parameters for assay performance of DNA microarrays, which can be also applied to microbead-based assays. The fluorescence dye SYTO-62 was the only one among the initially tested fluorescence dyes which stained carboxylated PMMA microbead surfaces selectively but did not penetrate the microbead matrix and which generated fluorescence signal intensities dependent on the microbead DoC. We defined a concentration of 2 μM SYTO-62 in an alkaline staining buffer and 40 min of incubation time at 22 °C as optimal parameters for the SYTO-62 assay. A basic flowchart for further applications (e.g., smaller microbeads) of the assay is shown in Supporting Information Figure S-4. SYTO-62 is a fluorescence dye of the SYTO dye family whose members vary considerably regarding their binding to other macromolecules and substrates. SYTO dyes were previously used for real-time PCRs, Gram staining of bacteria, tumor cell death studies, and others.26
33 It was reported that dyes of the SYTO family tend to self-quench if distance between molecules falls below a critical distance. We tried to address the question whether a high density of SYTO-62 molecules on the microbead surface due to a high DoC leads to such a process, thus resulting in a flattening curve instead of a linear progression. We could not observe such behavior in our experiments (DoC 0
3 nmol mm
2) and concluded that this process did not play a role during our SYTO-62 assay. SYTO-62 microbead staining was stable for at least 6 h under mild alkaline conditions. SYTO-62 binding was shown to be reversible in pure water or accelerated at higher ionic strength (NaCl, SDS) which supports the ionic nature of dye binding (Supporting Information Figure S-3). The SYTO-62 assay predicted equal DoCs on microbead surfaces like the simple and broadly applied TBO assay which is based on UV
vis spectrometry analysis. We suppose that the more labor-intensive TBO assay and other methods for quantifications of carboxyl groups might be replaced or supported by the SYTO-62 assay. Since the fluorescence signals represent arbitrary units a reference to an established assay (e.g., TBO assay) might be required in certain applications. Additionally, using the SYTO-62 assay other time-consuming and error-prone covalent coupling strategies (e.g., via EDC), which may bias results, could be avoided. We were able to simultaneously quantify carboxylation of 18 different microbead populations within 1 h (including 40 min incubation time) in one well with the fluorescence microscopy technology. Moreover only as little as 300 microbeads of each population was needed for analysis. In contrast, applying the TBO assay for quantification of carboxylation of 18 different microbead populations took 5 h with continuous work. For the TBO assay we had to use 105
106 microbeads (∼250
1000 μg) of each population. The SYTO-62 assay also offers the possibility to quickly view and assess the quality of microbead itself (shape, integrity, and size of beads) and the quantity and quality of carboxylation on single microbeads as well as the distribution of carboxylation within one microbead population. This is in contrast to bulk 3384

dx.doi.org/10.1021/ac103277s |Anal. Chem. 2011, 83, 3379–3385

Analytical Chemistry detection assays like the TBO assay or the FT-NMR or FT-IR spectroscopy in which only the total of all microbeads provides one measured value which only represents the mean value over all microbeads. The final aim of sufficient and homogeneous carboxylation of microbeads is the application of these microbeads in biomolecule detection assays. We evaluated the precision of the prediction of coupling successes of one exemplary oligonucleotide and one exemplary protein (streptavidin) by the SYTO-62 assay. In the range of carboxylation between 0 and 1.5 nmol mm
2 we found an approximately linear relation between the SYTO-62 signal and the oligonucleotide or SA signal. We showed that in this DoC range a prediction of coupling successes is possible. If the carboxylation was higher than 1.5 nmol mm
2 SYTO-62 signals did not correlate with oligonucleotide or SA signals, but we were able to show that those microbeads were well usable for coupling of biomolecules. Oligonucleotide or SA signals rather flattened in a plateau. This is an indication that microbead surfaces were saturated by ligand molecules and that DoCs higher than 1.5 nmol mm
2 might not help to increase quantities of coupled biomolecules. An earlier saturation of microbead surfaces by oligonucleotides or proteins compared to SYTO-62 molecules is explainable by differences in the molecule sizes: oligonucleotides or proteins are larger than SYTO-62 molecules. Although high DoCs are not necessary for microbead assays, they might be of interest in other fields like medical applications (drug delivery, hard tissue repair and regeneration).9,13,34
36

’ CONCLUSION The SYTO-62 assay is a very simple and fast fluorescence dye adsorption assay to determine quality and quantity of carboxylation of single PMMA microbeads. Successes of biomolecule coupling on PMMA microbead surfaces are predictable. Only 300 microbeads are necessary to test quality or quantity of carboxylation of one microbead population. The SYTO-62 assay can be analyzed by fluorescence microscopy as well as flow cytometer, which enormously extends the application scope. Further tests should provide information whether the SYTO-62 assay can also be used for other applications like planar surfaces or other matrixes. ’ ASSOCIATED CONTENT

bS

Supporting Information. Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

’ AUTHOR INFORMATION Corresponding Author

*E-mail: [email protected]. Fax: þ49-(0)3573 85 809.

’ ACKNOWLEDGMENT The authors thank Alexander Kaiser (Department of Chemical Engineering, Hochschule Lausitz, Germany) for critic comments and Bryon Nicholson (Iowa State University, Ames, Iowa, U.S.A.) for helpful comments on the manuscript.

ARTICLE

’ REFERENCES (1) Defoort, J. P.; Martin, M.; Casano, B.; Prato, S.; Camilla, C.; Fert, V. J. Clin. Microbiol. 2000, 38, 1066–1071. (2) Dunbar, S. A.; Vander Zee, C. A.; Oliver, K. G.; Karem, K. L.; Jacobson, J. W. J. Microbiol. Methods 2003, 53, 245–252. (3) Fuja, T.; Hou, S.; Bryant, P. J. Biotechnol. 2004, 108, 193–205. (4) Vignali, D. A. J. Immunol. Methods 2000, 243, 243–255. (5) Wedemeyer, N.; Pascher, E.; Cassens, U.; Gohde, W. Ann. Biol. Clin. (Paris) 2004, 62, 65–71. (6) Butler, J. E. Methods 2000, 22, 4–23. (7) Ma, Z.; Kotaki, M.; Ramakrishna, S. J. Membr. Sci. 2006, 272, 179–187. (8) Sano, S.; Kato, K.; Ikada, Y. Biomaterials 1993, 14, 817–822. (9) Sivakumar, M.; Rao, K. P. React. Funct. Polym. 2000, 46, 29–37. (10) Schiestel, T.; Brunner, H.; Tovar, G. E. M. J. Nanosci. Nanotechnol. 2004, 4, 504–511. (11) Brinkhuis, R. H. G.; Schouten, A. J. Macromolecules 1992, 25, 2717–2724. (12) Brown, L.; Koerner, T.; Horton, J. H.; Oleschuk, R. D. Lab Chip 2006, 6, 66–73. (13) Wei, S.; Vaidya, B.; Patel, A. B.; Soper, S. A.; McCarley, R. L. J. Phys. Chem. B 2005, 109, 16988–16996. (14) Janolino, V. G.; Swaisgood, H. E. Biotechnol. Bioeng. 1982, 24, 1069–1080. (15) Situma, C.; Wang, Y.; Hupert, M.; Barany, F.; McCarley, R. L.; Soper, S. A. Anal. Biochem. 2005, 340, 123–135. (16) Zhang, C.; Xing, D. Nucleic Acids Res. 2007, 35, 4223–4237. (17) Tsai, N. C.; Sue, C. Y. Biosens. Bioelectron. 2006, 22, 313–317. (18) Li, S. J.; Hu, J.; Liu, B. L. Methods Find. Exp. Clin. Pharmacol. 2004, 26, 507–513. (19) Sandner, B.; Bischof, C. Angew. Makromol. Chem. 1983, 115, 207–219. (20) Yao, L.; Liu, B.; Chen, T.; Liu, S.; Zuo, T. Biomed. Microdevices 2005, 7, 253–257. (21) Abramoff, M. D.; Magelhaes, P. J.; Ram, S. J. Biophotonics Int. 2004, 11, 36–42. (22) Giese, R. W. J. Chromatogr., A 1996, 746, 303–303. (23) Gallizia, A.; de Lalla, C.; Nardone, E.; Santambrogio, P.; Brandazza, A.; Sidoli, A.; Arosio, P. Protein Expression Purif. 1998, 14, 192–196. (24) Glenny, R. W.; Bernard, S.; Brinkley, M. J. Appl. Physiol. 1993, 74, 2585–2597. (25) Dufva, M. Biomol. Eng. 2005, 22, 173–184. (26) Gudnason, H.; Dufva, M.; Bang, D. D.; Wolff, A. Nucleic Acids Res. 2007, 35, e127. (27) Guindulain, T.; Comas, J.; Vives-Rego, J. Appl. Environ. Microbiol. 1997, 63, 4608–4611. (28) Udovich, J. A.; Besselsen, D. G.; Gmitro, A. F. J. Microsc. 2009, 234, 124–129. (29) Chen, J.; Koopman, B. Appl. Environ. Microbiol. 1997, 63, 3941–3945. (30) Lebaron, P.; Catala, P.; Parthuisot, N. Appl. Environ. Microbiol. 1998, 64, 2697–2700. (31) Lebaron, P.; Parthuisot, N.; Catala, P. Appl. Environ. Microbiol. 1998, 64, 1725–1730. (32) Wlodkowic, D.; Skommer, J.; Darzynkiewicz, Z. Cytometry, Part A 2008, 73, 496–507. (33) Mason, D. J.; Shanmuganathan, S.; Mortimer, F. C.; Gant, V. A. Appl. Environ. Microbiol. 1998, 64, 2681–2685. (34) Cho, J. C.; Cheng, G.; Feng, D.; Faust, R.; Richard, R.; Schwarz, M.; Chan, K.; Boden, M. Biomacromolecules 2006, 7, 2997–3007. (35) Egitto, F. D.; Matienzo, L. J. IBM J. Res. Dev. 1994, 38, 423–439. (36) Sasai, Y.; Matsuzaki, N.; Kondo, S.; Yamauchi, Y.; Kuzuya, M. J. Photopolym. Sci. Technol. 2008, 21, 277–280.

3385

dx.doi.org/10.1021/ac103277s |Anal. Chem. 2011, 83, 3379–3385