ARTICLE pubs.acs.org/ac
Fluorescent Ferritin Nanoparticles and Application to the Aptamer Sensor Seong-Eun Kim,† Keum-Young Ahn,† Jin-Seung Park,† Kyung Rim Kim,† Kyung Eun Lee,§ Sung-Sik Han,‡ and Jeewon Lee*,† †
Department of Chemical and Biological Engineering and ‡School of Life Sciences and Biotechnology, Korea University, Anam-Dong 5-1, Seongbuk-Gu, Seoul 136-713, Republic of Korea § Biomedical Research Center, Korea Institute of Science and Technology, Seoul 136-791, Republic of Korea
bS Supporting Information ABSTRACT: We synthesized fluorescent ferritin nanoparticles (FFNPs) through bacterial expression of the hybrid gene consisting of human ferritin heavy chain (hFTN-H), spacer (glycine-rich peptide), and enhanced green (or red) fluorescent protein [eGFP (or DsRed)] genes. The self-assembly activity of hFTN-H that leads to the formation of nanoparticles (12 nm in diameter), the conformational flexibility of the C-terminus of hFTN-H, and the glycinerich spacer enabled eGFPs (or DsReds) to be well displayed on the surface of each ferritin nanoparticle, resulting in the construction of green (or red) FFNPs [gFFNPs (or rFFNPs)]. As compared to eGFP (or DsRed) alone, it is notable that the developed FFNPs showed significantly amplified fluorescence intensity and also enhanced stability. DNA aptamers were chemically conjugated to gFFNP via each eGFP’s cysteine residue that was newly introduced through site-directed mutagenesis (Ser175Cys). The DNA-aptamer-conjugated gFFNPs were used as a fluorescent reporter probe in the aptamer-based “sandwich” assay of a cancer marker [i.e., platelet-derived growth factor B-chain homodimer (PDGF-BB)] in phosphate-buffered saline buffer or diluted human serum. This is a simple twostep assay without any additional steps for signal amplification, showing that compared to the same aptamer-based assays using eGFP alone or Cy3, the detection signals, affinity of the reporter probe to the cancer marker, and assay sensitivity were significantly enhanced; i.e., the limit of detection was lowered to the 100 fM level. Although the PDGF-BB assay is reported here as a proof-ofconcept, the developed FFNPs can be applied in general to any aptamer-based sandwich assays.
n biomolecular detection assays, fluorescence-based detection is widely used because this method is simple and convenient and can also exploit the diverse spectral properties of fluorescent dyes with a high signal-to-noise ratio.14 Fluorescence is the main detection mode for most aptamer-based assays,5,6 and even for ELISA (enzyme-linked immunosorbent assay), where the detection is typically colorimetric, a fluorescence measurement where the enzyme step of the assay is replaced with a fluorophore-tagged antibody is becoming quite popular (http:// www.ncgc.nih.gov/guidance/section10.html# sandwich-immunoassay).79 Nevertheless, a major drawback associated with fluorescence detection systems is a low sensitivity resulting from a limited amplification of the detection signal.4,10 It has been reported that, for the signal amplification, coupling the nanoparticles with a function of biological recognition to signaling moieties usually enhances the sensitivity and selectivity of bioanalytical assays,11,12 and special chemical and physical properties of a variety of nanoparticles have been intensively studied.13,14 Recently, we synthesized protein nanoparticles using a bacterial expression system and applied them successfully to various sensitive diagnostic assays.1518 In addition to a small
I
r 2011 American Chemical Society
size (550 nm) and correspondingly large surface-to-volume ratio, the protein nanoparticles have distinct benefits, including high size uniformity, easy surface modification by a simple genetic engineering approach, convenient and low-cost production, and high stability. In this study, we developed human ferritin heavy chain (hFTN-H)-derived fluorescent ferritin nanoparticles and used them as an effective detection indicator in aptamer-based biomolecular detection. Through combining the C-terminus of hFTN-H19 with the N-terminus of enhanced green (or red) fluorescent protein [eGFP (or DsRed)],2022 the recombinant fluorescent ferritin nanoparticles (FFNPs) were easily produced using Escherichia coli as a bacterial expression host. Although we previously reported that the fluorescence emission of eGFP-associated FFNPs (gFFNPs) was only about 60% of that of intact eGFP,23 here we dramatically increased the emission intensity of FFNPs by introducing a flexible glycine-rich spacer between Received: December 12, 2010 Accepted: June 3, 2011 Published: June 03, 2011 5834
dx.doi.org/10.1021/ac200657s | Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry
ARTICLE
Figure 1. Schematics of the various gene fusions for the synthesis of green (ac) and red (d, e) fluorescent ferritin nanoparticles with (b, c, e) and without (a, d) glycine-rich spacer peptide between hFTN-H and fluorescent protein (eGFP or DsRed).
hFTN-H and the fluorescent protein (eGFP or DsRed) and also by conjugating DNA aptamers to FFNPs. Since monitoring a variety of disease states requires measurement of irregular concentrations of biomarker proteins, sensitive, convenient, and precise bioassay is essential to the early detection of disease-specific markers, which is directly related to successful treatment of patients.24,25 Antibody-based immunoassays have been mostly explored for such applications, but in recent years, aptamer-based bioassays have held great promise as an alternative to overcome the inherent drawbacks of antibodies, such as laborious and expensive production, limited modifications of the molecule, temperature-sensitive and irreversible denaturation, and uneasy bioactivity control from batch to batch. Aptamers that are isolated by systematic evolution of ligands by exponential amplification (SELEX) are oligonucleotides (DNA or RNA), which form defined tertiary structures and hence have specific ligand-binding properties. They have significant advantages over the antibody counterparts: they have a smaller size (815 kDa for typical aptamers vs 50150 kDa for antibodies), they are amenable to chemical synthesis and modification, and they have stable uniform activity upon denaturationrenaturation.26,27 In this regard, aptamer-based biomolecular detection assays are expected to overcome the pitfalls of current diagnostic immunoassays such as ELISA. In this study, we covalently attached DNA aptamers to the surface of FFNPs and used the aptamer-conjugated FFNPs as a three-dimensional and signal-amplified reporter probe in the aptamer-based “sandwich” assay of a potential cancer biomarker (platelet-derived growth factor B-chain homodimer, PDGF-BB).24,25,28 The sandwich assay, namely, the dual-site binding assay, is one of the most used formats of aptamerbased assays.27,29,30 In this assay, the target analyte (PDGFBB) is sandwiched by a pair of aptamers, one a capture probe that is usually immobilized on the surface of solid supports and the other a reporter probe that is often conjugated with signaling moieties (e.g., fluorophores, enzymes, or nanoparticles). The developed DNA-aptamer-conjugated FFNPs (i.e., reporter probe) showed significantly amplified fluorescence signal and enhanced affinity to PDGF-BB compared to the same DNA-aptamer-conjugated eGFP and Cy3 and also lowered the limit of detection to the 100 fM level, demonstrating that the aptamer-conjugated FFNPs can be applied in general to many other aptamer-based sandwich assays with superior efficacy.
’ EXPERIMENTAL SECTION Biosynthesis of Recombinant eGFP, DsRed, and FFNPs. Following polymerase chain reaction (PCR) amplification using the appropriate primers, six gene clones were prepared: NNdeI-(hFTN-H)-XhoI-C, N-NdeI-hexahistidine-(eGFP)-HindIII-C, N-XhoI-eGFP-hexahistidine-HindIII-C, N-XhoI-G3SG3TG3SG3eGFP-H6-HindIII-C, N-XhoI-(DsRed)-hexahistidine-HindIII-C, and N-XhoI-G3SG3TG3SG3-DsRed-H6-HindIII-C. The above gene clones were ligated into pT7-7 plasmids to construct various expression vectors (Figure 1): pT7-GFP, pT7-FTN-GFP, and pT7-FTN-RED encoding the synthesis of recombinant eGFP and hFTN-H fused with eGFP and DsRed, respectively, and pT7-FTH-LNK-GFP and pT7-FTH-LNK-RED encoding the synthesis of recombinant hFTN-H fused with linker-added eGFP and DsRed, respectively. After complete sequencing, the E. coli strain BL21(DE3) [FompThsdSB(rBmB)] was transformed with the above expression vectors, and transformants with ampicillin resistance were finally selected. The detailed procedures for the isopropyl β-D-1-thiogalactopyranoside (IPTG)-induced gene expression and purification of the recombinant fluorescent ferritin nanoparticles and transmission electron microscopy (TEM) image analysis of the purified protein nanoparticles were well described in our previous reports.1519 To implement DNA aptamer conjugation of eGFP and gFFNP, the 175th residue of eGFP was mutated from serine to cysteine (Ser175Cys) using the primers (forward) AACATCGAGGACGGCTGCGTGCAGCTCGCC and (reverse) GGCGAGCTGCACGCAGCCGTCCTCGATGTT (Genotech, Daejon, South Korea) (Tm = 86.1 °C). Site-directed mutagenesis was performed using the optimal procedure described in our previous report.19 After DNA gel purification and sequencing, the E. coli strain BL21(DE3) was transformed with the expression vector encoding the synthesis of the mutated eGFP (Ser175Cys) and gFFNP containing the mutated eGFP (Ser175Cys), and then ampicillin-resistant transformants were selected. The same experimental procedures for the recombinant gene expression, purification, and TEM image analysis of the fluorescent ferritin nanoparticles were used as described above. Synthesis and Purification of DNA-Aptamer-Conjugated eGFP, Cy3, and FFNPs. On the basis of the sequence information from the previous reports,31 the amine-modified and Cy3modified DNA aptamers with strong and specific affinity for 5835
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry PDGF-BB (i.e., 50 -NH2-(CH2)6-CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT-30 and 50 -Cy3-CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT-30 ) were synthesized and supplied from Genotech. To activate the amine-modified aptamer with sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SSMCC), 40 μL of the aptamer (100 μM) in distilled water was incubated for 1 h at 35 °C with 100 μL of phosphate-buffered saline (PBS) buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) and 60 μL of dimethylformamide (DMF) containing 2 mg of SSMCC (Pierce, Rockford, IL). Unreacted excess SSMCC was removed using a QIAEX II Gel Extraction Kit (QIAGEN, Duesseldorf, Germany). Before the DNA aptamer conjugation to gFFNPs, 100 μL of dithiothreitol (DTT) (1 M) was added to 1 mL of gFFNPs (0.5 mg/mL) consisting of hFTNH, spacer peptide, and the mutated eGFP (Ser175Cys), the resulting mixture was incubated for 30 min at 35 °C to remove any internanoparticle disulfide bridges, and then the solution volume was reduced to 500 μL using ultrafiltration (Amicon Ultra 100K, Millipore, Billerica, MA). The SSMCC-activated DNA aptamer and the reduced gFFNPs were combined and incubated in the dark for 2 h at room temperature. The unconjugated/free DNA aptamers were separated from DNA aptamergFFNP conjugates using ultrafiltration (Amicon Ultra 100K), and the retentate buffer was exchanged to an anionexchange buffer [20 mM [bis(2-hydroxyethyl)amino]tris(hydroxymethyl)methane (Bis-Tris), pH 6.0] using the same ultrafiltration as described above, followed by anion-exchange chromatography on a Q Sepharose fast flow bead column (GE Healthcare, Buckinghamshire, U.K.) to purify the DNA-aptamer-conjugated gFFNPs with removal of the free gFFNPs that were not conjugated to the DNA aptamers. The elution was performed by gradually increasing the NaCl concentration from 0 to 0.7 M (pH 6.0). The buffer of the purified DNA aptamergFFNP conjugates was then exchanged to storage buffer (150 mM NaCl, 36.4 mM KH2PO4, 63.6 mM K2HPO4, 5 mM EDTA, pH 7.5).32 In the case of production of DNA-aptamer-conjugated eGFP, the unconjugated/free DNA aptamers were separated from DNA-aptamer-conjuated eGFP using nickel affinity chromatography (QIAGEN), and the rest of the purification procedure was the same as the above method to purify DNA-aptamer-conjugated gFFNPs. DNA concentration of the DNA aptamereGFP conjugates or the DNA aptamergFFNP conjugates was measured by absorbance at 260 nm, and the protein nanoparticle concentration was determined by the Bradford method using the predetermined correlation: absorbance from the sample containing 1 ferritin particle (Abcam Inc., Cambridge, MA) and 24 eGFP monomers (Biovision, Mountain View, CA) was regarded as the absorbance from 1 nanoparticle of gFFNP. Aptamer-Based Assay of PDGF-BB Using DNA-AptamerConjugated eGFP, Cy3, and gFFNPs. The biotin-modified PDGF-BB-binding DNA aptamers 50 -biotin-(CH2)6-CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT-30 were also synthesized and supplied from Genotech. Before immobilization of the biotin-modified DNA aptamer probes, the Costar high-binding 96-well plate (Corning Inc., Corning, NY) was incubated with 100 ng of streptavidin (New England Biolabs, Hitchin, Herts, England) in PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) at 4 °C for 12 h. Next 20 μL of biotin-modified DNA aptamer (10 nM) was incubated in the 96-well plate for 1 h and 30 min. The plate was then washed with the same PBS buffer for 5 min. A 150 μL
ARTICLE
volume of analyte sample containing PDGF-BB (1 fM to 10 nM) (Sigma-Aldrich, St. Louis, MO) in either PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4, 5 mM EDTA, and 10 g/L BSA) or healthy human serum (5%) was added to each well and incubated at 37 °C for 1 h. The plate was then washed with the same PBS buffer for 5 min. Then 35 μL of DNA aptamergFFNPs (5 μg/mL) in the storage buffer was added to each well and incubated at 37 °C for 1 h. After the three consecutive washing steps followed by the addition of 50 μL of PBS buffer to each well, the fluorescence signals were measured using a microplate reader (Tecan, GENios) with excitation and emission at 485 and 535 nm, respectively. The assays of PDGFBB using DNA-aptamer-conjugated Cy3 and eGFP were performed through the same procedure as above.
’ RESULTS AND DISCUSSION Fluorescent Ferritin Nanoparticles with Enhanced Emission Intensity. We previously reported the synthesis of gFFNPs
by the bacterial expression of eGFP-linked hFTN-H and higher stability of gFFNPs than eGFP even at high temperature. However, the emission intensity of an individual eGFP comprising gFFNPs was only about 60% of the intact eGFP.23 Figure 2C shows an about 11-fold increase in the fluorescence intensity of a single gFFNP (bar 2), as compared to that of eGFP (bar 1), but this is less than half the proportional increase when considering that 24 eGFPs are anchored to a single gFFNP. [In the analyses of Figure 2C, the protein nanoparticle number in the various gFFNP solutions was adjusted to be the same as the eGFP molecule number in the eGFP solution (1 pM) to compare the fluorescence emission from a single eGFP with that from a single gFFNP.] This result is due presumably to fluorescence quenching among the adjacent eGFPs of gFFNPs, which generally occurs when the fluorophores are located within 110 nm of each other.33 When we inserted the flexible glycine-rich peptide (G3SG3TG3SG3) (≈4.5 nm) between the C-terminus of hFTN-H and the N-terminus of eGFP (Figures 1 and 2A), the fluorescence emission from gFFNPs (bar 3 of Figure 2C) significantly (1.74-fold) increased, which corresponds to a nearly 20-fold increase compared to that of eGFP (bar 1 of Figure 2C). The glycine-rich amino acid sequence has often been used to construct a fusion protein to maximize protein flexibility and solubility34,35 and is likely to reduce the quenching effect by acting as a flexible linker in this case too. In addition to the conformational flexibility given by the spacer peptide, DNA-mediated chargecharge repulsion between eGFPs of the FFNP was expected to further decrease the quenching effect. In the past few years, various methods of immobilization and conjugation to create proteinDNA hybrids have been developed in the area of biosensors and nanofabrication,36 including biotinstreptavidin binding,37 amino or sulfhydryl group specific bifunctional cross-linkers,38 nickelhistidine ligand affinity,39 and so on. In this study, the FFNPs were chemically conjugated to DNA aptamers using SSMCC, i.e., an aminethiol heterofunctional cross-linker for covalent coupling that allows no dissociation of conjugates. Although eGFP has two cysteine residues, the thiol groups are buried inside eGFP32,37 and can be hardly used for the aptamer conjugation. As a mutation site, we selected Ser175 that is located on the external loop of eGFP [PDB ID 1Z1P40 and PyMol view of eGFP (Figure 2A)] and mutated it to cysteine. It seems that the single residue alteration (Ser175Cys) does not affect the tight β-barrel structure of 5836
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry eGFP because the mutation site is on the flexible long external loop and far from the chromophore.41 The gFFNP consisting of the mutated eGFPs (Ser175Cys) was also synthesized in E. coli and purified. Prior to DNA aptamer conjugation, the purified gFFNP was treated by DTT to remove any aggregated gFFNPs that might be formed by internanoparticle
ARTICLE
disulfide bridges in the in vitro oxidative environment. We also prepared amine-modified DNA aptamers (41 bp) that have strong and specific affinity for PDGF-BB, which is generally known as a marker in the detection of a variety of cancers such as lung, breast, and gastric.24,25 (The DNA aptamer for PDGF-BB had a KD value of 0.093 ( 0.009 nM.31) The amine-modified
Figure 2. Continued 5837
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry
ARTICLE
Figure 2. (A) Schematics of various green fluorescent ferritin nanoparticles synthesized in this study: spacer-free gFFNP (a), gFFNP with the spacer peptide linkage between hFTN-H and eGFP (wild) (b), gFFNP with the spacer peptide linkage between hFTN-H and mutated eGFP (S175C) (c), and DNA-aptamer-conjugated gFFNP with the spacer peptide linkage between hFTN-H and eGFP (S175C) (d). (B) TEM images and histograms of particle size analysis of the four purified green fluorescent ferritin nanoparticles above: (a)(d) of (B) correspond to those of (A). In (A) and (B), (a), (b), and (c) indicate the green fluorescent ferritin nanoparticles that are synthesized using gene fusion systems a, b, and c of Figure 1, respectively. (C) Results of fluorescence emission analyses (λex = 485 nm/λem = 535 nm) of an eGFP monomer (1) and various green fluorescent ferritin nanoparticles (26), including spacer-free gFFNP (2), gFFNP with the spacer peptide linkage between hFTN-H and eGFP (wild) (3), gFFNP with the spacer peptide linkage between hFTN-H and mutated eGFP (S175C) (4), DTT-reduced gFFNP with the spacer peptide linkage between hFTN-H and mutated eGFP (S175C) (5), and DNA-aptamer-conjugated gFFNP with the spacer peptide linkage between hFTN-H and mutated eGFP (S175C) (6). The nanoparticle number in the various gFFNP samples was adjusted to the be same as the molecule number in the sample of eGFP monomers (1 pM) to compare the fluorescence emission from a single eGFP monomer with that from a single gFFNP. Inset photographs show green fluorescence emitted from an eGFP monomer (2 nM) (1) and various gFFNPs (2 nM) (2, 3, and 6) under UV excitation. In (C), error bars are based on the standard deviation of triplicate measurement.
DNA aptamers were activated first with excessive SSMCC and then incubated with the DTT-treated gFFNPs containing the mutated eGFPs. The aptamer-conjugated gFFNPs (aptamergFFNPs) were separated from unbound aptamers using size exclusive membranes. As shown in Figure 2C, the fluorescence emission intensity of aptamergFFNPs (bar 6) was finally 29-fold higher than that of eGFPs alone (bar 1), corresponding to an about 50% increase compared to the aptamer-free gFFNPs (bar 3) with the Gly-rich spacer. This most likely occurred because the spatial distance between eGFPs on the surface of the gFFNPs was properly maintained due to the electrostatic repulsion of the negatively charged nucleic acids and correspondingly the quenching effect was reduced. Figure 2C also shows that the mutated eGFP and the DTT treatment of gFFNPs (bars 4 and 5, respectively) did not significantly influence the fluorescent emission of gFFNPs. The TEM images and histograms of Figure 2B show the successful formation of spherical ferritin nanoparticles with high size uniformity. The same approach was applied to DsRed to form red fluorescent ferritin nanoparticles (rFFNPs) (Figure 3A). The hFTN-HDsRed fusion without the spacer sequence (bar 2 of Figure 3C) resulted in an about 4-fold increase in fluorescent emission intensity compared to the intact DsRed (bar 1 of Figure 3C). Compared to the case of gFFNPs (Figure 2C), the fluorescence quenching among DsReds in the spacer-free rFFNPs might have more severely occurred than that among eGFPs. [In the analyses of Figure 3C, the protein nanoparticle number in the rFFNP solutions was adjusted to be the same as the DsRed protein molecule number in the DsRed solution (1 pM) to compare the fluorescence emission from a single DsRed with that from a single rFFNP.] When the same spacer peptide was inserted between hFTN-H and DsRed, the fluorescence intensity of the rFFNP (bar 3 of Figure 3C) increased by 68% compared to that of the spacer-free rFFNP (bar 2 of Figure 3C). Conclusively,
from the results of Figures 2 and 3, the flexible linkage between hFTN-H and fluorescent protein is of crucial importance in recovering the quenching-induced loss of emission intensity of fluorescent proteins in FFNPs. The TEM images and histograms of Figure 3B also confirm the formation of spherical nanoparticles of rFFNPs with high size uniformity. [The purification performance of various FFNPs is presented in the Supporting Information (Figure S1).] Enhanced Stability of Fluorescent Ferritin Nanoparticles. The analysis of long-term stability at mild temperature (25 °C) shows that despite the stable β-barrel structure of eGFP, eGFPs lost about 60% of the initial emission intensity within two weeks, while more than 90% of the initial fluorescence emission of gFFNPs was retained during the same period, indicating the significantly enhanced stability of gFFNPs (Figure 4). (The result of Figure 4 was based on the spot measurements taken at the time points indicated. That is, the eGFP and gFFNP samples were not continuously exposed to the excitation source for the full time duration of analysis.) hFTN-H consists of a bundle of four antiparallel R-helices (helices AD) and a fifth shorter R-helix (helix E) that is located in the C-terminus.4244 The 24 subunits of hFTN-H assemble into a stable protein shell according to the assembly pattern of 432 symmetry, leaving iron channels along the 3- and 4-fold axes. The 4-fold axis is formed by the four C-termini of hFTN-Hs. It was proven that the carboxy terminus, including the E helix, is essential neither for proper folding of the monomer subunit nor for assembly of the 24-mer.42 The more interesting feature is that the 24-mer of hFTN-Hs can exist in two alternative conformations that differ in the position of the E helix in the 4-fold axis: a “flip” conformation with the E helix pointing inside the ferritin shell and a “flop” conformation with the E helix being extruded outside, while normally the native ferritin shell is constructed with the flip 5838
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry
ARTICLE
Figure 4. Time-course analyses of fluorescence emission of an eGFP monomer and a gFFNP with the spacer peptide linkage between hFTNH and eGFP (wild) in PBS buffer (pH 7.4) at 25 °C for two weeks. Error bars are based on the standard deviation of triplicate measurement.
Figure 3. (A) Schematics of a couple of red fluorescent ferritin nanoparticles synthesized in this study: spacer-free rFFNP (a) and rFFNP with the spacer peptide linkage between hFTN-H and DsRed (b). (B) TEM images and histograms of particle size analysis of the two purified red fluorescent ferritin nanoparticles above: (a) and (b) of (B) correspond to those of (A). In (A) and (B), (a) and (b) indicate the red fluorescent ferritin nanoparticles that are synthesized using gene fusion systems d and e of Figure 1, respectively. (C) Results of fluorescence emission analyses (λex = 550 nm/λem = 590 nm) of DsRed monomer (1), spacer-free rFFNP (2), and rFFNP with the spacer peptide linkage between hFTN-H and DsRed (3). The nanoparticle number in the two rFFNP samples was adjusted to be the same as the molecule number in the sample of DsRed monomers (1 pM) to compare the fluorescence emission from a single DsRed monomer with that from a single rFFNP. Inset photographs show red fluorescence emitted from a DsRed monomer (2 nM) (1) and the two rFFNPs above (2 nM) (2 and 3) under UV excitation. In (C), error bars are based on the standard deviation of triplicate measurement.
conformation. Lussago and Cesareni42 and Levi et al.43 observed that the flop conformation can be taken when a certain peptide or protein is fused to the C-terminus of hFTN-H and that upon the assembly of ferritinpeptide/protein fusion proteins, the decision of whether to flip or to flop is taken depending on whether the empty volume inside the shell is sufficient to contain the 24 peptides/proteins. As evidenced in this study through Western blot analysis following native polyacrylamide gel electrophoresis (PAGE) (data not shown), the eGFP (or DsRed) proteins that are fused to the C-termini of hFTN-Hs are exposed on the surface of ferritin (hFTN-H) nanoparticles with the flop conformation, which implies that four eGFP (or DsRed) monomers exist together in probably a tetrameric arrangement around each 4-fold axis of nanoparticle. Stepanenko et al.45 reported that tetrameric eGFP was shown to be dramatically more stable than the eGFP monomer, assuming that the association might contribute to the protein conformational stability. Therefore, the significantly enhanced stability of gFFNPs (Figure 4) seems likely to be due to the conformational stability of eGFPs, i.e., the stable tetrameric conformation of four eGFPs that are connected to C-termini of hFTN-H via the glycine-rich spacer. Aptamer-Based Biomolecular Detection Assay Using Green Fluorescent Ferritin Nanoparticles. The developed DNA-aptamer-conjugated gFFNPs were used as reporter probes in the aptamer-based sandwich assay of PDGF-BB. (gFFNPs were selected because reportedly eGFP is brighter and more photostable than DsRed.46) As schematically illustrated in Figure 5A, biotin-linked DNA aptamers (capture probes) are immobilized on a 96-well plate where streptavidin proteins are already attached on the bottom of each well, the analyte solution containing PDGF-BB is added to each well, and finally DNAaptamer-conjugated gFFNPs (reporter probes) are added to detect PDGF-BB that is already captured by the specific DNA aptamer probes. DNA-aptamer-conjugated eGFP and Cy3 were also used at the same molar concentration in PBS buffer as the DNA aptamergFFNPs. Cy3 has previously been used with success for aptamer microarray-based detection of protein targets.6 As shown in Figure 5B, compared to the gFFNP-based reporter, the fluorescence signals from eGFP and Cy3 were far lower in the entire concentration range of PDGF-BB. It is notable 5839
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry
ARTICLE
that the plots of Figure 5B show typical Langmuir-isotherm curves; i.e., the signals are rarely linear over a concentration range and converge to a saturated value at high solute concentration. The signal saturation is due presumably to saturation of capture probes, inhibition of solute binding to capture probes by solute already bound, binding-site competition, etc.47 According to the classical Langmuir-isotherm model [a linearized form of the adsorption isotherm, C/NF = C/NFsatd + KD/NFsatd, where C, NF, NFsatd, and KD represent the PDGF-BB concentration, net fluorescence (sensor signal), saturated net fluorescence, and dissociation constant, respectively], signals are all linear at sufficiently dilute solute concentrations, which is clearly shown in Figure 5C (C/NF vs C). On the basis of the linearized form of the Langmuir adsorption isotherm and the linear curves of Figure 5C, the dissociation constants (KD) were determined for the three different assays using DNA-aptamer-conjugated gFFNPs, eGFP, and Cy3 as follows: 6.0 1014, 4.0 1011, and 5.0 1011 mol L1, respectively. This indicates that, compared to the other two reporters, the three-dimensional structure of aptamergFFNPs, i.e., 24 DNA aptamers that are attached per single spherical gFFNP, may give more efficient access (or higher affinity) of gFFNPs to the target marker protein (PDGF-BB) and allow more sensitive detection. The limit of detection (LOD) was approximately 100 pM PDGF-BB in the eGFP-based assay, while the LOD was significantly lowered to approximately the 100 fM level in the gFFNP-based assay. The gFFNP-based assay demonstrates sensitivity comparable to the lower limits achieved in typical ELISA-based assays (picomolar
Figure 5. (A) Schematic illustration of a DNA-aptamer-based assay of PDGF-BB using DNA-aptamer-conjugated gFFNPs. (B) Assay results using DNA-aptamer-conjugated gFFNPs (b), DNA-aptamer-conjugated eGFP (O), and DNA-aptamer-conjugated Cy3 (1) as reporter probes in the detection of PDGF-BB. The assay experiments of (B) were conducted with PDGF-BB in PBS buffer solutions. Net fluorescence was estimated by subtracting the background signal from the measured actual signal value, and error bars are based on the standard deviation of triplicate measurement. λex = 485 nm/λem = 535 nm for gFFNPs and monomeric eGFP, and λex = 550 nm/λem = 590 nm for Cy3. (C) Linear correlations based on the linearized form of the Langmuir adsorption isotherm.
Figure 5. Continued
to nanomolar)48 and the best reported LOD for ELISA-based PDGF-BB detection. Beauchamp et al.49 reported LOD of approximately 550 fM in an ELISA-based PDGF-BB detection, while Li et al.50 demonstrated that PDGF-BB was detected with an LOD of about 100 fM using ELISA. (The LOD was determined according to the IUPAC definition: average of the detection signals from the negative control samples plus 3 times the standard deviation of the negative control signals.) The difference in fluorescence signals between gFFNP- and eGFP-based assays is relatively smaller than what is expected 5840
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry
Figure 6. (A) Assay results of a DNA-aptamer-based assay of PDGF-BB spiked in 5% healthy serum using DNA-aptamer-conjugated gFFNPs as reporter probes. Net fluorescence was estimated by subtracting the background signal from the measured actual signal value, and error bars are based on the standard deviation of triplicate measurement. λex = 485 nm/λem = 535 nm. (B) Linear correlation based on the linearized form of the Langmuir adsorption isotherm.
from the result of Figure 2C, which shows fluorescence emission of DNA-aptamer-conjugated gFFNPs is 29-fold more intensive than that of eGFP in aqueous solution. This may result from the fact that the phenomenon of self-quenching more severely happens on the surface than in the solution.51 Also it looks likely that when located on the surface, gFFNPs experience more severe self-quenching than eGFP, because eGFPs anchored to gFFNPs might have much higher local density on the surface than free eGFPs. Through the same DNA-aptamer-based assay, PDGF-BB spiked in the diluted serum (5%) of a healthy human was also successfully detected with a bit higher LOD (110 pM PDGF-BB), demonstrating that the assay could be properly performed even in the biological environment (Figure 6). Figure 6A also shows a typical Langmuir-isotherm curve, and Figure 6B indicates that the signals are all linear at dilute concentrations of PDGF-BB. The optical reporters that are commonly used in the biomolecular detection assays include chemical fluorescent dyes such as Cy69 and Alexa Fluor dyes,52 quantum dots (QDs), and chemiluminescent reporters. The use of QDs has increased dramatically over the past several years5356 due to their unique sizedependent optical properties.53,54 The typical size of QDs for
ARTICLE
biosensing is 2030 nm, but 10 nm QDs are also commercially available (Invitrogen), and even smaller QDs (6 nm) including dihydrolipoic acid (DHLA) coating have been recently reported.56 The advantages of QDs include high quantum yields, large extinction coefficients, pronounced photostability, and, more importantly, broad absorption spectra coupled to narrow size-tunable photoluminescent emission spectra.55 However, QDs are often self-aggregated and hence result in a significant degradation of the quantum yield, and additional chemical treatment is further required on the surface of QDs to conjugate capture probes for biosensing. The quantum yields (QYs) of various quantum dots are in the range between 0.4 and 0.5.57 The QYs of Cy3 and Alexa Fluor 546 are 0.14 and 0.79, respectively,52,58 while the QY of eGFP is 0.6,46 indicating that the QY of gFFNPs would be relatively high. In terms of photostability, it was reported that QDs, Alexa Fluor, and cyanines (Cy3, Cy5) are more photostable than fluorescent proteins (GFP, DsRed).59,60 (The core/shell CdSe(S)/ZnO QDs lost 40% of the initial fluorescence after 32 min, and Alexa Fluor dyes lost 1020% of the initial emission intensity after 100 s, whereas eGFP reached 50% loss of brightness within 174 s.) Chemiluminescence (CL) assays61,62 do not require an excitation source, but the transient nature of luminescence and matrix effects can be problematic, although fresh substrate is possibly added. FFNPs that are biologically synthesized in this study are stable nanostructured particles without a self-aggregation problem and also are uniformly small (i.e., only about 14 nm even when conjugated to DNA aptamers) enough to be comparable with the size of QDs. Analogous to immunoassays based on the antigenantibody interaction, aptamer-based bioassays are performed on the basis of different assay configurations to transduce biorecognition events. Since aptamers are synthesized to specifically bind very different targets, ranging from small molecules to macromolecules such as proteins, various assay configurations have been designed and reported, and the majority of these designs fall into two categories of configuration: single-site binding and dual-site binding.6366 (The latter is also known as the sandwich assay, which is one of the most used assay formats and also can ensure high sensitivity and specificity.) Especially proteins are structurally complicated, allow the interplay of various differential contacts (e.g., stacking, shape complementarity, electrostatic interactions, and hydrogen bonding), and hence can be detected via both single-site binding and sandwich assay. General sandwich assay requires the use of both capture and reporter probe aptamers with different nucleic acid sequences, and of course, a pair of aptamers that bind to different sites of the proteins should be available. However, in limited cases, some proteins such as homodimers (e.g., PDGF-BB used in this study) contain two identical binding sites, thus allowing the use of a single aptamer for the sandwich assay (Figure 5A). It has been reported that PDGF A-chain homodimer (PDGF-AA), thrombin, immunoglobulin E (IgE), lysozyme, and MPT64 (mycobacterium protein tuberculosis) are also detected by sandwich assay using a single aptamer with high sensitivity.6771 However, since the developed FFNP can be covalently and stably conjugated to any DNA aptamers, it can be used for sandwich assays of any other protein targets with dual binding sites as long as a pair of aptamers are available. This assay system has several important advantages. First, this is a relatively simpler sandwich-type assay, compared to sandwich 5841
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry ELISA: the captured target analyte (PDGF-BB in this case) is directly detected by the gFFNP-conjugated aptamers, unlike the sandwich ELISA (http://www.ncgc.nih.gov/guidance/section10. html#sandwich-immunoassay), where the absorbance- or chemiluminescence-based detection requires the addition of substrates. Second, the signaling moiety of the reporter probe (aptamerFFNP) is the 24 eGFPs anchored per ferritin nanoparticle, thereby allowing the significant signal amplification, as compared to that of eGFP or another fluorescent chemical such as Cy3. One DNA aptamer is covalently and stably conjugated to each eGFP of the gFFNP, and the negative-charge-induced repulsion between eGFPs even further enhances the fluorescence intensity of the gFFNP. Third, gFFNPs are more resistant to denaturation than eGFP when stored in solution at room temperature. Next, the three-dimensional structure of aptamer-conjugated FFNPs where 24 DNA aptamers are attached per single spherical FFNP seems to give higher affinity of gFFNPs to the protein target and allows more sensitive detection. Finally, since the mutation (Ser175Cys) of eGFP that is essential to the aptamer conjugation to gFFNPs never causes a significant reduction of the fluorescence emission, gFFNPs for the conjugation of any DNA aptamers and therefore in general for many other DNA-aptamer-based sandwich assays.
ARTICLE
’ ASSOCIATED CONTENT
bS
Supporting Information. Additional experimental methods and data. This material is available free of charge via the Internet at http://pubs.acs.org.
’ AUTHOR INFORMATION Corresponding Author
*Phone:+82-2-3290-3304. Fax: +82-2-926-6102. E-mail: leejw@ korea.ac.kr.
’ ACKNOWLEDGMENT This study was supported by the National Research Laboratory Project (Grant 2010-0018908, the main project that supported this work), the Microbial Genomics and Applications Center at Korea Research Institute of Bioscience & Biotechnology (Grant 2010-K000599), the Public Welfare & Safety research program (Grant 2010-0020778), and the Basic Science Research Program (ERC Program, Grant 2010-0029409) of the National Research Foundation of Korea (NRF) funded by the Korea Government. This work was also supported by the NRF (Grant 2010-0027771). ’ REFERENCES
’ CONCLUSIONS hFTN-H was genetically engineered by fusing fluorescent protein (eGFP or DsRed) to its C-terminus. When produced using a cost-effective E. coli expression system, the engineered fusion proteins [NH2-hFTN-H-(spacer peptide)-eGFP (or DsRed)-(His)6-COOH] were self-assembled to form nanoscale spherical particles in E. coli. That is, the fluorescent ferritin nanoparticles (gFFNPs or rFFNPs) that are highly stable with uniform nanoscale (about 12 nm) diameter were produced owing to the self-assembly function of hFTN-H. The glycinerich and flexible spacer peptide between hFTN-H and eGFP (or DsRed) significantly reduced the self-quenching effect among eGFPs (or DsReds) that are densely anchored to the surface of each ferritin nanoparticle. The quenching effect was further reduced by covalently conjugating a DNA aptamer to each mutated eGFP (Ser175Cys) of the gFFNP, which is due presumably to the electrostatic repulsion by the negatively charged nucleic acids. The site-directed mutagenesis in an external loop of eGFP (Ser175Cys) that is essential to the chemical and covalent coupling of DNA aptamers rarely affected the emission intensity of gFFNPs. Consequently, through the biosynthesis of hFTN-Hbased and surface-engineered nanoparticles (gFFNPs or rFFNPs), fluorescence emission from eGFPs (or DsReds) was notably amplified with avoidance of the quenching effect. The threedimensional nature of the DNA-aptamer-conjugated gFFNP seems to allow good accessibility/affinity of the reporter probe to the protein target. Owing to the amplified fluorescence emission and three-dimensional structure of the DNA-aptamerconjugated gFFNP (i.e., reporter probe), the detection sensitivity was significantly enhanced upon the aptamer-based assay of a disease marker (PDGF-BB), compared to the same aptamerbased assay using eGFP or Cy3 alone. Although the PDGF-BB assay is reported here as a proof-of-concept, the developed FFNPs in this study can be applied in general to many other aptamer-based sandwich assays.
(1) Tamilarasu, N.; Zhang, J.; Hwang, S.; Rana, T. M. Bioconjugate Chem. 2001, 12, 135–138. (2) DeJong, E. S.; Chang, C. E.; Gilson, M. K.; Marino, J. P. Biochemistry 2003, 42, 8035–8046. (3) Kirby, R.; Cho, E. J.; Gehrke, B.; Bayer, T.; Park, Y. S.; Neikirk, D. P.; McDevitt, J. T.; Ellington, A. D. Anal. Chem. 2004, 76, 4066–4075. (4) Zhong, W. W. Anal. Bioanal. Chem. 2009, 394, 47–59. (5) Sassolas, A.; Bluma, L. J.; Leca-Bouvier, B. D. Biosens. Bioelectron. 2011 in press. (6) Cho, E. J.; Collett, J. R.; Szafranska, A. E.; Ellington, A. D. Anal. Chim. Acta 2006, 564, 82–90. (7) Wang, Y. Y.; Liu, B. Biosens. Bioelectron. 2009, 24, 3293–3298. (8) Lacharme, F.; Vandevyver, C.; Gijs, M. A. M. Microfluid. Nanofluid. 2009, 7, 479–487. (9) Anderson, G. P.; Taitt, C. R. Biosens. Bioelectron. 2008, 24, 324–328. (10) He, X. X.; Wang, K. M.; Tan, W. H.; Xiao, D.; Li, J.; Yang, X. H. Chin. Sci. Bull. 2001, 46, 1962–1965. (11) Zhao, X. J.; Tapec-Dytioco, R.; Tan, W. H. J. Am. Chem. Soc. 2003, 125, 11474–11475. (12) Wang, J.; Liu, G. D.; Jan, M. R. J. Am. Chem. Soc. 2004, 126, 3010–3011. (13) Rosi, N. L.; Mirkin, C. A. Chem. Rev. 2005, 105, 1547–1562. (14) Wang, H.; Yang, R. H.; Yang, L.; Tan, W. H. ACS Nano 2009, 3, 2451–2460. (15) Park, J. S.; Cho, M. K.; Lee, E. J.; Ahn, K. Y.; Lee, K. E.; Jung, J. H.; Cho, Y. J.; Han, S. S.; Kim, Y. K.; Lee, J. Nat. Nanotechnol. 2009, 4, 259–264. (16) Lee, S. H.; Lee, H.; Park, J. S.; Choi, H.; Han, K. Y.; Seo, H. S.; Ahn, K. Y.; Han, S. S.; Cho, Y.; Lee, K. H.; Lee, J. FASEB J. 2007, 21, 1324–1334. (17) Lee, J. H.; Kim, J. S.; Park, J. S.; Lee, W.; Lee, K. E.; Han, S. S.; Lee, K. B.; Lee, J. Adv. Funct. Mater. 2010, 20, 2004–2009. (18) Seo, H. S.; Kim, S. E.; Park, J. S.; Lee, J. H.; Yang, K. Y.; Lee, H.; Lee, K. E.; Han, S. S.; Lee, J. Adv. Funct. Mater. 2010, 20, 4055–4061. (19) Ahn, J. Y.; Choi, H.; Kim, Y. H.; Han, K. Y.; Park, J. S.; Han, S. S.; Lee, J. Nucleic Acids Res. 2005, 33, 3751–3762. (20) Yang, T. T.; Cheng, L. Z.; Kain, S. R. Nucleic Acids Res. 1996, 24, 4592–4593. 5842
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
Analytical Chemistry (21) Kain, S. R.; Adams, M.; Kondepudi, A.; Yang, T. T.; Ward, W. W.; Kitts, P. Biotechniques 1995, 19, 650–655. (22) Wang, S. X.; Hazelrigg, T. Nature 1994, 369, 400–403. (23) Park, J. S.; Ahn, J. Y.; Lee, S. H.; Lee, H.; Han, K. Y.; Seo, H. S.; Ahn, K. Y.; Min, B. H.; Sim, S. J.; Choi, I. S.; Kim, Y. H.; Lee, J. Appl. Microbiol. Biotechnol. 2007, 75, 347–355. (24) Ariad, S.; Seymour, L.; Bezwoda, W. R. Breast Cancer Res. Treat. 1991, 20, 11–17. (25) Lubinus, M.; Meier, K. E.; Smith, E. A.; Gause, K. C.; Leroy, E. C.; Trojanowska, M. J. Biol. Chem. 1994, 269, 9822–9825. (26) Mukhopadhyay, R. Anal. Chem. 2005, 77, 114a–118a. (27) Jayasena, S. D. Clin. Chem. 1999, 45, 1628–1650. (28) Heldin, C. H. EMBO J. 1992, 11, 4251–4259. (29) Ikebukuro, K.; Kiyohara, C.; Sode, K. Biosens. Bioelectron. 2005, 20, 2168–2172. (30) Song, S. P.; Wang, L. H.; Li, J.; Zhao, J. L.; Fan, C. H. TrAC, Trends Anal. Chem. 2008, 27, 108–117. (31) Green, L. S.; Jellinek, D.; Jenison, R.; Ostman, A.; Heldin, C. H.; Janjic, N. Biochemistry 1996, 35, 14413–14424. (32) Kukolka, F.; Niemeyer, C. M. Org. Biomol. Chem. 2004, 2, 2203–2206. (33) Weissleder, R.; Tung, C. H.; Mahmood, U.; Bogdanov, A. Nat. Biotechnol. 1999, 17, 375–378. (34) Huston, J. S.; Levinson, D.; Mudgetthunter, M.; Tai, M. S.; Novotny, J.; Margolies, M. N.; Ridge, R. J.; Bruccoleri, R. E.; Haber, E.; Crea, R.; Oppermann, H. Proc. Natl. Acad. Sci. U.S.A. 1988, 85, 5879–5883. (35) Robinson, C. R.; Sauer, R. T. Biochemistry 1996, 35, 109–116. (36) Niemeyer, C. M. Angew. Chem., Int. Ed. 2010, 49, 1200–1216. (37) Demidov, V. V.; Dokholyan, N. V.; Witte-Hoffmann, C.; Chalasani, P.; Yiu, H. W.; Ding, F.; Yu, Y.; Cantor, C. R.; Broude, N. E. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 2052–2056. (38) Takeda, S.; Tsukiji, S.; Ueda, H.; Nagamune, T. Org. Biomol. Chem. 2008, 6, 2187–2194. (39) Boireau, W.; Bombard, S.; Sari, M. A.; Pompon, D. Biotechnol. Bioeng. 2002, 77, 225–231. (40) Palm, G. J.; Zdanov, A.; Gaitanaris, G. A.; Stauber, R.; Pavlakis, G. N.; Wlodawer, A. Nat. Struct. Biol. 1997, 4, 361–365. (41) Chou, W. Y.; Matthews, K. S. J. Biol. Chem. 1989, 264, 18314–18319. (42) Luzzago, A.; Cesareni, G. EMBO J. 1989, 8, 569–576. (43) Levi, S.; Luzzago, A.; Franceschinelli, F.; Santambrogio, P.; Cesareni, G.; Arosio, P. Biochem. J. 1989, 264, 381–388. (44) Santambrogio, P.; Pinto, P.; Levi, S.; Cozzi, A.; Rovida, E.; Albertini, A.; Artymiuk, P.; Harrison, P. M.; Arosio, P. Biochem. J. 1997, 322, 461–468. (45) Stepanenko, O. V.; Verkhusha, V. V.; Kazakov, V. I.; Shavlovsky, M. M.; Kuznetsova, I. M.; Uversky, V. N.; Turoverov, K. K. Biochemistry 2004, 43, 14913–14923. (46) Shaner, N. C.; Steinbach, P. A.; Tsien, R. Y. Nat. Methods 2005, 2, 905–909. (47) Nygren, H.; Werthen, M.; Stenberg, M. J. Immunol. Methods 1987, 101, 63–71. (48) Rosi, N. L.; Mirkin, C. A. Chem. Rev. 2005, 105, 1547–1562. (49) Beauchamp, M. C.; Letendre, E.; Renier, G. J. Lipid Res. 2002, 43, 215–222. (50) Li, Y. Y.; Zhang, C.; Li, B. S.; Zhao, L. F.; Li, X. B.; Yang, W. J.; Xu, S. Q. Clin. Chem. 2007, 53, 1061–1066. (51) Skaff, H.; Sill, K.; Emrick, T. J. Am. Chem. Soc. 2004, 126, 11322–11325. (52) Spratt, D. E.; Taiakina, V.; Palmer, M.; Guillemette, J. G. Biochemistry 2008, 47, 12006–12017. (53) Medintz, I. L.; Mattoussi, H.; Clapp, A. R. Int. J. Nanomed. 2008, 3, 151–167. (54) Bally, M.; Voros, J. Nanomedicine 2009, 4, 447–467. (55) Goldman, E. R.; Medintz, I. L.; Mattoussi, H. Anal. Bioanal. Chem. 2006, 384, 560–563. (56) Sapsford, K. E.; Pons, T.; Medintz, I. L.; Mattoussi, H. Sensors 2006, 6, 925–953.
ARTICLE
(57) RodriguezViejo, J.; Jensen, K. F.; Mattoussi, H.; Michel, J.; Dabbousi, B. O.; Bawendi, M. G. Appl. Phys. Lett. 1997, 70, 2132–2134. (58) Mujumdar, S. R.; Mujumdar, R. B.; Grant, C. M.; Waggoner, A. S. Bioconjugate Chem. 1996, 7, 356–362. (59) Aldeek, F.; Mustin, C.; Balan, L.; Medjahdi, G.; RoquesCarmes, T.; Arnoux, P.; Schneider, R. Eur. J. Inorg. Chem. 2011, 2011, 794–801. (60) Berlier, J. E.; Rothe, A.; Buller, G.; Bradford, J.; Gray, D. R.; Filanoski, B. J.; Telford, W. G.; Yue, S.; Liu, J. X.; Cheung, C. Y.; Chang, W.; Hirsch, J. D.; Beechem, J. M.; Haugland, R. P.; Haugland, R. P. J. Histochem. Cytochem. 2003, 51, 1699–1712. (61) Muller, M. M.; Griesmacher, A.; Grabenwoger, M. Mikrochim. Acta 1991, 2, 157–166. (62) Baeyens, W. R.; Schulman, S. G.; Calokerinos, A. C.; Zhao, Y.; Garcia Campana, A. M.; Nakashima, K.; De Keukeleire, D. J. Pharm. Biomed. Anal. 1998, 17, 941–953. (63) Polsky, R.; Gill, R.; Kaganovsky, L.; Willner, I. Anal. Chem. 2006, 78, 2268–2271. (64) Xiang, Y.; Xie, M.; Bash, R.; Chen, J. J. L.; Wang, J. Angew. Chem., Int. Ed. 2007, 46, 9054–9056. (65) Xu, Y.; Cheng, G. F.; He, P. G.; Fang, Y. Z. Electroanalysis 2009, 21, 1251–1259. (66) Zuo, X. L.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2009, 131, 6944–6945. (67) Huang, C. C.; Huang, Y. F.; Cao, Z. H.; Tan, W. H.; Chang, H. T. Anal. Chem. 2005, 77, 5735–5741. (68) Pavlov, V.; Xiao, Y.; Shlyahovsky, B.; Willner, I. J. Am. Chem. Soc. 2004, 126, 11768–11769. (69) Wang, J. L.; Lv, R. J.; Xu, J. J.; Xu, D. K.; Chen, H. Y. Anal. Bioanal. Chem. 2008, 390, 1059–1065. (70) Wang, Y. Y.; Liu, B. Langmuir 2009, 25, 12787–12793. (71) Qin, L. H.; Zheng, R. J.; Ma, Z. X.; Feng, Y. H.; Liu, Z. H.; Yang, H.; Wang, J.; Jin, R. L.; Lu, J. M.; Ding, Y. S.; Hu, Z. Y. Clin. Chem. Lab. Med. 2009, 47, 405–411.
5843
dx.doi.org/10.1021/ac200657s |Anal. Chem. 2011, 83, 5834–5843
