G-Quadruplex

Article pubs.acs.org/ac

Analysis of Telomerase by the Telomeric Hemin/G-QuadruplexControlled Aggregation of Au Nanoparticles in the Presence of Cysteine Etery Sharon,† Eyal Golub,† Angelica Niazov-Elkan, Dora Balogh, and Itamar Willner* Institute of Chemistry, The Center for Nanoscience and Nanotechnology, The Hebrew University of Jerusalem, Jerusalem 91904, Israel ABSTRACT: Telomeres are guanosine-rich nucleic-acid chains that fold, in the presence of K+ ions and hemin, into the telomeric hemin/ G-quadruplex structure, exhibiting horseradish peroxidase mimicking functions. The telomeric hemin/G-quadruplex structures catalyze the oxidation of thiols (e.g., L-cysteine) into disulfides (e.g., cystine). As L-cysteine stimulates the aggregation of Au nanoparticles (NPs), accompanied by absorbance changes from red (individual Au NPs) to blue (aggregated Au NPs), the process is implemented to quantitatively analyze the activity (content) of telomerase, a versatile biomarker for cancer cells. Telomerase extracted from 293T cancer cells catalyzes, in the presence of a dNTPs mixture and an appropriate primer probe, the telomerization process, leading to the generation of catalytic telomeric hemin/G-quadruplex chains that control the L-cysteine-mediated aggregation of Au NPs. The extent of aggregation is thus controlled by the concentration of telomerase. The method enabled the detection of telomerase with a detection limit of 27 cells/μL. The spectral changes accompanying the aggregation of Au NPs are further supported by transmission electron microscopy imaging.

T

elongation of the telomeres.15 The telomerase-induced elongation of the telomeres compensates for the natural telomere shortening process, thus transforming the cells into immortal and malignant cells. Indeed, in over 85% of cancer cells elevated amounts of telomerase were found,16−18 and it is considered as a versatile biomarker for cancer cells. Thus, the sensitive detection of telomerase activity and its inhibition is important both for diagnostics and for the screening of anticancer drugs. Different methods to analyze telomerase were developed in recent years. The most frequently used telomerase analysis method is the telomeric repeat amplification protocol (TRAP),19 which is a polymerase chain reaction (PCR)-based method. This method is, however, susceptible to the inhibition of the PCR process by the cell extract. Different electrochemical sensing platforms were, also, reported using either ferrocenyl naphthalene diimide20 or Ru(NH3)63+21 as electrochemical labels. Additionally, telomerase activity was followed using fieldeffect transistor devices and surface plasmon resonance spectroscopy.22 Alternatively, optical sensing of telomerase activity was reported using semiconductor quantum dots.22,23 L-Cysteine induces the aggregation of Au NPs by its association with the NPs and the formation of interparticle H-bonds and electrostatic binding interactions.24,25 Recently, we have applied the I−-catalyzed oxidation of L-cysteine to

he aggregation of Au nanoparticles, Au NPs, and the accompanying color changes from red to blue due to interparticle plasmon coupling effects became a versatile paradigm to develop sensors and biosensors.1,2 Complementary H-bonds between molecularly modified NPs,3 ion-induced aggregation of ligand-functionalized NPs,4 and donor−acceptor interactions5 or host−guest interactions6 were used to aggregate chemically modified Au NPs. Similarly, biorecognition events, such as biotin−avidin or antigen−antibody affinity interactions, were used to stimulate the aggregation of Au NPs.7 Specifically, nucleic acid-functionalized Au NPs were implemented to develop colorimetric sensors based on the aggregation of Au NPs. The aggregation of Au NPs by the bridging of nucleic acid-functionalized Au NPs with a target nucleic acid was used to develop DNA sensing platforms.8 Similarly, the aggregation of Au NPs by aptamer−substrate complexes,9 the Hg2+-stimulated bridging of nucleic acidmodified Au NPs,10 and the Pb2+-dependent DNAzyme cleavage of nucleic acids and the deaggregation of Au NPs11 were used to develop aptasensors and Hg2+-ions and Pb2+-ions sensors. The telomere ends cap and protect the eukaryotic chromosome ends against degradation, and consist of short DNA repeat units (TTAGGG in vertebrates). In human somatic cells, telomeres undergo progressive shortening during cell proliferation, and at a certain critical length provide a signal to terminate cell’s life cycle.12−14 Telomerase is a ribonucleoprotein that binds to the telomere ends and stimulates the © 2014 American Chemical Society

Received: January 2, 2014 Accepted: February 6, 2014 Published: February 6, 2014 3153

dx.doi.org/10.1021/ac5000152 | Anal. Chem. 2014, 86, 3153−3158

Analytical Chemistry

Article

at least three times and incubating in ice for 30 min to thoroughly lyse the cells. The lysate was then centrifuged at 14 000 rpm for 30 min at 4 °C, and the supernatant was collected carefully and aliquoted into several 1.5 mL Eppendorf tubes (about 25 μL per tube). The resulting extract was used immediately or was flash-frozen in liquid nitrogen and stored at −80 °C. Telomerization Reaction. The telomerization reaction was performed by using the telomerase primer, (1), 5 × 10−6 M, in the presence of dATP, dTTP, dGTP, and dCTP (2 mM each) and telomerase solution (20 mM Tris-HCl, pH = 8.3, 1.5 mM MgCl2, 63 mM KCl, 0.005% Tween 20, 1 mM EGTA, 0.1 mg·mL−1 bovine serum albumin) at 38 °C for 1 h. Telomerase solution consisted of telomerase originating from the specified number of cancer cells. For control experiments, fibroblast cell extract, which lacks telomerase, was used. Monitoring Telomerase Activity. Telomerase orginating from different numbers of 293T cancer cells extracts was incubated in a HEPES buffer solution 5 mM, pH = 7.2, containing 20 mM KNO3, 200 mM NaNO3, and 2 × 10−6 M hemin, for 60 min at room temperature, to stabilize the hemin/ G-quadruplex complex. The system was incubated then with 1 × 10−5 M L-cysteine for 45 min at room temperature. Twenty microliters from the resulting system were incubated with 20 μL of 6 × 10−9 M Au NPs in 100 μL of 5 mM HEPES buffer, pH = 7.2, for 10 min. The color development was followed from λ = 700 nm to λ = 450 nm with a Shimadzu UV-2401 PC spectrophotometer.

cystine by means of H2O2 to develop optical sensors for glucose oxidase or acetylcholine esterase by inhibiting the aggregation of the NPs.26 Furthermore, the hemin/G-quadruplex horseradish peroxidase was found to catalyze the aerobic oxidation of thiols into disulfides.27 As the telomere units self-assemble into a G-quadruplex structure, and realizing that hemin associates to telomeric G-quadruplexes to form a peroxidase-like DNAzyme,28 we argued that the telomeric hemin/G-quadruplexes could catalyze the aerobic oxidation of L-cysteine to cystine, thereby inhibiting the aggregation of the Au NPs. Accordingly, in the present study we introduce an assay for telomerase activity, by probing the control of the L-cysteine-induced aggregation of Au NPs in the presence of telomeric hemin/Gquadruplexes generated by telomerase.

■

EXPERIMENTAL SECTION Materials and Reagents. Ultrapure water from NANOpure Diamond source (Barnstead Int., Dubuque, IA) was used throughout the experiments. Hemin was obtained from Frontier Scientific and was used without further purification. Hemin stock solution was prepared in dimethyl sulfoxide and kept in the dark at −20 °C. L-Cysteine dihydrochloride anhydrous was purchased from Fluka. The DNA strands used in this study were obtained from Integrated DNA Technologies Inc. (IDT). All oligonucleotides were purified by high-performance liquid chromatrography and freeze-dried by IDT. The oligonucleotides were used as provided and diluted in phosphate buffer solution, 10 Mm, pH = 7.4, to give stock solutions of 100 μM. The deoxynucleotide solution set, 100 mM each, was purchased from New England BioLabs. The sequence of the oligomer used in this study is 5′‐TTTTAATCCGTCGAGCAGAGTT‐3′

■

RESULTS AND DISCUSSION The method to probe telomerase through the telomere hemin/ G-quadruplex-controlled aggregation of Au NPs is depicted in Scheme 1. The system consists of the telomerase primer (1), the dNTPs mixture, hemin, and L-cysteine. In the absence of telomerase, the addition of Au NPs to the system results in the L-cysteine-induced aggregation of the Au NPs accompanied by the red-to-blue transition of individual NPs into the plasmon-

(1)

Preparation and Functionalization of Au NPs. The 13 nm Au NPs were synthesized by the standard citrate method.29 Briefly, a solution of sodium citrate, 38 mM, was added to a rapidly stirred boiling aqueous solution of 1 mM HAuCl4. After the mixture was boiled for 30 min, and the resulting red solution was allowed to cool down to room temperature, the Au NPs were collected by filtering through a 0.45 μm membrane. Finally, 50 mL of the Au NPs solution was mixed with 2 mL of 1% of the surfactant Tween-20 to yield welldispersed Au NPs and was stored at 4 °C. The concentration of the 13-nm Au NPs was determined by recording the absorbance spectra, λ = 520 nm, and by using the corresponding extinction coefficient. The concentration was determined as 12 nM. Telomerase Extract Preparation. 293T, a transformed human embryonic kidney cell line, was used for telomerasepositive cells. Primary human foreskin fibroblasts were used as a telomerase-negative control. Cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum and 1% nonessential amino acids (for the fibroblasts only), collected by trypsinization and centrifugation, counted, washed twice in phosphate buffer saline (PBS), aliquoted, and stored as cell pellets at −80 °C until extraction by the CHAPS method.19 Cells were collected in the exponential phase of growth. Typically, an aliquot containing 40 × 106 cells was resuspended in 200 μL of ice-cold lysis buffer (0.5% CHAPS, 10 mM Tris-HC1, pH = 7.5, 1 mM MgCl2, 1 mM ethylene glycol tetraacetic acid (EGTA), 5 mM β-mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride, 10% glycerol) by pipetting

Scheme 1. Analysis of Telomerase Activity by Following the Hemin/Telomere-G-Quadruplex-Controlled L-CysteineMediated Aggregation of Au NPs

3154

dx.doi.org/10.1021/ac5000152 | Anal. Chem. 2014, 86, 3153−3158

Analytical Chemistry

Article

coupled aggregated state, path (a). In the presence of telomerase, the telomerization of the primer, (1), proceeds, leading to the formation of the telomeric G-quadruplexes. The binding of hemin to the G-quadruplexes yields the DNAzyme that catalyzes the aerobic oxidation of L-cysteine to cystine. Since cystine is inactive in stimulating the aggregation of the NPs, the addition of Au NPs to the system will thus result in the inhibition of the aggregation process, path (b). The aerobic telomeric hemin/G-quadruplex-catalyzed oxidation of L-cysteine to cystine is attributed27 to the sequence of reactions outlined in Figure 1, eqs 1−10. In the primary step, the

Figure 2. (A) Absorption spectra of Au NPs in the presence of synthetic nucleic acids containing a different number of telomeric repeats, in the presence of 2 × 10−6 M hemin and 1 × 10−5 M Lcysteine: (a) 4 repeats, (b) 8 repeats, and (c) 16 repeats. (B) Absorption spectra of Au NPs in the presence of synthetic nucleic acids containing 16 telomeric repeats, in the presence of 2 × 10−6 M hemin incubated with 1 × 10−5 M L-cysteine for different durations: (a) 0 min, (b) 10 min, (c) 20 min, (d) 30 min, and (e) 40 min.

Figure 1. Suggested mechanism for the aerobic hemin/telomere-Gquadruplex-catalyzed oxidation of thiols to disulfides with the simultaneous generation of H2O2.

inefficient noncatalytic, aerobic oxidation of the thiol to disulfide yields minute amounts of H2O2 (or H2O), eqs 1 and 2. The generated H2O2 oxidizes the hemin/telomere-Gquadruplex, eq 3, thus initiating the hemin/telomere-Gquadrupex-catalyzed oxidation of thiols to thiol radicals, eqs 4 and 5. In an aerobic environment, the thiol radicals autocatalyze the generation of H2O2 and the disulfide product via eqs 6−10, thus creating an amplification cycle for the constant generation of the disulfide with the concomitant generation of H2O2. Therefore, the minute amount of H2O2 formed via eq 1 leads to the hemin/telomere-G-quadruplex DNAzyme catalyzing the oxidation of thiols to disulfides with a concomitant generation of H2O2, even in the absence of exogenously added H2O2. As a primary prerequisite, it was essential to confirm that the association of hemin to the telomeric G-quadruplex units generate a catalyst for the oxidation of L-cysteine to cystine, thus controlling the aggregation of the Au NPs. Toward this end, we first implemented synthetic nucleic acids as telomere models. Realizing that four telomere repeats generate one Gquadruplex, we used nucleic acid sequences that included either 4, 8, or 16 telomere repeats that generate 1, 2, or 4 hemin/Gquadruplexes, respectively. Figure 2A, curves (a)−(c), depicts the absorption spectra of the system containing L-cysteine/Au NPs/hemin in the presence of telomere-G-quadruplex composed of a different number of telomeric repeats after a fixed time interval of 30 min. It can be seen that as the number of the telomeric repeats in the nucleic acid chains increases, the absorbance band at 650 nm, which is indicative of aggregated Au NPs due to the plasmon coupling of the Au NPs, decreases, while the absorbance band at 520 nm, characteristic to individual Au NPs, increases. That is, as the number of

telomeric repeats increases, the particles are less aggregated, consistent with the higher content of the hemin/G-quadruplex catalyst. Figure 2B shows the absorption spectra of the aggregated Au NPs generated by exposing the L-cysteine to the hemin/16 synthetic telomere repeats for different time intervals and the subsequent addition of the Au NPs to the resulting solution. As the time interval of the aerobic reaction of the hemin/synthetic telomeres with L-cysteine increases, the aggregation of the Au NPs is retarded, and treatment of the Lcysteine solution with the telomeric DNAzyme for 40 min does not lead to an aggregation of the NPs, Figure 2B, curve (e). These results confirm that the association of hemin to the telomere G-quadruplex yields a catalyst that oxidizes L-cysteine to cystine, and this process prohibits the aggregation of the Au NPs. As the content of the catalytic telomeric hemin/Gquadruplexes is controlled by the content of telomerase (and the time interval for the catalyzed oxidation of L-cysteine to cystine), the degree of aggregation of the Au NPs is anticipated to be controlled by the concentration of telomerase. Figure 3A depicts the absorption spectra generated by the Au NPs upon analyzing the telomerase extracted from different numbers of 293T cancer cells. In these experiments, the telomerization of (1) was stimulated in the presence of telomerase extracted from a different number of 293T cells in the presence of dNTPs, and the telomerization was conducted for a fixed time interval corresponding to 60 min. The resulting telomere G-quadruplex was allowed to react with hemin for 60 min and then with Lcysteine solution for a fixed time interval of 45 min. Subsequently, Au NPs were added to the reaction mixture, and the degree of aggregation was followed spectroscopically 3155

dx.doi.org/10.1021/ac5000152 | Anal. Chem. 2014, 86, 3153−3158

Analytical Chemistry

Article

after a fixed time interval of 10 min. At a high concentration of cells (192 cells/μL) the resulting aggregation is prohibited, curve (a). However, as the concentration of the cells decreases (and hence the content of extracted telomerase is lowered), the degree of aggregation is intensified, curves (b)−(d). For comparison, curve (e) depicts the absorption spectrum generated by a fibroblast cell extract (274 cells/μL) that lacks telomerase. In this system an effective aggregation of the Au NPs proceeds. Thus, the absorption spectra of the aggregated Au NPs relates to the concentration of the 293T cells and to the telomerase activity. Figure 3A, inset, depicts the resulting calibration curve corresponding to the A520/A650 ratio of the Au NPs as a function of the 293T cells concentration after a fixed time interval of 45 min. This system enabled the detection of telomerase with a detection limit corresponding to 27 cells/μL. The effect of the concentration of telomerase on the aggregation of the nanoparticles could also be followed visually, Figure 3B. Transmission electron microscopy (TEM) images of the Au NPs that were treated either with fibroblast cells extract or with 293T cells are presented in Figure 4, panels I and II, respectively. When only fibroblast cells are present, aggregation takes place, while almost no aggregation is visible in the presence of 293T cells containing telomerase, orginating from 192 cells/μL. These images further support the formation of the hemin/telomere-G-quadruplex DNAzyme that prohibits the aggregation of the Au NPs in the presence of L-cysteine. Figure 5, panels I −IV, presents the TEM images of Au NPs treated with different concentrations of 293T cells, in the presence of dNTPs, (1), hemin and L-cysteine. It can be seen that as the concentration of the cells increase, the size of the formed aggregates decreases, until only individual particles are observed at a high concentration of 293T cells. These images imply that as the concentration of telomerase in the samples increases, a higher content of hemin/telomere-G-quadruplex DNAzyme is formed in the system, thus leading to the biocatalytic oxidation of thiols to disulfides, and to the inhibition of the L-cysteine-mediated aggregation process of the NPs.

Figure 3. (A) Absorption spectra corresponding to the analysis of telomerase originating from a different number of 293T cancer cells according to Scheme 1: (a) 192 cells/μL, (b) 137 cells/μL, (c) 82 cells/μL, (d) 27 cells/μL, and (e) fibroblast cell extract, 274 cells/μL (lacking the telomerase). Inset: Calibration curve presenting the A520/ A650 absorbance ratio at different concentrations of cell extracts. In all experiments, the telomerization was performed for a fixed time interval of 1 h, 38 °C, and the Au NPs aggregation process was stimulated for a time interval of 10 min. (B) Visual color changes upon analyzing telomerase extracted from a different number of cancer cells through the L-cysteine-mediated aggregation of Au NPs: (a) 192 cells/μL, (b) 137 cells/μL, (c) 82 cells/μL, (d) 27 cells/μL, and (e) fibroblast cell extract, 274 cells/μL (lacking the telomerase).

■

CONCLUSIONS In conclusion, the present study has introduced a new method to quantitatively assay the activity of telomerase originating from cancer cells by following the telomeric hemin/Gquadruplex-catalyzed oxidation of L-cysteine and the controlled

Figure 4. TEM images corresponding to the following: (I) The aggregated Au NPs generated by the L-cysteine-stimulated cross-linking process in the absence of telomerase. (II) The nonaggregated Au NPs generated by treatment of the Au NPs with telomerase orginating from 192 cell/μL extract (telomerization time of 1 h) in the presence of 2 × 10−6 M hemin and 1 × 10−5 M L-cysteine. For all experiments the Au NPs samples were allowed to interact for 10 min prior to the recording of the TEM images. Scale bars represent 500 nm. 3156

dx.doi.org/10.1021/ac5000152 | Anal. Chem. 2014, 86, 3153−3158

Analytical Chemistry

Article

Figure 5. TEM images following the degree of Au NPs aggregation upon analyzing different concentrations of cell extracts: (I) 27 cells/μL, (II) 82 cells/μL, (III) 137 cells/μL, and (IV) 192 cells/μL. For all experiments the telomerization was conducted for 1 h in the presence of (1), 5 × 10−6, and dNTPs 2 mM. The aggregation process was conducted for a fixed time interval of 10 min, in the presence of 2 × 10−6 M hemin and 1 × 10−5 M L-cysteine prior to recording of the TEM images. Scale bars represent 500 nm.

Table 1. Sensor Platforms for Telomerase Detaction method

system

detection limit

detection time

reference

PCR-based assay optical (color evolution) optical (FRET) optical (fluorescence) optical

telomeric repeat amplification protocol (TRAP) catalytic beacons CdSe/ZnS QDs/Texas Red labeled dUTP ZnP/telomere-G-quadruplex hemin/telomere-G-quadruplex/L-cysteine/aggregation AuNPs

10−100 cells 500 cells 10000 cells 380 cells/μL 27 cells/μL

1 day 1.5 h 3.5 h 3.5 h 3h

electrochemical

ferrocenylnaphthalene diimide as binder to tetraplex structure of telomere DNA Ru(NH3)63+/DNA-Au NP conjugate telomerase primer/ISFET gate

40 cells/μL

5.5 h

19 30 23 31 present study 20

10 cells 67 cells/μL

5.5 h 3.5 h

21 22

structure-switching DNA probe/ferrocene (Fc)

100 cells/ mL 1000 cells 100 cells/ mL

1 day

32

1 day 5h

33 34

electrochemical (biobarcode) electrochemical (ion-sensitive field-effect transistor) electrochemical electrochemical (impedance spectroscopy) electrochemical

Au electrode-Fe(CN)63−/Fe(CN)64− glassy carbon electrode (GCE) /Pt-nanoparticle/Exo III

■

aggregation of Au NPs. The method enabled the detection of telomerase originating from 27 cancer cells/μL. Table 1

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: 972-2-6585272. Fax: 972-2-6527715.

compares the advantages and disadvantages of the present method. The table reveals that the present telomerase sensing

Author Contributions

platform is among the most sensitive analysis schemes of

†

E.S and E.G. contributed equally to this work.

telomerase. The major advantages of the present analysis

Notes

method, besides its sensitivity, are, however, reflected by the

The authors declare no competing financial interest.

■

relative fast detection time (3 h) and the lack for need of sophisticated manipulation and readout instrumentation. This

ACKNOWLEDGMENTS

This research is supported by the Israel Science Foundation.

turns the method as a potential point-of-care sensing platform. 3157

dx.doi.org/10.1021/ac5000152 | Anal. Chem. 2014, 86, 3153−3158

Analytical Chemistry

■

Article

REFERENCES

(1) Su, K. H.; Wei, Q. H.; Zhang, X.; Mock, J. J.; Smith, D. R.; Schultz, S. Nano Lett. 2003, 3, 1087−1090. (2) Ghosh, S. K.; Pal, T. Chem. Rev. 2007, 107, 4797−4862. (3) Boal, A. K.; Ilhan, F.; DeRouchey, J. E.; Thurn-Albrecht, T.; Russell, T. P.; Rotello, V. M. Nature 2000, 404, 746−748. (4) Obare, S. O.; Hollowell, R. E.; Murphy, C. J. Langmuir 2002, 18, 10407−10410. (5) Balogh, D.; Zhang, Z.; Cecconello, A.; Vavra, J.; Severa, L.; Teply, F.; Willner, I. Nano Lett. 2012, 12, 5835−5839. (6) Liu, J.; Mendoza, S.; Román, E.; Lynn, M. J.; Xu, R.; Kaifer, A. E. J. Am. Chem. Soc. 1999, 121, 4304−4305. (7) Otsuka, H.; Akiyama, Y.; Nagasaki, Y.; Kataoka, K. J. Am. Chem. Soc. 2001, 123, 8226−8230. (8) Rosi, N. L.; Mirkin, C. A. Chem. Rev. 2005, 105, 1547−1562. (9) Wang, J.; Wang, L.; Liu, X.; Liang, Z.; Song, S.; Li, W.; Li, G.; Fan, C. Adv. Mater. 2007, 19, 3943−3946. (10) Lee, J. S.; Han, M. S.; Mirkin, C. A. Angew. Chem. Int. Ed. 2007, 46, 4093−4106. (11) Liu, J.; Lu, Y. J. Am. Chem. Soc. 2003, 125, 6642−6643. (12) Moyzis, R. K.; Buckingham, J. M.; Cram, L. S.; Dani, M.; Deaven, L. L.; Jones, M. D.; Meyne, J.; Ratcliff, R. L.; Wu, J. R. Proc. Natl. Acad. Sci. U. S. A. 1988, 85, 6622−6626. (13) Hahn, W. C.; Stewart, S. A.; Brooks, M. W.; York, S. G.; Eaton, E.; Kurachi, A.; Beijersbergen, R. L.; Knoll, J. H.; Meyerson, M.; Weinberg, R. A. Nat. Med. 1999, 5, 1164−1170. (14) Makarov, V. L.; Hirose, Y.; Langmore, J. P. Cell 1997, 88, 657− 666. (15) Bryan, T. M.; Cech, T. R. Curr. Opin. Cell Biol. 1999, 11, 318− 324. (16) Shay, J. W.; Bacchetti, S. Eur. J. Cancer 1997, 33, 787−791. (17) Kim, N. W. Eur. J. Cancer 1997, 33, 781−786. (18) Morin, G. B. Cell 1989, 59, 521−529. (19) Kim, N. W.; Piatyszek, M. A.; Prowse, K. R.; Harley, C. B.; West, M. D.; Ho, P. L.; Coviello, G. M.; Wright, W. E.; Weinrich, S. L.; Shay, J. W. Science 1994, 266, 2011−2015. (20) Sato, S.; Kondo, H.; Nojima, T.; Takenaka, S. Anal. Chem. 2005, 77, 7304−7309. (21) Li, Y.; Liu, B.; Li, X.; Wei, Q. Biosens. Bioelectron. 2010, 25, 2543−2547. (22) Sharon, E.; Freeman, R.; Riskin, M.; Gil, N.; Tzfati, Y.; Willner, I. Anal. Chem. 2010, 82, 8390−8397. (23) Patolsky, F.; Gill, R.; Weizmann, Y.; Mokari, T.; Banin, U.; Willner, I. J. Am. Chem. Soc. 2003, 125, 13918−13919. (24) Xiao, Q.; Shang, F.; Xu, X.; Li, Q.; Lu, C.; Lin, J. M. Biosens. Bioelectron. 2011, 30, 211−215. (25) Lu, C.-H.; Wang, Y.-W.; Ye, S.-L.; Chen, G.-N.; Yang, H.-H. NPG Asia Mater. 2012, 4, 1−7. (26) Wang, F.; Liu, X.; Lu, C.-H.; Willner, I. ACS Nano 2013, 7, 7278−7286. (27) Golub, E.; Freeman, R.; Willner, I. Anal. Chem. 2013, 85, 12126−12133. (28) Freeman, R.; Sharon, E.; Teller, C.; Henning, A.; Tzfati, Y.; Willner, I. ChemBioChem 2010, 11, 2362−2367. (29) Turkevich, J.; Stevenson, P. C.; Hillier, J. Discuss. Faraday Soc. 1951, 11, 55−75. (30) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2004, 126, 7430−7431. (31) Zhang, Z.; Sharon, E.; Freeman, R.; Liu, X.; Willner, I. Anal. Chem. 2012, 84, 4789−4797. (32) Yi, Z.; Wang, H.-B.; Chen, K.; Gao, Q.; Tang, H.; Yu, R.-Q.; Chu, X. Biosens. Bioelectron. 2014, 53, 310−315. (33) Yang, W.; Zhu, X.; Liu, Q.; Lin, Z.; Qiu, B.; Chen, G. Chem. Commun. 2011, 47, 3129−3131. (34) Zhang, Z.; Wu, L.; Wang, J.; Rena, J.; Qu, X. Chem. Commun. 2013, 49, 9986−9988.

3158

dx.doi.org/10.1021/ac5000152 | Anal. Chem. 2014, 86, 3153−3158