Genetic Code Expansion of the Silkworm Bombyx mori to

Letter pubs.acs.org/synthbio

Cite This: ACS Synth. Biol. XXXX, XXX, XXX−XXX

Genetic Code Expansion of the Silkworm Bombyx mori to Functionalize Silk Fiber Hidetoshi Teramoto,*,†,§ Yoshimi Amano,‡,§ Fumie Iraha,‡ Katsura Kojima,† Takuhiro Ito,‡ and Kensaku Sakamoto*,‡ †

Division of Biotechnology, Institute of Agrobiological Sciences, National Agriculture and Food Research Organization (NARO), 1-2 Owashi, Tsukuba, Ibaraki 305-0035, Japan ‡ Division of Structural and Synthetic Biology, RIKEN Center for Life Science Technologies, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan S Supporting Information *

ABSTRACT: The genetic code in bacteria and animal cells has been expanded to incorporate novel amino acids into proteins. Recent efforts have enabled genetic code expansion in nematodes, flies, and mice, whereas such engineering is rare with industrially useful animals. In the present study, we engineered the silkworm Bombyx mori to synthesize silk fiber functionalized with azidophenylalanine. For this purpose, we developed a bacterial system to screen for B. mori phenylalanyl-tRNA synthetases with altered amino-acid specificity. We created four transgenic B. mori lines expressing the selected synthetase variants in silk glands, and found that two of them supported the efficient in vivo incorporation of azidophenylalanine into silk fiber. The obtained silk was bio-orthogonally reactive with fluorescent molecules. The results showed that genetic code expansion in an industrial animal can be facilitated by prior bacterial selection, to accelerate the development of silk fiber with novel properties. KEYWORDS: azidophenylalanine, Bombyx mori silk, click chemistry, genetic code expansion, phenylalanyl-tRNA synthetase, synthetic amino acid

S

site-specificity in replacement is less important than the proportion of incorporated synthetic amino acids for functionalizing the fiber. The amino-acid specificity of B. mori phenylalanyl-tRNA synthetase (BmPheRS) was previously modified,17,18 on the basis of knowledge of yeast and bacterial PheRS.19−22 The BmPheRS variants were expressed in the posterior silk glands of B. mori larvae, and examined for their ability to replace phenylalanine with 4-chloro-, 4-bromo-, and 4-azido-L-phenylalanines in silk fibroin.23,24 The azido derivative AzPhe (Figure 1) was found to be incorporated much less efficiently than the others, which prompted us to develop new variants for AzPhe. Azido groups function as selective chemical handles for bio-orthogonal modifications,25,26 and thus would enhance the utility of silk fibroin for industrial and biomedical applications. The knowledge from other PheRS species appeared to be insufficient, and thus a method was needed for directly evaluating BmPheRS variants. We therefore tried to develop a bacterial screening system, because creating transgenic silkworms is laborious and not applicable for sifting a large number of variants. Our experimental strategy is shown in Figure 1.

ilk is one of the proteins supporting the extracellular structures of organisms, and has the advantageous properties of mechanical toughness, elasticity, biocompatibility, and biodegradability.1,2 Silkworm cocoons and spider silk are thus a promising biobased material for industrial and biomedical applications.3,4 Spiders are not domesticated due to their cannibalistic nature, making it necessary to use heterogeneous hosts, such as bacteria, for synthesizing silk protein and then find a way to spin it into fiber.5,6 The silkworm Bombyx mori has been domesticated for thousands of years, and the annual production of raw silk fiber from B. mori reached 200 thousand tons in 2015.7 The genetic traits of this animal have been modified by transposon-based gene transfer8 and genome editing,9 enabling the production of engineered silk in the native spun form.10−13 We sought to extend this series of genetic modifications by subjecting B. mori to genetic code expansion, a process that relies on the development of aminoacyl-tRNA synthetases capable of attaching synthetic amino acids to tRNA.14−16 Phenylalanine is a minor component of silk fibroin (35 residues in 5487 total amino acids; see Figure S1), rarely occurring in the structurally important crystalline domains, and thus a potential target to be replaced with synthetic derivatives; random replacements of phenylalanine and subsequent chemical modification would not destroy the native structure of silk fibroin. Silk fiber is a huge protein assembly, and accurate © XXXX American Chemical Society

Received: December 5, 2017

A

DOI: 10.1021/acssynbio.7b00437 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Letter

ACS Synthetic Biology

Figure 1. Experimental steps for genetic code expansion in B. mori. A pool of BmPheRS variant genes was introduced into E. coli cells, to be screened for AzPhe-recognizing variants by growth inhibition assays. Selected BmPheRS variants were examined for possible adverse effects in B. mori cultured cells, and only safe variants were finally expressed in the silk glands of transgenic B. mori larvae to produce azido-functionalized cocoon silk.

PheRS consists of two polypeptides, and the α-subunit contains the L-phenylalanine binding pocket. BmPheRS has high sequence homology with human PheRS (65% identity) (Figure S2). We refined the structure of the pocket in the crystal structure of human PheRS (PDB ID: 3L4G),27 to remove an unlikely steric hindrance occurring between the bound substrate and pocket residues in the reported structure. We noticed an important difference from the structure of Thermus thermophilus PheRS, which was the structure used to design the previous modifications of Escherichia coli, yeast, and B. mori PheRSs.17−21 Two residues, Val261 and Ala314, of T. thermophilus PheRS form a “wall” restricting a substitution at the para position of the bound phenyl ring,20,21 whereas this position is located in the vicinity of three residues (Thr413, Ala456, and Phe438) in human PheRS (Figure 2, left), with the

observation indicated that BmPheRS in an active form can be expressed in E. coli, and it can recognize the yeast tRNA efficiently. A variant with the Thr407Ala substitution (Figure 2, right), which we previously found to recognize halogenated phenylalanines,18 also conferred the resistance, even when none of these derivatives was supplemented. This finding indicated that this variant retained an activity with phenylalanine, and thus the binding pocket enlarged with T407A does not restrict the binding of the native substrate. Thus, the amber suppression could not be used for detecting the activity of a variant toward derivatives. Therefore, we based our bacterial screening system on growth inhibition due to AzPhe incorporated in the bacterial proteome. BmPheRS variants were coexpressed in E. coli cells, together with yeast tRNAPhe, for incorporating AzPhe in place of phenylalanine. Random replacements in endogenous proteins with noncanonical amino acids reportedly inhibited bacterial growth.19,28 We measured a reduction in the density of an overnight culture fed in a synthetic growth medium supplemented with AzPhe. All 19 of the possible substitutions for Phe432 were examined, and significant degrees of growth inhibition were observed for the substitutions with Ala, Val, Thr, and Cys (Figure S4). This result supported our refined model that predicted the involvement of position 432 in substrate selection. These favorable substitutions probably each create a space large enough for accommodating an azido group at the para position (Figure 2, middle). We then examined these 19 possible replacements in combination with Gly and Ala substitutions at position 407 (Figure S4), because Thr407 also limits space near the azido group. Finally, out of the 59 examined variants, we chose four variants with two single substitutions (V432 and A432) and two double substitutions (A407/V432 and A407/M432), for further experiments. The A432 variant was not among the most inhibitory variants, but had a similar substitution with the most inhibitory V432 variant, and was thought worth comparing with it. The previously reported G407 and A407 variants were also shown to incorporate AzPhe in the inhibition assay. We noted that any modification at the amino-acid binding site could allow a promiscuous incorporation of amino acids into proteins, thus causing a fatal effect in host cells. Therefore, prior to the in vivo experiments, we expressed the four selected variants in B. mori cultured cells to check their toxicity, and found that none of them caused serious effects (Figure S5). Finally, we stably

Figure 2. Part of the structures of the phenylalanine-binding pocket of the wild-type human PheRS (crystal structure) and its variants (structure models). The three residues in the vicinity of the para position of the phenyl ring are shown in these space-filled renderings. The bound phenylalanine is shown with its carbons in yellow. The corresponding positions in BmPheRS are indicated in parentheses. Phe438 is replaced with Val (middle), and Thr413 is replaced with Ala (right) in the structure models of the PheRS variants.

first two of these residues corresponding to the bacterial residues. The third residue, corresponding to Phe432 in BmPheRS, was not previously examined for involvement in the substrate selection. In the present study, we tested the activity of BmPheRS in E. coli cells by pairing it with an amber suppressor tRNA derived from yeast tRNAPhe (Figure S3),20,21 because this eukaryotic tRNA reportedly exhibited little background activity to translate UAG. We found that BmPheRS supported the readthrough of an in-frame UAG codon in the chloramphenicol acetyltransferase gene, and conferred the antibiotic resistance onto E. coli host cells, when the yeast suppressor tRNA was coexpressed (data not shown). This B


Letter

ACS Synthetic Biology expressed the variants (V432, A432, A407/V432, and A407/ M432) under the control of a posterior-silk-gland-specific promoter, to create the B. mori transgenic lines H06, H07, H08, and H09, respectively. Each line included multiple individual silkworms, and we experimented with a set of three silkworms for each line. The fifth instar larvae were fed with AzPhe, to examine the yield of silk fibroin and the incorporation of AzPhe (Figures S6 and S7). Phenylalanine is an essential amino acid for B. mori, and AzPhe is taken up together with phenylalanine in the silkworm diet. AzPhe content of 0.1% (w/w) in the dried diet supported better incorporation in H06 and H07 than the other two lines and the previous H03 line, which expressed the A407 variant (Figure S6). The incorporation rates were estimated by mass spectrometric analyses, on the basis of the relative intensities of peptides from silk fibroin obtained from cocoons. The AzPhe content in the diet was then varied for H06 and H07 (Figure S7); the content of 0.05% gave the best balance between AzPhe incorporation and fibroin production. AzPhe was substituted for over 6% of the phenylalanine in silk fibroin, resulting in fibroin yields comparable to those in the H03 line (Table 1).24

Figure 3. Click reaction of azido-functionalized silk fibroin with fluorescent compounds. Fibroin heavy chain (FibH) and light chain (FibL) derived from H03, H06, and H07 cocoons were reacted with sulforhodamine B DBCO (red fluorescence) or carboxyrhodamine 110 DBCO (green fluorescence). The proteins were separated by SDSPAGE and their fluorescence was detected (panels marked by FL). The same gel was stained with CBB. Raw data without trimming are shown in Figure S9.

Table 1. Yields of Azido-Functionalized Silk Fibroin from the Transgenic Silkworms line

BmPheRS variant

AzPhe (wt % in dry diet)

replacement of Phe to AzPhe (%)a

weight of fibroin/larva (mg)

H03

A407

0.1

1.4 ± 0.2

107.7 ± 7.2

H06

V432

0.05

6.6 ± 1.2

102.0 ± 6.7

H07

A432

0.05

6.8 ± 1.6

80.2 ± 6.7

for silk engineering in B. mori. Although azido-containing amino acids are toxic to cells at high concentrations in the diet, the content of 0.05% applied for H06 and H07 was quite within the safe range for AzPhe.24 Therefore, the incorporation rate of AzPhe in silk fibroin was limited in these lines, due to the structural and functional impairment of target or endogenous proteins into which AzPhe was incorporated at high levels. Thus, the engineering of new BmPheRS variants allowed us to reach this inherent limit to the AzPhe rate in silk. The engineering scheme developed herein will facilitate genetic code expansion in B. mori, and accelerate the engineering of silk fiber with useful properties for applications in the fields of textile, biomaterials, and medical treatments.

source Figure S6 Figure S7 Figure S7

a

Estimated from MALDI-TOF-MS data under the assumption that the ionization efficiencies of the AzPhe-containing peptide and its parental peptide are identical.

■

Although a higher AzPhe content (0.1%) further increased the proportion of AzPhe, it also greatly reduced fibroin yield, probably due to the adverse effects of AzPhe being incorporated in silk fibroin or endogenous proteins (Figure S7). Silk fibroin from the H06 and H07-derived cocoons was more strongly labeled with fluorescent compounds by click chemistry reaction than the H03-derived silk fibroin (Figure 3). As compared with the H03-line silkworms, the H06 and H07 lines achieved a nearly 5-fold higher AzPhe proportion in silk fibroin with half the AzPhe content in the diet (Table 1). These variants each contained a single substitution, and exhibited better performance than those with double substitutions. The silkworm H08 with BmPheRS(A407/V432) showed a poor yield of silk fibroin (Figure S6), and the misincorporation of Trp in place of Phe was detected (Figure S8). This double substitution probably enlarged the amino-acid binding pocket to a size that allowed the promiscuous recognition of Trp, AzPhe, and Phe. BmPheRS(A407/M432), expressed in H09, caused only slightly stronger growth inhibition in the bacterial assay than BmPheRS(A407), which was consistent with the resulting similar levels of AzPhe incorporation and fibroin production between the H09 and H03 silkworms (Figure S6), and indicated the neutrality of the M432 substitution. The “residue-specific” manner for genetic code expansion is a facile method to achieve the multiple incorporations of synthetic amino acids into target proteins,15 and was suitable

METHODS Materials and Animals. All chemicals used in this study were of reagent grade and used as received. M9 minimal Medium Salts Premix was from MP Biomedicals (Santa Ana, CA). 100-fold concentrated Kao and Michayluk Vitamin Solution was purchased from Sigma-Aldrich (St. Louis, MO). 4-Azido-L-phenylalanine (AzPhe) was from Watanabe Chemical Industries (Hiroshima, Japan). To avoid photolysis of AzPhe, all experiments involving AzPhe and AzPhe-containing silk fibroin were conducted under LED lighting. LB broth (Miller) and cellulose powder were from Nacalai Tesque (Kyoto, Japan). Sulforhodamine B DBCO and carboxyrhodamine 110 DBCO were from Click Chemistry Tools (Scottsdale, AZ). A B. mori strain, MCS601, which has been maintained in the Transgenic Silkworm Research Unit at the Institute of Agrobiological Sciences, NARO, was used for germline transformation. B. mori larvae were reared on an artificial diet (SilkMate PS) (Nosan Corporation, Yokohama, Japan) at 22−26 °C. Structure Refinement and Model Building. The coordinate and structural factors of phenylalanine-bound human PheRS were obtained from the PDB database (PDB ID: 3L4G), and the structure was further refined using the program phenix.refine.29 On the basis of the refined structure, C


Letter


Corporation) at a ratio of 0.01%, 0.02%, 0.05%, 0.1%, or 0.5% (w/w). Cellulose powder was added to normalize the dry weight among different conditions. Deionized water of 2.6 units of volume per unit weight of dry diet was added and heated for 1 h at 50 °C with gentle shaking to make uniform slurries. The slurries were heated for 5 min at 95 °C in an autoclave and stored in a refrigerator until use. At the third day of fifth instar, groups of three male larvae with similar average body weights were selected for each experimental condition. The AzPhemixed diet was administered once a day to three male larvae from the third day of fifth instar. When the average body weights of three larvae stopped increasing, each larva was individually transferred into a handmade paper box to allow it to start cocooning (at the seventh day in most cases). Urea Degumming. The amounts of fibroin in cocoons were calculated by estimating the proportion of the coating protein sericin by a urea degumming method as reported previously.23 Briefly, aliquots of cocoons were heated in a degumming solution (8 M urea, 40 mM Tris-SO4 (pH 7)) at 80 °C for 10 min followed by washing with deionized water and then dried. The weights of fibroin in the cocoons were calculated from the weight loss by urea degumming. In-Gel Digestion and Mass Analysis. Small pieces of cocoons were dissolved in 8 M LiBr solution at 35 °C at a concentration of 50 μg/μL. The dissolved solutions were used for in-gel digestion of fibroin light chain followed by MALDITOF-MS analysis as previously reported.23 Click Reaction. Dried cocoon shells were incubated overnight with 5 μM sulforhodamine B DBCO or carboxyrhodamine 110 DBCO in 50 mM Tris-HCl (pH 8) and 50% (v/v) DMSO at room temperature. The cocoon shells were washed three times with DMSO with shaking at 50 °C, rinsed with deionized water, and air-dried at 25 °C. The fluorescence of the cocoons was recorded on a TL-2000 UV illuminator (UVP, Upland, CA) with a digital camera. Aliquots of the urea-degummed cocoons were dissolved in 8 M LiBr solution at 35 °C at a concentration of 25 μg/μL, and 5 μL of each of the solutions was mixed with 45 μL of the reaction premix (40 μL 10 M urea, 2.5 μL 1 M Tris-HCl (pH 8), 0.25 μL 5 mM sulforhodamine B DBCO or carboxyrhodamine 110 DBCO, and 2.25 μL deionized water) in 0.5 mL centrifuge tubes. The reaction mixtures were incubated overnight at room temperature. After the reaction, each reaction mixture was mixed with 6 × SDS-PAGE sample buffer containing reducing agent (Nacalai Tesque) and incubated for 15 min at 50 °C. Each of the above sample mixtures was subjected to SDS-PAGE on a 4−15% Mini-PROTEAN TGX precast gel (Bio-Rad) at a constant voltage of 100 V. The gel was washed in deionized water and its fluorescence signal was recorded with a Fusion FX7 imaging system (Vilber, Collégien, France). The same gel was then stained with Bio-Safe CBB stain (Bio-Rad) and recorded with the same imaging system.

the coordinates of AzPhe bound variants were modeled with the program Coot,30 and the resultant models were regularized using the program phenix.dynamics. The cif file of AzPhe was made on the PRODRG server.31 The molecular graphics were prepared with the program PyMol (Schrodinger, Cambridge, MA). Growth Inhibition Assay. The encoding sequence of the used yeast tRNA was: 5′- GCGGATTTAGCTCAGTTGGGAGAGCGCCATACTGAAGATGTGGAGGTCCTGTGTTCGATCCACAGAATTCGCACCA-3′. BmPheRS and this tRNA were expressed from a kanamycin-resistant plasmid derived from pACYC184, under the control of the tyrS and lpp promoters, respectively, in the E. coli strain MV1184. The transformed cells were grown at 37 °C in LB medium containing the antibiotic at a concentration of 30 mg/L. Aliquots of the overnight culture were cultivated in synthetic media with or without AzPhe supplementation (no phenylalanine was added in either case). A 4 mM AzPhe solution was prepared in 10 mM HCl, neutralized with equimolar NaOH, and added to the synthetic media at a final concentration of 2 mM. The synthetic medium contained M9 minimal medium salts (48 mM Na2HPO4, 22 mM KH2PO4, 9 mM NaCl, 19 mM NH4Cl), 1 mM MgSO4, 0.5% (w/v) glycerol, a 200-fold diluted Kao and Michayluk Vitamin solution and 30 mg/L kanamycin. After a further incubation for 15−18 h, the optimal density of the culture was measured to determine the level of the reduction in the density of the culture with AzPhe, relative to that of the culture with no AzPhe. Cell Culture Assay. BmN cells were cultured in Grace medium and seeded in 25 cm2 culture flasks (1.5 × 106 cells/ flask). The cells were transfected with the plasmid vectors expressing the wild-type or one of the variants of the α-subunit of BmPheRS (1.5 μg/flask) and the wild-type β-subunit of BmPheRS (1.5 μg/flask) and EGFP (3 μg/flask) under a serum-free condition using HilyMax transfection reagent (24 μL/flask) (Dojindo, Tokyo). After overnight transfection, the medium was exchanged with fresh medium supplemented with 10% FBS. The transfected cells were cultured for 8 days at 26 °C with two medium changes on the second and fifth days. The cells were then harvested and lysed in Buffer W (100 mM TrisHCl pH 8, 150 mM NaCl, 1 mM EDTA) supplemented with 1% (v/v) Igepal CA-630 by 10 min incubation on ice. The cleared lysates obtained after centrifugation (9500g, 4 °C, 15 min) were purified under a native condition by using StrepTactin spin columns (IBA). Five microliters of the affinitypurified EGFP eluted with 50 μL of Buffer BE (100 mM TrisHCl pH 8, 150 mM NaCl, 1 mM EDTA, 2 mM D-biotin) was subjected to SDS-PAGE. Electrophoresis was performed by standard techniques using 4−15% Mini-PROTEAN TGX precast gels (Bio-Rad, Hercules, CA) at a constant voltage of 200 V. Separated proteins were stained with EzStain AQua (ATTO, Tokyo). Germline Transformation. Construction of the piggyBac plasmid vector, pBac[3 × P3-DsRed2afm]-BmPheRS_α_V432, pBac[3 × P3-DsRed2afm]-BmPheRS_α_A432, pBac[3 × P3DsRed2afm]-BmPheRS_α_A407/V432, and pBac[3 × P3DsRed2afm]-BmPheRS_α_A407/M432 encoding the V432, A432, A407/V432, and A407/M432 variants of the BmPheRS α-subunit, and germline transformation of B. mori were performed as described previously.23 The established transgenic lines were designated H06, H07, H08, and H09, respectively. Production of AzPhe-Containing Silk Fibroin. AzPhe was mixed with SilkMate PM (dried form) (Nosan

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.7b00437. Figure S1: Schematic structure of the B. mori silk fibroin; Figure S2: Sequence alignment of PheRS α-subunits; Figure S3: Sequence alignment of the genes encoding Bm tRNAPhe (Bm) and yeast tRNAPhe; Figure S4: Growth inhibition of E. coli by BmPheRS variants; Figure D


Letter


■

(10) Kuwana, Y., Sezutsu, H., Nakajima, K., Tamada, Y., and Kojima, K. (2014) High-toughness silk produced by a transgenic silkworm expressing spider (Araneus ventricosus) dragline silk protein. PLoS One 9, e105325. (11) Teulé, F., Miao, Y., Sohn, B., Kim, Y., Hull, J. J., Fraser, M. J., Lewis, R. V., and Jarvis, D. L. (2012) Silkworms transformed with chimeric silkworm/spider silk genes spin composite silk fibers with improved mechanical properties. Proc. Natl. Acad. Sci. U. S. A. 109, 923−928. (12) Iizuka, T., Sezutsu, H., Tatematsu, K., Kobayashi, I., Yonemura, N., Uchino, K., Nakajima, K., Kojima, K., Takabayashi, C., Machii, H., Yamada, K., Kurihara, H., Asakura, T., Nakazawa, Y., Miyawaki, A., Karasawa, S., Kobayashi, H., Yamaguchi, J., Kuwabara, N., Nakamura, T., Yoshii, K., and Tamura, T. (2013) Colored fluorescent silk made by transgenic silkworms. Adv. Funct. Mater. 23, 5232−5239. (13) Kambe, Y., Kojima, K., Tamada, Y., Tomita, N., and Kameda, T. (2016) Silk fibroin sponges with cell growth-promoting activity induced by genetically fused basic fibroblast growth factor. J. Biomed. Mater. Res., Part A 104, 82−93. (14) Liu, C. C., and Schultz, P. G. (2010) Adding new chemistries to the genetic code. Annu. Rev. Biochem. 79, 413−444. (15) Johnson, J. A., Lu, Y. Y., Van Deventer, J. A., and Tirrell, D. A. (2010) Residue-specific incorporation of non-canonical amino acids into proteins: Recent developments and applications. Curr. Opin. Chem. Biol. 14, 774−780. (16) Mukai, T., Lajoie, M. J., Englert, M., and Söll, D. (2017) Rewriting the genetic code. Annu. Rev. Microbiol. 71, 557−577. (17) Teramoto, H., and Kojima, K. (2010) Cloning of Bombyx mori phenylalanyl-tRNA synthetase and the generation of its mutant with relaxed amino acid specificity. J. Insect Biotechnol. Sericol. 79, 53−65. (18) Teramoto, H., and Kojima, K. (2013) Residue-specific incorporation of phenylalanine analogues into protein biosynthesis in silkworm cultured cells. J. Insect Biotechnol. Sericol. 82, 61−69. (19) Kast, P., and Hennecke, H. (1991) Amino acid substrate specificity of Escherichia coli phenylalanyl-tRNA synthetase altered by distinct mutations. J. Mol. Biol. 222, 99−124. (20) Datta, D., Wang, P., Carrico, I. S., Mayo, S. L., and Tirrell, D. A. (2002) A designed phenylalanyl-tRNA synthetase variant allows efficient in vivo incorporation of aryl ketone functionality into proteins. J. Am. Chem. Soc. 124, 5652−5653. (21) Kwon, I., Wang, P., and Tirrell, D. A. (2006) Design of a bacterial host for site-specific incorporation of p-bromophenylalanine into recombinant proteins. J. Am. Chem. Soc. 128, 11778−11783. (22) Fishman, R., Ankilova, V., Moor, N., and Safro, M. (2001) Structure at 2.6 Å resolution of phenylalanyl-tRNA synthetase complexed with phenylalanyl-adenylate in the presence of manganese. Acta Crystallogr., Sect. D: Biol. Crystallogr. 57, 1534−1544. (23) Teramoto, H., and Kojima, K. (2014) Production of Bombyx mori silk fibroin incorporated with unnatural amino acids. Biomacromolecules 15, 2682−2690. (24) Teramoto, H., Nakajima, K., and Kojima, K. (2016) Azideincorporated clickable silk fibroin materials with the ability to photopattern. ACS Biomater. Sci. Eng. 2, 251−258. (25) Lang, K., and Chin, J. W. (2014) Bioorthogonal reactions for labeling proteins. ACS Chem. Biol. 9, 16−20. (26) Patterson, D. M., Nazarova, L. A., and Prescher, J. A. (2014) Finding the right (bioorthogonal) chemistry. ACS Chem. Biol. 9, 592− 605. (27) Finarov, I., Moor, N., Kessler, N., Klipcan, L., and Safro, M. G. (2010) Structure of human cytosolic phenylalanyl-tRNA synthetase: Evidence for kingdom-specific design of the active sites and tRNA binding patterns. Structure 18, 343−353. (28) Iraha, F., Oki, K., Kobayashi, T., Ohno, S., Yokogawa, T., Nishikawa, K., Yokoyama, S., and Sakamoto, K. (2010) Functional replacement of the endogenous tyrosyl-tRNA synthetase−tRNATyr pair by the archaeal tyrosine pair in Escherichia coli for genetic code expansion. Nucleic Acids Res. 38, 3682−3691. (29) Afonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A.,

S5: Screening of BmPheRS variants in B. mori-cultured BmN cells; Figure S6: Comparison of the production of AzPhe-containing silk fibroin between the new transgenic lines and previous H03 line; Figure S7: Production of AzPhe-containing silk fibroin by H06 and H07 on diets containing varied amounts of AzPhe; Figure S8: Misincorporation of tryptophan in H08 line; Figure S9: Click reaction of azido-functionalized silk fibroin with fluorescent compounds; Figure S10: H06 cocoons reacted with fluorescent compounds (PDF)

AUTHOR INFORMATION

Corresponding Authors

*E-mail: teramoto@affrc.go.jp. *E-mail: [email protected]. ORCID

Hidetoshi Teramoto: 0000-0002-2075-0218 Author Contributions §

H.T. and Y.A. contributed equally to this work. H.T. and K.S. designed the experiments. H.T., Y.A., F.I., K.K., and T.I. performed the experiments. H.T., Y.A., T.I., and K.S. analyzed the data. H.T., Y.A., and K.S. wrote the manuscript. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grants for Scientific Research (B) (26291035) to K.S. and Scientific Research (C) (15K07800) to H.T. from the Japan Society for the Promotion of Science (JSPS). H.T. thanks the Transgenic Silkworm Research Unit at NARO for providing silkworm eggs and Dr. Q. Zhang and Ms. Y. Tian for their technical assistance.

■

REFERENCES

(1) Ebrahimi, D., Tokareva, O., Rim, N. G., Wong, J. Y., Kaplan, D. L., and Buehler, M. J. (2015) Silk−its mysteries, how it is made, and how it is used. ACS Biomater. Sci. Eng. 1, 864−876. (2) Omenetto, F. G., and Kaplan, D. L. (2010) New opportunities for an ancient material. Science 329, 528−531. (3) Li, G., Li, Y., Chen, G., He, J., Han, Y., Wang, X., and Kaplan, D. L. (2015) Silk-based biomaterials in biomedical textiles and fiber-based implants. Adv. Healthcare Mater. 4, 1134−1151. (4) Leal-Egaña, A., and Scheibel, T. (2010) Silk-based materials for biomedical applications. Biotechnol. Appl. Biochem. 55, 155−167. (5) Andersson, M., Jia, Q., Abella, A., Lee, X. Y., Landreh, M., Purhonen, P., Hebert, H., Tenje, M., Robinson, C. V., Meng, Q., Plaza, G. R., Johansson, J., and Rising, A. (2017) Biomimetic spinning of artificial spider silk from a chimeric minispidroin. Nat. Chem. Biol. 13, 262−264. (6) Xia, X.-X., Qian, Z.-G., Ki, C. S., Park, Y. H., Kaplan, D. L., and Lee, S. Y. (2010) Native-sized recombinant spider silk protein produced in metabolically engineered Escherichia coli results in a strong fiber. Proc. Natl. Acad. Sci. U. S. A. 107, 14059−14063. (7) International Sericultural Commission. Global Silk Production. http://inserco.org/en/statistics (accessed Jan 24, 2018). (8) Tamura, T., Thibert, C., Royer, C., Kanda, T., Abraham, E., Kamba, M., Komoto, N., Thomas, J. L., Mauchamp, B., Chavancy, G., Shirk, P., Fraser, M., Prudhomme, J. C., and Couble, P. (2000) Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector. Nat. Biotechnol. 18, 81−84. (9) Tsubota, T., and Sezutsu, H. (2017) Genome editing of silkworms, In Genome Editing in Animals: Methods and Protocols (Hatada, I., Ed.), pp 205−218, Springer, New York, NY. E


Letter

ACS Synthetic Biology Zwart, P. H., and Adams, P. D. (2012) Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr., Sect. D: Biol. Crystallogr. D68, 352−367. (30) Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Features and development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. D66, 486−501. (31) Schuttelkopf, A. W., and van Aalten, D. M. F. (2004) Prodrg: A tool for high-throughput crystallography of protein-ligand complexes. Acta Crystallogr., Sect. D: Biol. Crystallogr. D60, 1355−1363.

F


Genetic Code Expansion of the Silkworm Bombyx mori to

Recommend Documents