Ginsenoside 25-OCH3-PPD Promotes Activity of LXRs To Ameliorate

Article Cite This: J. Agric. Food Chem. 2018, 66, 7023−7035

pubs.acs.org/JAFC

Ginsenoside 25-OCH3‑PPD Promotes Activity of LXRs To Ameliorate P2X7R-Mediated NLRP3 Inflammasome in the Development of Hepatic Fibrosis Xin Han,† Jian Song,† Li-Hua Lian,† You-Li Yao,† Dan-Yang Shao,† Ying Fan,† Li-Shuang Hou,† Ge Wang,† Shuang Zheng,† Yan-Ling Wu,*,† and Ji-Xing Nan*,†,‡

Downloaded via DURHAM UNIV on July 13, 2018 at 09:54:50 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

Key Laboratory for Natural Resource of ChangBai Mountain & Functional Molecules, Ministry of Education, College of Pharmacy, Yanbian University, Yanji, Jilin Province 133002, China ‡ Clinical Research Center, Affiliated Hospital of Yanbian University, Yanji, Jilin Province 133002, China ABSTRACT: Ginseng is widely used in energy drinks, dietary supplements, and herbal medicines, and its pharmacological actions are related with energy metabolism. As an important modulating energy metabolism pathway, liver X receptors (LXRs) can promote the resolving of hepatic fibrosis and inflammation. The present study aims to evaluate the regulation of 25-OCH3PPD, a ginsenoside isolated from Panax ginseng, against hepatic fibrosis and inflammation in thioacetamide (TAA)-stimulated mice by activating the LXRs pathway. 25-OCH3-PPD decreases serum ALT/AST levels and improves the histological pathology of liver in TAA-induced mice; attenuates transcripts of pro-fibrogenic markers associated with hepatic stellate cell activation; attenuates the levels of pro-Inflammatory cytokines and blocks apoptosis happened in liver; inhibits NLRP3 inflammasome by affecting P2X7R activation; and regulates PI3K/Akt and LKB1/AMPK-SIRT1. 25-OCH3-PPD also facilitates LX25Rs and FXR activities decreased by TAA stimulation. 25-OCH3-PPD also decreases α-SMA via regulation of LXRs and P2X7R-NLRP3 in vitro. Our data suggest the possibility that 25-OCH3-PPD promotes activity of LXRs to ameliorate P2X7R-mediated NLRP3 inflammasome in the development of hepatic fibrosis. KEYWORDS: Ginsenoside 25-OCH3-PPD, hepatic fibrosis, inflammation, LXRs, P2X7R

■

INTRODUCTION As a result of chronic liver disease, hepatic fibrosis presents a dynamic process with excess accumulation of extracellular matrix (ECM) and further leads to cell death and organ dysfunction.1 Excessive fibrogenesis inevitably disrupts hepatic structure and even contributes to cirrhosis and hepatocellular carcinoma.2 Hepatic stellate cells (HSCs), key cells involved in fibrogenesis, transformed from quiescent storing vitamin-A into fibrogenic myofibroblasts once activation, which is a central driver of fibrosis in liver injury.3 During the activation of HSCs in response to profibrogenic stimuli, ECM proteins were produced and deposited with a transcriptional program characterized by augmented expression of collagens and α smooth muscle actin (α-SMA).4 ECM also functions as a pro-inflammatory or pro-fibrogenic mediator.5 Resolution of fibrosis may happen at the same time as senescence, inactivation, or apoptosis of activated HSCs. And the greatly clarified pathways of HSC clearance contribute to the development of novel diagnostics and therapies of hepatic disease; however, these discovered novel pathways or mediators reveal the complexity of HSCs activation in hepatic fibrosis. Especially, extracellular signals from resident or inflammatory cells can further regulate HSCs activation, while the molecular mechanisms of hepatic fibrosis need to be explored in depth, and available treatments for hepatic fibrosis are still limited. Therefore, it is important to discover new targets and develop new drugs in antifibrotic therapy. There is increasing evidence that inflammation contributes to development of hepatic fibrosis.6 In the past decade, © 2018 American Chemical Society

numerous studies have contributed to the progression of hepatic fibrosis increasing the severity of inflammatory activity.6 Among the healing procession, HSCs closely crosstalk with liver-resident cells, including hepatocytes, Kupffer cells, and infiltrating immune cells. These dynamic interactions of HSCs and other liver cells control the activation of HSCs and the balance of hepatic ECM and are further related with the regression of liver fibrosis.6 Hence, understanding the mechanism of inflammation is crucial to excavate the effective remedies for hepatic fibrosis. Inflammation plays a key role for hepatic fibrogenic responses, but inflammatory signaling pathways are relatively less considered as targets for hepatic fibrosis. The P2X7 receptor (P2X7R) is primarily involved in the inflammation triggered by adenosine triphosphate (ATP) released from damaged cells.7 Indeed, ATP is associated with energy metabolism. In energy metabolism, liver X receptors (LXRs) are activated and then regulate target genes involved in cholesterol and lipid metabolism, such as ATP-binding cassette. We have found that LXRs might be important regulators of inflammation in hepatic fibrosis. And P2X7R also is considered as a key regulator in the development of tissue fibrosis related with exaggerated collagen deposition.8 Therefore, we hypothesized Received: Revised: Accepted: Published: 7023

April 16, 2018 June 21, 2018 June 21, 2018 June 22, 2018 DOI: 10.1021/acs.jafc.8b01982 J. Agric. Food Chem. 2018, 66, 7023−7035

Article

Journal of Agricultural and Food Chemistry

saline; TAA-treated group, received intraperitoneal (i.p.) TAA (100 mg/kg b.w. and three times a week for the first week, and then 200 mg/kg and twice a week for the following 4 weeks); 25-OCH3-PPD + TAA-treated groups, received TAA and 25-OCH3-PPD (5, 10, or 20 mg/kg), respectively; silymarin + TAA-treated group, received TAA and silymarin (100 mg/kg). And silymarin (100 mg/kg) was considered as a positive control.16,17 25-OCH3-PPD and silymarin were intragastrically administrated once per day during animal experiment. All mice were fed ad libitum and water in the experiment. Mice were anesthetized, and blood and liver tissue were collected for biochemical analysis. The liver specimens were prepared for histological and immunohistochemical studies. Some of liver tissues were properly stored at −80 °C for Western blotting or PCR. Cell Cultures. HSC-T6, a rat hepatic stellate cell line, was cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin in a humidified 5% CO2 atmosphere at 37 °C. HSC-T6 cell was cultured in 6-well plates at a density of 1 × 106 per well, and stimulated with TGF-β for 2 h, and then followed with 25-OCH3PPD (1, 5, or 10 μM) for 6 h. The cells were collected, followed with Western blotting or immunofluorescent staining, respectively. Serum Biochemistry Analysis. Blood samples were separated by centrifugation at 3000 rpm for 30 min at 4 °C, followed by collecting and dialyzing the supernatant. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were detected by an Autodry Chemistry Analyzer (SPOTCHEMTM SP4410, Arkray, Kyoto, Japan). Histological Analysis. The livers were fixed with 10% formaldehyde solution for at least 1 week, and then washed and embedded in paraffin for histopathological examination. Liver tissue sections (5 μm) were stained with hematoxylin-eosin staining (H&E). The hepaticological scores were blindly assessed by a professional pathologist. For Masson’s trichrome blue or Sirius Red staining, the sections were deparaffinized in xylene and hydrated in gradient alcohol solution, counterstained with hematoxylin, washed, stained with Masson or Sirius Red staining, and then followed by washing with acetic acid water, ethanol, and xylene and mounted in a resinous medium. Immunohistochemistry was performed on formalin-fixed livers with indicated primary antibodies followed by DAB staining, and counterstaining with hematoxylin. Immunofluorescent histochemistry was performed on frozen sections, with methanol and acetone fixed, followed with indicated primary antibodies, finally labeled by specific fluorescent antibody and observed by microscopy. For Masson, Sirius Red, immunohistochemistry, and immunofluorescent histochemistry staining, the average integrated positive area from 10 randomly regions were calculated by using Image-Pro Plus 5.1 image analysis software. TUNEL Assay. The liver sections were stained according to the manufacturer’s instructions (Beyotime Biotechnology, Shanghai, Jiangsu, China). Briefly, freezing sections were pretreated with 1% formaldehyde at room temperature for 15 min, rinsed in phosphatebuffered saline, and then incubated in 3% hydrogen peroxide for 10 min. Then the sections were incubated in equilibration buffer for 10 s at 4 °C. Washed with phosphate-buffered saline for 3 times, the sections were incubated with 50 μL of TUNEL reaction mixture with terminal deoxynucleotidyl transferase (TdT) for 1 h at 37 °C under humidified conditions. The sections were sealed and analyzed under a phase-contrast Olympus microscope. Western Blotting Analysis. The protein extracted from liver tissue was used for Western blotting analysis. Equivalent proteins were resolved by sodium dodecyl sulfate-polyacrylamid gel electrophoresis (SDS-PAGE). After gel electrophoresis, protein was transferred onto a polyvinylidene fluoride (PVDF) membrane (GE, Freiburg, Germany). Then the membrane was blocked by 5% skim milk for 1 h at room temperature and incubated with specific primary antibodies at 4 °C overnight, and then incubated with HRP-conjugated secondary antibody for 1 h at room temperature and visualized by ECL Detection Reagent (Bio-Rad, Hercules, CA, USA). Each membrane was stripped and cultivated with GAPDH antibody as a loading

that LXRs might regulate inflammation via P2X7R and its mediated inflammasome. In Asian countries, Ginseng is considered as a highly valued herb, and widely used in energy drinks, dietary supplements, and herbal medicines, and exerts a regulation on endocrine, nerves, metabolism, and other physiological functions, without apparent adverse effects from long-term usage.9−11 Ginsenosides are the main active components in ginseng and are believed to contribute to ginseng’s pharmacological actions.10 Generally, the pharmacological actions of ginseng are related with energy metabolism.11,12 25-OCH3-PPD (20(S)-25-methoxyldammarane-3β,12β,20triol) is a ginsenoside isolated from Panax ginseng, which shows anticancer activity against lung, pancreatic, breast, and prostate cancers via MDM2 oncogene and other actions.13,14 Our laboratory has confirmed that 25-OCH3-PPD could alleviate liver injury. Our previous study demonstrated that 25-OCH3-PPD presents a hepatoprotective effect and reversed the activated hepatic stellate cells by regulating c-FLIP pathway-mediated NF-κB activation.15 However, the preliminary results only indicated that 25-OCH3-PPD induced the apoptosis of activated HSCs, which is one of the basic strategies in the prevention or cure of hepatic fibrosis. The progression and reversal of hepatic fibrosis is complicated and related with the liver microenvironments. Also considering the effect of ginseng on energy metabolism, the subsequent study focuses on the antihepatic fibrosis of 25-OCH3-PPD by modulating energy metabolism pathways, such as LXRs, in vivo considering inflammation. Here, we provide in vivo evidence that 25-OCH3-PPD alleviates TAA-induced hepatic fibrosis in mice, and it may be a potential candidate for the treatment of hepatic fibrotic diseases. And we aim to reveal the involved pathway of 25-OCH3-PPD on LXRs, and further regulation on P2X7R-mediated NLRP3 inflammasome.

■

MATERIALS AND METHODS

Materials and Reagents. 25-OCH3-PPD (20(R)-25-methoxyldammarane-3β,12β, 20-triol) was isolated from the total hydrolyzed saponin fraction extracted from Panax ginseng cultivated in China and authenticated by 13C-NMR and MS data, and the purity was determined to be higher than 99.0% by HPLC analysis.15 Anti-α-SMA (ab5694), TIMP-1 (ab61224), MMP-13 (ab75606), F4/80 (ab6640), Lipin-1 (ab181389), GAPDH (ab8245), P2X7R (ab48871), and NLRP-3 (ab4207) were obtained from Abcam (Cambridge, MA, UK). Anti-IL1RI (sc-393998), IL-1β (sc-32294), IL-6 (sc-28343), cFLIP (sc-8347), Bid (sc-11423), Bax (sc-2772), Bcl-2 (sc-7382), caspase-1 (sc-622), caspase-3 (sc-7148), SIRT1 (sc-74504), LXRα (sc-34386), LXRβ (sc-34341), and FXR (sc-4173s) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-Akt (cs9272), p-Akt (cs-9275), PI3K (cs-4275), p-PI3K (cs-4228), LKB1 (cs-3407), p-LKB1 (cs-3482), AMPKα (cs-2532), and p-AMPKα(cs2531) were purchased from Cell Signaling technology (Boston, MA, USA). Horseradish peroxidase (HRP)-conjugated goat antimouse or antirabbit antibodies were purchased from Abcam (Cambridge, MA, UK). The BCA Protein Assay Kit was obtained from Beyotime (Shanghai, Jiangsu, China). TAA and other reagents were obtained from Sigma-Aldrich (St Louis, MO, USA). Animal and Treatment. Male C57BL/6 mice 6−8 weeks of age were obtained from Changchun Yisi Experimental Animal Technology Co., Ltd. (ChangChun, Jilin, China). All animals were housed at Yanbian University animal facility. The animal experiment was handled according to the guidelines and protocols approved by the Institutional Animal Care Committee, and the permission number was 20170708. Mice took food and water freely in 60% relative humidity and 12 h light/dark cycle. Thirty-six mice were randomly divided into six groups: normal group, received the same volume 7024

DOI: 10.1021/acs.jafc.8b01982 J. Agric. Food Chem. 2018, 66, 7023−7035

Article

Journal of Agricultural and Food Chemistry Table 1. RT-PCR Primer Sets Acession No.

Target

NM.007392.2

α-SMA

NM.007742.3

Collagen-I

NM.001044384.1

TIMP-1

NM.008360.1

IL-18

NM.013693.2

TNF-α

NM_001038839.2

P2X7R

NM.008084.2

GAPDH

Genes

Primer Sequences (5′-3′)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CATCAGGGAGTAATGGTTGG CACAATACCAGTTGTACGTC TGAGTCAGCAGATTGAGAAC TACTCG AACGGGAATCCATC GGAAAGCCTCTGTGGATATG AACAGGGAAACACTGTGC GATCAAAGTGCCAGTGAACC AACTCCATCTTGTTGTGTCC TCACACTCAGATCATCTTCTC AGACTCCTCCCAGGTATATG CGAATTATGGCACCGTCAAGT TTCTCCGTCACCTCTGCTATG CTTGTGCAGTGCCAGCC GCCCAATACGGCCAAATCC

Figure 1. 25-OCH3-PPD prevents hepatic injury and hepatic fibrosis in the TAA model. (A) Chemical structure of 25-OCH3-PPD. (B) Serum ALT and AST activities. (C) Liver appearance pictures, Hematoxylin and Eosin (H&E), Masson and Sirius Red stain present in 100 × magnification. The histopathological scores and positive areas were quantified. ###P < 0.001 vs normal group, *P < 0.05, **P < 0.01, ***P < 0.001 vs TAA group, ns, not significant. using primers specific for the genes as described in Table 1. The PCR products were loaded in agarose gel electrophoresis and stained with ethidium bromide. The transcript level was normalized with GAPDH mRNA in the same samples. Statistical Analysis. The values in the experiments present as mean ± SD. GraphPad Prism program (Graphpad Software, Inc., San

control. Quantity One software (Bio-Rad, Hercules, CA, USA) was used to qualify the band intensities. Liver mRNA Isolation and RT-PCR. Total RNA was extracted from liver tissue specimens by using the RNA extraction kit (Promega, Madison, WI, USA). Isolated RNA was reverse-transcribed into complementary DNA (cDNA). And RT-PCR was performed by 7025


Article


Figure 2. 25-OCH3-PPD attenuates pro-fibrogenic cytokines in the TAA model. (A) Representative Western blotting analysis for expressions of αSMA, TIIMP-1, and MMP-13. Densitometric values were normalized against GAPDH. (B) Representative RT-PCR analysis for expressions of αSMA, TIIMP-1, and collagen I. Densitometric values were normalized against GAPDH. (C) Immunohistochemical staining of α-SMA and collagen I present in 100× magnification. The positive areas were quantified. ###P < 0.001 vs normal group, ***P < 0.001 vs TAA group, ns, not significant. Diego, CA, USA) is used to evaluate the comparison of the results by One-way analysis of variance (ANOVA) and Tukey’s multiple comparison tests, and statistical significance between groups is defined as p-value less than 0.05.

■

As shown in Figure 1C, the liver picture of normal mice presented a smooth surface, soft texture, and sharp edges. While the liver in TAA-induced mice showed obvious diffuse nodules on the surface with dark red and varied sizes. The color of the liver tissue around the nodules was deeper, the liver texture was hard, the particles were obvious, and the edges were blunt. With 25-OCH3-PPD or silymarin administration, diffuse nodules were decreased, liver textures were softer, and the particles were reduced. However, silymarin administration showed less change than 25-OCH3-PPD (20 mg/kg). The extent of histopathological damage in mice liver sections was examined by H&E (Figure 1C). In the normal group, hepatic lobule was rule and hepatocyte nuclear was round, while normal lobular architecture was disturbed in TAA group with increased fibrous septa, increased hepatic necrosis, and more infiltration of inflammatory cells. 25-OCH3-PPD or silymarin administrations ameliorated these histological

RESULTS

25-OCH3-PPD Prevents Hepatic Injury and Hepatic Fibrosis in the TAA Model. After TAA exposure for 5 weeks, serum ALT and AST levels were significantly elevated compared with the normal group. And 25-OCH3-PPD administrations significantly decreased serum ALT level compared with the TAA group. 25-OCH3-PPD (10 mg/kg and 20 mg/kg) markedly decreased serum AST level compared with the TAA group (Figure 1B). As a control positive group, silymarin also has a decreasing serum ALT level, but no obviously decreasing serum AST levels (Figure 1B). 7026


Article


Figure 3. 25-OCH3-PPD attenuates the levels of proinflammatory cytokines. (A) Representative Western blotting analysis for expressions of F4/ 80, caspase-1, IL-1β, ASC, IL-1R1, IL-6, and IL-18. Densitometric values were normalized against GAPDH. (B) Representative RT-PCR analysis for expressions of TNF-α and IL-18. Densitometric values were normalized against GAPDH. (C) Immunohistochemical staining of F4/80 present in 100× magnification. The positive areas were quantified. ###P < 0.001 vs normal group, **P < 0.01 and ***P < 0.001 vs TAA group, ns, not significant.

25-OCH3-PPD Attenuates Transcripts of Pro-fibrogenic Cytokines Associated with Hepatic Stellate Cell Activation. To detect the activated myofibroblasts, the expressions of α-SMA, collagen I, TIMP-1, or MMP-13 were detected. The protein and mRNA expressions of α-SMA in the TAA group were significantly increased compared with the normal group, while 25-OCH3-PPD or silymarin administrations obviously decreased compared with the TAA group (Figure 2A, 2B). And the same alternation happened in the mRNA expression of TIMP-1 and collagen I (Figure 2B). TAA significantly increased TIMP-1 and decreased MMP-13 protein expressions compared with the normal group, and 25-OCH3PPD administrations obviously ameliorated these changes caused by TAA, while silymarin showed no obvious regulating in TIMP-1/MMP-13 (Figure 2A). The immunopositivity correlated with the localization of αSMA and type I collagen after 5 weeks of TAA exposure,

changes caused by TAA. The hepaticological scores for liver were blindly assessed by a professional pathologist. The hepaticological score of the TAA group was significantly increased compared with the normal group, and the hepaticological scores of 25-OCH3-PPD and silymarin groups were significantly decreased compared with the TAA group (Figure 1C). Masson and Sirius red staining showed that collagen deposition in the TAA group was visible in the portal area compared with the normal group, while 25-OCH3-PPD or silymarin administrations obviously ameliorated these collagen depositions caused by TAA (Figure 1C). Positive areas of Masson and Sirius red in the TAA group were significantly increased compared with the normal group, and positive areas in 25-OCH3-PPD or silymarin groups were significantly decreased compared with the TAA group (Figure 1C). 7027


Article


Figure 4. 25-OCH3-PPD blocks hepatic apoptosis in TAA-induced mice. (A) Representative Western blotting analysis for expressions of c-FLIP, bid, bcl-2, bax, and caspase-3. Densitometric values were normalized against GAPDH. (B) TUNEL staining present in 100× magnification. The positive areas were quantified. ###P < 0.001 vs normal group, *P < 0.05, **P < 0.01, and ***P < 0.001 vs TAA group.

3B). However, silymarin only significantly decreased TNF-α and had no significance on IL-18. 25-OCH3-PPD Blocks Hepatic Apoptosis in TAAInduced Mice. Apoptosis is one of the most important events and the first cell response in the molecular mechanism of liver damage. Since necrosis often appears after the process of apoptosis, apoptosis plays a very important role for the following formation of necrosis. To explore the mechanism of inhibition of TAA-induced hepatocyte apoptosis by 25-OCH3PPD, we analyzed the expression of several molecules related to TAA-induced apoptotic pathways. Bcl-2 family and caspase family are all important apoptosis factors. With TAA exposure, the expressions of c-FLIPS, bid, and cleaved caspase-3 were significantly increased compared with the normal group, while 25-OCH3-PPD administration significantly decreased the expressions of c-FLIPS, bid, and cleaved caspase-3 compared with the TAA group (Figure 4A). The ratio of bcl-2 and bax was significantly decreased by TAA-stimulation compared with the normal group, while 25-OCH3-PPD or silymarin obviously enhanced the ratio of bcl-2 and bax compared with the TAA group (Figure 4A). As a positive control, silymarin only significantly decreased the expressions of c-FLIPS, bcl-2/bax, and cleaved caspase-3 and had no significance on the expression of bid. Moreover, abundant apoptotic changes were also confirmed by TUNEL. TUNEL assay was used to evaluate the effects of 25-OCH3-PPD on hepatocellular apoptosis and staining in yellow brown. After TAA exposure, apoptotic hepatocytes were frequently observed in the TAA group, while no apparent apoptotic cell was found in the liver tissue of mice in the normal group (Figure 4B). 25-OCH3-PPD or silymarin

indicating the presence of proliferating myofibroblasts and revealing the formation of hepatic fibrosis. And 25-OCH3-PPD or silymarin administrations obviously ameliorated positive expressions of α-SMA and collagen I compared with the TAA group (Figure 2C). Especially, α-SMA and collagen I expressions seemed to be balanced in 25-OCH3-PPD (10 and 20 mg/kg) groups and were similar to the normal group. 25-OCH3-PPD Attenuates the Levels of Proinflammatory Cytokines. Inflammation play a key role in the development of hepatic fibrosis. And chronic unresolved inflammation is associated with persistent hepatic fibrosis. F4/80 is generally considered as the specific mature macrophage marker. After TAA exposure, protein expression of F4/ 80 was significantly increased compared with the normal group, while 25-OCH3-PPD or silymarin administrations significantly decreased F4/80 expression. This was supported by the immunohistochemical staining as well, showing that the positive area of F4/80 was increased with TAA stimulation compared with the normal group and decreased with 25OCH3-PPD or silymarin administrations compared with the TAA group (Figure 3C). The other inflammation factors, including caspase-1, IL-1β, IL-1R1, IL-6, and IL-18 protein expressions were increased in the TAA group compared with the normal group. Caspase-1 is a protease related with inflammatory reaction and produces mature IL-1β and IL-18. Thus, we found 25-OCH3-PPD and silymarin administrations significantly decreased the expressions of cleaved caspase-1 and IL-1β, and IL-1R1, IL-6, and IL-18. 25-OCH3-PPD (10 and 20 mg/kg) treatments significantly decreased mRNA expressions of TNF-α and IL-18 compared with the TAA group (Figure 7028


Article


Figure 5. 25-OCH3-PPD regulates the expressions of P2X7R and NLRP3 in TAA-stimulation. (A) Immunofluorescent histochemistry staining present in 100× magnification. The positive areas were quantified. (B) Representative Western blotting analysis for expressions of P2X7R and NLRP3. Densitometric values were normalized against GAPDH. (C) Representative RT-PCR analysis for expressions of P2X7R and NLRP3. Densitometric values were normalized against GAPDH. ###P < 0.001 vs normal group, ***P < 0.001 vs TAA group, ns, not significant.

PPD or silymarin significantly decreased the expression of P2X7R compared with the TAA group (Figure 5A). However, treatment of 25-OCH3-PPD (20 mg/kg) also showed obviously lower green expression of P2X7R compared with treatment of silymarin (Figure 5A). This was supported by the Western blot and RT-PCR assay as well. The protein and mRNA expressions of P2X7R and NLRP-3 were significantly increased in the TAA group compared with the normal group (Figure 5B, 5C). And 25-OCH3-PPD (20 mg/kg) significantly decreased the protein expression of P2X7R. 25-OCH3-PPD (5, 10, and 20 mg/kg) significantly decreased the protein expression of NLRP3. Silymarin showed no significant effect on the protein expression of P2X7R and NLRP-3 (Figure 5B). And 25-OCH3-PPD significantly decreased the mRNA expressions of P2X7R and NLRP-3. Silymarin showed no significant effect on the mRNA expression of P2X7R and significantly decreased the mRNA expression of NLRP-3 (Figure 5C). These results showed that 25-OCH3-PPD regulated NLRP3 inflammasome by affecting P2X7R activa-

significantly reduced the number of apoptotic hepatocytes (Figure 4B). Quantitative analysis of TUNEL positive hepatocytes showed that the number of apoptotic hepatocytes in TAA group was significantly higher than that in the normal group. Treatment with 25-OCH3-PPD or silymarin reduced the number of apoptotic cells in the liver (Figure 4B). These results suggested that 25-OCH3-PPD inhibited the hepatocyte apoptosis induced by TAA through affecting the expression of apoptosis-related factors. 25-OCH3-PPD Regulates NLRP3 Inflammasome by Affecting P2X7R Activation. Inflammasomes are large intracellular multiprotein complexes in the development of inflammatory disorders, and the inflammasome NLRP3 is the best character to date. It was reported that the P2X7R directly interacted with NLRP3 inflammasome scaffold protein and was responsible for NLRP3 recruitment and activation.18 Immunofluorescence staining indicated that TAA stimulation obviously promoted the immunofluorescence expression of P2X7R (in green) in the TAA group compared with the normal group (Figure 5A). While treatment with 25-OCH37029


Article


Figure 6. 25-OCH3-PPD regulates PI3K/Akt and LKB1/AMPK-SIRT1 in TAA-induced mice. (A) Representative Western blotting analysis for expressions of p-Akt/Akt, p-PI3K/PI3K, p-LKB1/LBK1, p-AMPK/AMPK, Lipin-1, and SIRT1. Densitometric values were normalized against GAPDH. (B) Immunohistochemical staining of p-PI3K, p-Akt, and SIRT1 present in 100× magnification. The positive areas were quantified. ###P < 0.001 vs normal group, *P < 0.05, **P < 0.01, ***P < 0.001 vs TAA group, ns, not significant.

TAA group (Figure 6A). Sirtuin1 (SIRT1) is a lysine deacetylase regulating oxidative stress, energy metabolism, and further promoting ECM synthesis. Our previous study has found that SIRT1 antagonizes HSC activation in vitro. Thus, we found that TAA-stimulation decreased the protein expression of SIRT1, while 25-OCH3-PPD or silymarin significantly increased the expression of SIRT1 compared with TAA group (Figure 6A). This was supported by the immunohistochemistry staining as well. The positive area of SIRT1 were significantly decreased in TAA group compared with normal group, and 25-OCH3-PPD significantly enhanced the expression of SIRT1 compared with TAA group, but silymarin showed no significant effect on SIRT1 (Figure 6B). So, 25-OCH3-PPD decreased the phosphorylated PI3K/Akt and increased LKB1 phosphorylation and AMPK-SIRT1 signaling against TAA-induced hepatic fibrosis. 25-OCH3-PPD Facilitates LXRs and FXR Activity Decreased by TAA Stimulation. LXRs and farnesoid X receptor (FXR) belong to the nuclear receptor supergene family that encode the transcription factors, regulating lipid metabolism gene in metabolic and digestive diseases. We have found that activation of LXRs could block the activation of

tion, and the following inflammatory factors, including caspase1, IL-1β, IL-18, and others. 25-OCH3-PPD Regulates PI3K/Akt Phosphorylation and LKB1/AMPK-SIRT1 in TAA-Induced Mice. PI3K/Akt signaling plays the key role during the development of hepatic fibrosis and regulates ECM, HSCs activation, and hepatic sinusoidal capillarization to participate in the formation of hepatic fibrosis. The phosphorylation expressions of PI3K and Akt were significantly increased in the TAA group compared with the normal group, while 25-OCH3-PPD or silymarin significantly decreased the expressions of p-PI3K and p-Akt compared with the TAA group (Figure 6A). The immunohistochemistry staining of p-PI3K and p-Akt showed the same tendency change as well as the expressions of p-PI3K and pAkt (Figure 6B). In the previous study, it was found that LKB1-AMPK signaling could be regulated in the development of hepatic fibrosis. In the current study, the phosphorylation expression of LKB1 and AMPK was significantly decreased with TAAstimulation in the TAA group compared with the normal group, and 25-OCH3-PPD or silymarin significantly enhanced the expressions of p-LKB1 and p-AMPK compared with the 7030


Article


Figure 7. 25-OCH3-PPD facilitates LXRs and FXR activity in TAA-stimulation. (A) Immunofluorescent histochemistry staining of LXRs and FXR present in 200× magnification. The positive areas were quantified. (B) Representative Western blotting analysis for expressions of LXRs and FXR. Densitometric values were normalized against GAPDH. (C) Representative RT-PCR analysis for expressions of LXRs. Densitometric values were normalized against GAPDH. ###P < 0.001 vs normal group, *P < 0.05, **P < 0.01, ***P < 0.001 vs TAA group, ns, not significant.

HSCs, and further reversed hepatic fibrosis. In immunohistochemistry staining, the positive areas of LXRα and LXRβ (in red) were significantly decreased in TAA group compared with normal group, and 25-OCH3-PPD (20 mg/kg) significantly enhanced the expression of SIRT1 compared with TAA group. Silymarin showed no significant effect on LXRα, but significance on LXRβ (Figure 7A). The protein expressions of LXRα and LXRβ were obviously decreased in TAA group compared with normal group. 25-OCH3-PPD significantly enhanced the protein expression of LXRα and LXRβ compared with TAA group, while silymarin showed no significance on LXRα and LXRβ (Figure 7B). The Immunofluorescent intensity of FXR (in green) was also significantly decreased in the TAA group compared with the normal group, and 25-OCH3-PPD (10 and 20 mg/kg) or silymarin significantly enhanced the expression of FXR compared with the TAA group (Figure 7A). The protein expression of FXR was obviously decreased in the TAA group compared with the normal group, and 25-OCH3-PPD (10 and 20 mg/kg) or silymarin significantly enhanced the protein

expression of FXR compared with the TAA group (Figure 7B). The mRNA expressions of LXRα and LXRβ were obviously decreased in the TAA group compared with the normal group, and 25-OCH3-PPD or silymarin significantly enhanced the mRNA expressions of LXRα and LXRβ compared with the TAA group (Figure 7C). 25-OCH3-PPD Decreased α-SMA via Regulation of LXRs and P2X7R-NLRP3 in Vitro. HSCs are the key cells in the fibrogenesis and development of hepatic fibrosis, characterized by transformation from quiescent storing vitamin-A into fibrogenic myofibroblasts once activated. TGF-β is the major profibrogenic cytokine and activates HSCs and transdifferentiates to myofibroblast-like cells.19 In vitro, HSC-T6 cells were activated with TGF-β in response to profibrogenic stimuli, and the expression of α-SMA was significantly increased, which means the production and deposition of ECM proteins. The augmented expression of α-SMA was significantly decreased with 25-OCH3-PPD treatment (Figure 8C). And the expressions of LXRα and LXRβ were also significantly increased with 25-OCH3-PPD 7031


Article


Figure 8. 25-OCH3-PPD inhibits α-SMA by regulating LXRs and P2X7R-NLRP3 in vitro. (A) Representative Western blotting analysis for expressions of LXRα, LXRβ, P2X7R, and NLRP3. Densitometric values were normalized against GAPDH. **P < 0.01, ***P < 0.001 vs TGF-β stimulation, ns, not significant. (B) HSCs were treated with TGF-β with 25-OCH3-PPD or caspase-1 inhibitor I and representative Western blotting and RT-PCR analysis for expressions of casepase-1, IL-1β, and IL-18. Densitometric values were normalized against GAPDH. ###P < 0.001 vs normal group, *P < 0.05, ***P < 0.001 vs TGF-β group, ns, not significant, 25-OCH3-PPD vs inhibitor. (C) Immunofluorescent staining of αSMA present in 400× magnification. (D) Immunofluorescent staining of P2X7R present in 200× magnification. (E) Representative Western blotting analysis for expressions of p-PI3K/PI3K and p-Akt/Akt. Densitometric values were normalized against GAPDH.

treatment (Figure 8D). 25-OCH3-PPD also significantly decreased phosphorylation expressions of PI3K and Akt compared with activated HSCs stimulated by TGF-β, except 25-OCH3-PPD (1 μM) on p-Akt/Akt (Figure 8E). To further

treatment (Figure 8A). The expressions of P2X7R and NLRP3 were significantly decreased with 25-OCH3-PPD treatment (Figure 8A), and immunofluorescent staining showed the same tendency on P2X7R expression undergoing 25-OCH3-PPD 7032


Article


triggers immune response depending on the activation of TLR4 signaling pathway. The activation of TLR4/MyD88 results in ubiquitylation of NLRP3 and steps into activation.23 P2X7R is highly expressed in TAA-induced hepatic fibrosis and following increases the activity of NLRP3 inflammasome required for the mature IL-1β and cleaved caspase-1 expression. We have found that 25-OCH3-PPD exerts a negative impact on P2X7R and the following-mediated NLRP3 inflammasome activation, pro-caspase-1 processing, and IL-1β and IL-18 maturation. These findings support that the other proinflammatory factors were decreased by 25-OCH3-PPD in TAA-induced hepatic fibrosis. Other ginsenosides have been found to inhibit NLR inflammasomes against injury with inflammation.11,24 Ginsenoside Rg1 shows a protective effect against neuroinflammation by inhibiting NLRP-1 inflammasomes and decreasing the expressions of ASC, caspase-1, caspase-5, IL-1β, and IL-18.24 And Rg1 also exhibits a protective effect on liver fibrosis via suppressing ROS.25 Inflammasome activation is a complex process converging many different pathways, and the contribution of the lipidrelated pathway also has been investigated.26 As a lipid-related enzyme, lipid-2 modulates NLRP3 inflammasome activation by affecting P2X7R activation.26 During lipid metabolism, activated LXRs can induce ATP-binding cassette, subfamily A (ABCA1), and subfamily G (ABCG1), the target genes involved in cholesterol.27−29 Considering the ATP-gated or ATP-binding channel, it can be hypothesized that activated LXRs might affect the activation of P2X7R and regulation of P2X7R on NLRP3-type inflammasome. In the retinal inflammatory responses, LXR agonist TO901317 downregulated NLRP-3, caspase-1, as well as the expressions of proinflammatory factors, and indicated that activated LXRα exerted potent anti-inflammatory effect via inhibition of NLRP3 inflammasome.30 Corresponding to the above research, the present study also demonstrated that 25-OCH3PPD could activate protein and mRNA expressions of LXRα and LXRβ and furthermore inhibit P2X7R and NLRP3 inflammasome. In colon cancer cells, LXRβ ligates with its receptors and promotes activation of pannexin-1 and induces ATP efflux and subsequent caspase-1 via a pathway involving the P2X7R and the NLRP3 inflammasome.31 Although originally identified as a regulator in cholesterol homeostasis, the LXRs now can represent ripe targets in anti-inflammatory drug development for its inflammatory inhibition.32 The LXRs suppress inflammation through multiple mechanisms, and LXRs involving P2X7R-mediated NLRP3 inflammasome undoubtedly present a new pathway. However, the relative importance of this mechanism in different stages of hepatic fibrosis remains uncertain. Why could LXRs link lipid metabolism and inflammation? Some researchers found that increased ABCA1 would reduce inflammation in part by eliminating redundant free cholesterol which is harmful for cells during the regulation of fatty acid synthesis,33 and LXR agonists dependent up-regulation of ABCA1 to reduce inflammation.34 These studies built an available link for the regulation effect of LXRs in the cross-talk between cholesterol homeostasis and inflammation.35 Overall, our studies reveal the hepatoprotective effect of 25OCH3-PPD against TAA-induced hepatic fibrosis, and 25OCH3-PPD activates LXRs and reduces inflammation by regulating P2X7R-mediated NLRP-3 inflammasome and further ameliorates the development of hepatic fibrosis. The results presented here may provide clues to better understand

confirm that 25-OCH3-PPD regulates the inflammasome activation in the development of hepatic fibrosis, caspase-1 inhibitor I was selected in activated HSCs. And results indicated that 25-OCH3-PPD could significantly inhibit cleaved caspase-1, mature IL-1β, and IL-18 expressions, which showed no significance compared with caspase-1 inhibitor I (Figure 8B). This result also suggested that blockade of the P2X7R-NLRP3 inflammasome represents a potential therapeutic target of 25-OCH3-PPD against liver fibrosis.

■

DISCUSSION A wide array of etiologies induces hepatic fibrosis, such as viral hepatitis, metabolic diseases, alcohol abuse, autoimmune disease, toxin exposure, and drugs. Concomitant or persistent inflammation promotes hepatic fibrosis, even cirrhosis. Thus, treatments on hepatic fibrosis, hepatic damage, and inflammation are potential therapeutic methods for chronic liver disease avoiding progression to cirrhosis. Given these considerable elements, the current study has intense interest in developing candidates aimed at hepatic fibrosis with targeting mechanism. And now, the current study found that 25-OCH3-PPD ameliorated TAA-induced hepatic injury, fibrosis, and inflammation through promoting transcriptional activity of LXRs to ameliorate P2X7R-mediated NLRP3 inflammasome. TAA is generally used to induce hepatic fibrosis in animals for its high similarities to human hepatic fibrosis on hemodynamic, morphological, and biochemical changes. Our results indicate that 25-OCH3-PPD protects the liver against TAA-induced hepatic injury and fibrosis. However, it seems that 25-OCH3-PPD is interfering at multiple pathway in the development of hepatic fibrosis. 25-OCH3-PPD presents hepatoprotection as evidenced by the decrease in serum ALT and AST, and amelioration in pathological change of liver tissue. Based on these improvements, 25-OCH3-PPD also inhibits hepatocellular apoptosis and regulates apoptosis protein or genes, such as bcl-2 and caspase families. 25OCH3-PPD blocks the release of inflammatory factors and inflammatory signaling pathways. Collectively, 25-OCH3-PPD inhibits hepatic fibrosis by balancing the synthesis and degradation of extracellular matrix for reducing the production of pro-fibrotic cytokines, such as α-SMA, collagen I, TIMP-1, etc. Thus, 25-OCH3-PPD is particularly useful in preventing liver injury and fibrosis in the progression of chronic liver disease. Hepatic inflammation is essential in initiating events for liver fibrosis.20 Agents that ameliorate hepatic inflammation can exert a potential antifibrotic effect. In the present study, our results confirm that 25-OCH3-PPD can successfully ameliorate hepatic fibrosis caused by TAA-stimulation in mice. These effects are associated with inhibiting the production of proinflammatory cytokines and reducing pro-fibrogenic transcripts. A hallmark of liver inflammation in TAA-induced hepatic fibrosis is the release of proinflammatory cytokines, and 25-OCH3-PPD can significantly reduce these processes. As an ATP-gated nonselective cation channel, P2X7R induces inflammatory responses. Studies in humans and murine models also revealed that P2X7R is an important regulating key in many chronic diseases involved in immunoinflammatory response.21 P2X7R activation induces the activation of the NLRP3 inflammasome and promotes subsequent proinflammatory cytokines release, such as mature IL-1β and IL-18.22 As a component of the inflammasome, classical activated NLRP3 7033


Article


(8) Gentile, D.; Lazzerini, P. E.; Gamberucci, A.; Natale, M.; Selvi, E.; Vanni, F.; Alì, A.; Taddeucci, P.; Del-Ry, S.; Cabiati, M.; DellaLatta, V.; Abraham, D. J.; Morales, M. A.; Fulceri, R.; Laghi-Pasini, F.; Capecchi, P. L. Searching Novel Therapeutic Targets for Scleroderma: P2X7-Receptor Is Up-regulated and Promotes a Fibrogenic Phenotype in Systemic Sclerosis Fibroblasts. Front. Pharmacol. 2017, 8, 638. (9) Huang, Y. C.; Lin, C. Y.; Huang, S. F.; Lin, H. C.; Chang, W. L.; Chang, T. C. Effect and mechanism of ginsenosides CK and Rg1 on stimulation of glucose uptake in 3T3-L1 adipocytes. J. Agric. Food Chem. 2010, 58, 6039−6047. (10) Wang, C. W.; Huang, Y. C.; Chan, F. N.; Su, S. C.; Kuo, Y. H.; Huang, S. F.; Hung, M. W.; Lin, H. C.; Chang, W. L.; Chang, T. C. A gut microbial metabolite of ginsenosides, compound K, induces intestinal glucose absorption and Na(+)/glucose cotransporter 1 gene expression through activation of cAMP response element binding protein. Mol. Nutr. Food Res. 2015, 59, 670−684. (11) Wang, Z.; Hu, J. N.; Yan, M. H.; Xing, J. J.; Liu, W. C.; Li, W. Caspase-Mediated Anti-Apoptotic Effect of Ginsenoside Rg5, a Main Rare Ginsenoside, on Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2017, 65, 9226−9236. (12) Wang, W.; Liu, X.; Liu, J.; Cai, E.; Zhao, Y.; Li, H.; Zhang, L.; Li, P.; Gao, Y. Sesquiterpenoids from the Root of Panax ginseng Attenuates Lipopolysaccharide-Induced Depressive-Like Behavior through the Brain-Derived Neurotrophic Factor/TropomyosinRelated Kinase B and Sirtuin Type 1/Nuclear Factor-κB Signaling Pathways. J. Agric. Food Chem. 2018, 66, 265−271. (13) Wang, W.; Wang, H.; Rayburn, E. R.; Zhao, Y.; Hill, D. L.; Zhang, R. 20(S)-25-methoxyl-dammarane-3beta, 12beta, 20-triol. A novel natural product for prostate cancer therapy: activity in vitro and in vivo and mechanisms of action. Br. J. Cancer 2008, 98, 792−802. (14) Voruganti, S.; Qin, J. J.; Sarkar, S.; Nag, S.; Walbi, I. A.; Wang, S.; Zhao, Y.; Wang, W.; Zhang, R. Oral nano-delivery of anticancer ginsenoside 25-OCH3-PPD, a natural inhibitor of the MDM2 oncogene: Nanoparticle preparation, characterization, in vitro and in vivo anti-prostate cancer activity, and mechanisms of action. Oncotarget 2015, 6, 21379−21394. (15) Wu, Y. L.; Wan, Y.; Jin, X. J.; OuYang, B. Q.; Bai, T.; Zhao, Y. Q.; Nan, J. X. 25-OCH3-PPD induces the apoptosis of activated tHSC/Cl-6 cells via c-FLIP-mediated NF-κB activation. Chem.-Biol. Interact. 2011, 194, 106−112. (16) Wu, Y. L.; Jiang, Y. Z.; Jin, X. J.; Lian, L. H.; Piao, J. Y.; Wan, Y.; Jin, H. R.; Lee, J. J.; Nan, J. X. Acanthoic acid, a diterpene in Acanthopanax koreanum, protects acetaminophen-induced hepatic toxicity in mice. Phytomedicine 2010, 17, 475−479. (17) Chen, I. S.; Chen, Y. C.; Chou, C. H.; Chuang, R. F.; Sheen, L. Y.; Chiu, C. H. Hepatoprotection of silymarin against thioacetamideinduced chronic liver fibrosis. J. Sci. Food Agric. 2012, 92, 1441−1447. (18) Franceschini, A.; Capece, M.; Chiozzi, P.; Falzoni, S.; Sanz, J. M.; Sarti, A. C.; Bonora, M.; Pinton, P.; Di Virgilio, F. The P2X7 receptor directly interacts with the NLRP3 inflammasome scaffold protein. FASEB J. 2015, 29, 2450−2461. (19) Hellerbrand, C.; Stefanovic, B.; Giordano, F.; Burchardt, E. R.; Brenner, D. A. The role of TGFβ1 in initiating hepatic stellate cell activation in vivo. J. Hepatol. 1999, 30, 77−87. (20) Bisht, S.; Khan, M. A.; Bekhit, M.; Bai, H.; Cornish, T.; Mizuma, M.; Rudek, M. A.; Zhao, M.; Maitra, A.; Ray, B.; Lahiri, D.; Maitra, A.; Anders, R. A. A polymeric nanoparticle formulation of curcumin (NanoCurc) ameliorates CCl4-induced hepatic injury and fibrosis through reduction of pro-inflammatory cytokines and stellate cell activation. Lab. Invest. 2011, 91, 1383−1395. (21) Bartlett, R.; Stokes, L.; Sluyter, R. The P2X7 receptor channel: recent developments and the use of P2X7 antagonists in models of disease. Pharmacol. Rev. 2014, 66, 638−675. (22) Karmakar, M.; Katsnelson, M. A.; Dubyak, G. R.; Pearlman, E. Neutrophil P2X7 receptors mediate NLRP3 inflammasome-dependent IL-1β secretion in response to ATP. Nat. Commun. 2016, 7, 10555.

the molecular mechanism of 25-OCH3-PPD in prevention for hepatic fibrosis and may open new avenues for ginseng as a dietary food that helps to prevent hepatic fibrosis. Although, 25-OCH3-PPD could regulate liver fibrosis markers and a cascade of inflammatory processes, more further research also would focus on multiple factors and interactions based on the complex pathogenesis of hepatic fibrosis.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (Y.L. Wu). *E-mail: [email protected] (J.X. Nan). ORCID

Ji-Xing Nan: 0000-0002-6221-4309 Funding

This work was supported by grants from the National Natural Science Foundation of China (Grant no. 81460564, 81760668, and 81660689) and the Science and Technology Department of the Jilin Province Scientific Research Fund Project (Grant no. 20180519010JH, 20180201065YY, and 20180414048GH). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS JXN and YLW designed the animal studies and analyzed the results. YLW, HX, and JS performed the animal studies and participated in Western blot analysis and RT-PCR. YLW, YLY, DYS, YF, LSH, GW, and SZ carried out the experiments involving histological staining and TUNEL assays. JXN, YLW, and LHL contributed in critical discussion of the results and manuscript. JXN and YLW conceived of and designed the research and interpreted the results. YLW, HX, and JS prepared and wrote the manuscript. All authors approved the final manuscript.

■

ABBREVIATIONS USED LXRs, liver X receptors; TAA, thioacetamide; ECM, extracellular matrix; HSCs, hepatic stellate cells; P2X7R, P2X7 receptor; α-SMA, α smooth muscle actin; FXR, farnesoid X receptor; SIRT1, sirtuin1; TGF-β, transforming growth factor β.

■

REFERENCES

(1) Tsuchida, T.; Friedman, S. L. Mechanisms of hepatic stellate cell activation. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 397−411. (2) Li, M.; Hong, W.; Hao, C.; Li, L.; Wu, D.; Shen, A.; Lu, J.; Zheng, Y.; Li, P.; Xu, Y. SIRT1 antagonizes liver fibrosis by blocking hepatic stellate cell activation in mice. FASEB J. 2018, 32, 500−511. (3) Trautwein, C.; Friedman, S. L.; Schuppan, D.; Pinzani, M. Hepatic fibrosis: concept to treatment. J. Hepatol. 2015, 62, S15−24. (4) Kisseleva, T. The origin of fibrogenic myofibroblasts in fibrotic liver. Hepatology 2017, 65, 1039−1043. (5) Wynn, T. A. Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J. Clin. Invest. 2007, 117, 524− 529. (6) Seki, E.; Schwabe, R. F. Hepatic Inflammation and Fibrosis: Functional Links and Key Pathways. Hepatology 2015, 61, 1066− 1079. (7) Zhao, H.; Pan, P.; Yang, Y.; Ge, H.; Chen, W.; Qu, J.; Shi, J.; Cui, G.; Liu, X.; Feng, H.; Chen, Y. Endogenous hydrogen sulphide attenuates NLRP3 inflammasome-mediated neuroinflammation by suppressing the P2X7 receptor after intracerebral haemorrhage in rats. J. Neuroinflammation 2017, 14, 163. 7034


Article

Journal of Agricultural and Food Chemistry (23) Gurung, P.; Li, B.; Subbarao Malireddi, R. K.; Lamkanfi, M.; Geiger, T. L.; Kanneganti, T. D. Chronic TLR Stimulation Controls NLRP3 Inflammasome Activation through IL-10 Mediated Regulation of NLRP3 Expression and Caspase-8 Activation. Sci. Rep. 2015, 5, 14488. (24) Zhang, Y.; Hu, W.; Zhang, B.; Yin, Y.; Zhang, J.; Huang, D.; Huang, R.; Li, W.; Li, W. Ginsenoside Rg1 protects against neuronal degeneration induced by chronic dexamethasone treatment by inhibiting NLRP-1 inflammasomes in mice. Int. J. Mol. Med. 2017, 40, 1134−1142. (25) Wei, X.; Chen, Y.; Huan, g W. Ginsenoside Rg1 ameliorates liver fibrosis via suppressing epithelial to mesenchymal transition and reactive oxygen species production in vitro and in vivo. Biofactors 2018, DOI: 10.1002/biof.1432. (26) Lordén, G.; Sanjuán-García, I.; de Pablo, N.; Meana, C.; Alvarez-Miguel, I.; Pérez-García, M. T.; Pelegrín, P.; Balsinde, J.; Balboa, M. A. Lipin-2 regulates NLRP3 inflammasome by affecting P2X7 receptor activation. J. Exp. Med. 2017, 214, 511−528. (27) Repa, J. J.; Turley, S. D.; Lobaccaro, J. A.; Medina, J.; Li, L.; Lustig, K.; Shan, B.; Heyman, R. A.; Dietschy, J. M.; Mangelsdorf, D. J. Regulation of absorption and ABCA1-mediated efflux o cholesterol by RXR heterodimers. Science 2000, 289, 1524−1529. (28) Whitney, K. D.; Watson, M. A.; Goodwin, B.; Galardi, C. M.; Maglich, J. M.; Wilson, J. G.; Willson, T. M.; Collins, J. L.; Kliewer, S. A. Liver X receptor (LXR) regulation of the LXRα gene in human macrophages. J. Biol. Chem. 2001, 276, 43509−43515. (29) Joseph, S. B.; Laffitte, B. A.; Patel, P. H.; Watson, M. A.; Matsukuma, K. E.; Walczak, R.; Collins, J. L.; Osborne, T. F.; Tontonoz, P. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J. Biol. Chem. 2002, 277, 11019−11025. (30) Lei, C.; Lin, R.; Wang, J.; Tao, L.; Fu, X.; Qiu, Y.; Lei, B. Amelioration of amyloid β-induced retinal inflammatory responses by a LXR agonist TO901317 is associated with inhibition of the NF-κB signaling and NLRP3 inflammasome. Neuroscience 2017, 360, 48−60. (31) Derangère, V.; Chevriaux, A.; Courtaut, F.; Bruchard, M.; Berger, H.; Chalmin, F.; Causse, S. Z.; Limagne, E.; Végran, F.; Ladoire, S.; Simon, B.; Boireau, W.; Hichami, A.; Apetoh, L.; Mignot, G.; Ghiringhelli, F.; Rébé, C. Liver X receptor β activation induces pyroptosis of human and murine colon cancer cells. Cell Death Differ. 2014, 21, 1914−1924. (32) Fessler, M. B. The challenges and promise of targeting the Liver X Receptors for treatment of inflammatory disease. Pharmacol. Ther. 2018, 181, 1−12. (33) Ma, L.; Dong, F.; Zaid, M.; Kumar, A.; Zha, X. ABCA1 protein enhances toll-like receptor 4 (TLR4)-stimulated interleukin-10 (IL10) secretion through protein kinase A (PKA) activation. J. Biol. Chem. 2012, 287, 40502−40512. (34) Ito, A.; Hong, C.; Rong, X.; Zhu, X.; Tarling, E. J.; Hedde, P. N.; Gratton, E.; Parks, J.; Tontonoz, P. LXRs link metabolism to inflammation through Abca1-dependent regulation of membrane composition and TLR signaling. eLife 2015, 4, e08009. (35) Schulman, I. G. Liver X receptors link lipid metabolism and inflammation. FEBS Lett. 2017, 591, 2978−2991.

7035


Ginsenoside 25-OCH3-PPD Promotes Activity of LXRs To Ameliorate

Recommend Documents