Subscriber access provided by HOWARD UNIV
Article
Graphene FRET Aptasensor Kazuaki Furukawa, Yuko Ueno, Makoto Takamura, and Hiroki Hibino ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.6b00191 • Publication Date (Web): 22 Apr 2016 Downloaded from http://pubs.acs.org on April 25, 2016
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
ACS Sensors is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors
Graphene FRET Aptasensor Kazuaki Furukawa,* Yuko Ueno, Makoto Takamura and Hiroki Hibino† NTT Basic Research Laboratories, Morinosato Wakamiya 3-1, Atsugi, Kanagawa 243-0198 Japan KEYWORDS: graphene, aptasensor, fluorescence resonance energy transfer, microchannel device,
ABSTRACT: We report on a new protein sensor built on pristine graphene. Graphene grown by chemical vapor deposition and supported on a SiO2 surface was modified with a sequence consisting of pyrene, DNA aptamer, and dye. Here, an aptamer is a nucleic acid having a specific base sequence that recognizes and forms a complex with a target molecule such as a protein. In our protein sensing system, the recognition of a target protein triggers the fluorescence of a dye tethered on the graphene surface. This is based on the effective fluorescence quenching property of graphene via fluorescence resonance energy transfer (FRET). We first demonstrate that the graphene FRET aptasensor yields fluorescence when there is a target protein in the sample using prostate specific antigen (PSA, a cancer marker) as the target. We confirm that the fluorescence intensities vary depending on the PSA concentrations. We also discuss the selectivity and limit of detection using a microchannel configuration built on a graphene FRET aptasensor. A similar aptasensor has been intensively studied using graphene oxide (GO) dispersed in aqueous media, but has been little studied on a solid support. By preparing the graphene and GO FRET aptasensor on the same substrate, we show quantitatively that the graphene sensor yields brighter fluorescence than the GO aptasensor. We also demonstrate the response of the graphene FRET aptasensor under sample flow conditions.
After the unique characteristics of graphene were revealed,1-6 graphene oxide (GO), a similar two-dimensional sheet-like material made mainly of carbon atoms, also started to attract a lot of attention.7-10 Although they differ in terms of their electronic transport properties, both can quench fluorescence very effectively. This makes them strong acceptors in fluorescence resonance energy transfer (FRET) over the entire visible light region, because both have a broad absorption in this region. It has been experimentally demonstrated that the dye fluorescence is efficiently quenched when the dye is present near the GO surface.11 A new type of biosensor was recently reported using GO.12-20 In the sensor, dye-labeled biological molecules such as DNA and RNA are either physisorbed12 or covalently attached16 to the GO surface. The sensor yields fluorescence when it recognizes a molecule, as a result of the difference in FRET efficiencies depending on the distance between the dye and the GO surface. The dye fluorescence is quenched by GO at the initial stage, whereas it recovers when the biological molecule recognizes its target molecule. Thus, in this sensor, molecular recognition by biological molecules is converted to an observable physical quantity of fluorescence with the assistance of GO. When we use a specific nucleic acid sequence called an aptamer,21 the target molecule can be extended to proteins.14 The recognition by the aptamer is target-selective, and so the sensor yields fluorescence when detecting the target molecule.
Unlike graphene, GO is hydrophilic and can be readily dispersed in water. This is an advantage of GO when it is used for biosensing applications because such sensors must be operated under aqueous conditions. Therefore, most of the GO aptasensors reported so far have been operated in a dispersed form in an aqueous medium.22-24 By contrast, we have designed and demonstrated a protein sensor based on GO fixed on a solid support.25-28 There are several advantages of our approach. One is that we can employ observation instruments commonly used for surface science research such as an atomic force microscope (AFM) and a confocal laser scanning microscope (LSM).25 We have succeeded in the direct observation of the protein recognition process on a GO aptasensor surface by employing an AFM and an LSM with a single piece of GO on a solid support. Another advantage is that we can combine the microfluidics on the sensors. We have implemented microchannel devices on a GO aptasensor fixed on a solid support, which has led to the fabrication of a sensor array that is useful for a quantitative comparison of sensor performance26,28 and multitarget and multicolor detection.27 These operations could not be achieved using a GO aptasensor dispersed in an aqueous medium. The technique we developed for our GO aptasensors can be readily applied to graphene. We no longer have to disperse GO in aqueous media in our devices. This makes graphene a potential material for an aptasensor platform in addition to GO. However, a FRET aptasensor using pristine graphene has not yet been reported. We are also encouraged to develop a graphene aptasensor because of
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
the rapid evolution of scalability, quality and cost performance of graphene achieved by the development of chemical vapor deposition (CVD).29,30 If graphene is shown to be a better platform for FRET aptasensors than GO, the performance benefit may outweigh the cost disadvantage of graphene. In this paper, we investigate graphene as a new platform for a FRET aptasensor. We first build a graphene FRET aptasensor and use it to demonstrate protein detection using prostate specific antigen (PSA) as the target protein. We show that the fluorescence intensities vary in response to the PSA concentration. The detection performance is compared with that of a GO aptasensor, especially with regard to the fluorescence intensities for PSA detection. We also report on protein detection under solution flow conditions by implementing a microfluidics device on the graphene FRET aptasensor.
Page 2 of 9
was then transferred on the glass substrate. The PMMA film was removed in hot acetone before being chemically modified to prepare the graphene FRET aptasensor. We used the same chemical treatment for surface modification that we used in our previous report.25,32 In short, the glass substrate with graphene was covered with a drop of 5 mM DMF solution of 1 for 1 h, rinsed with DMF, and then dried in a nitrogen stream. The surface was then covered with a 100 µM solution of 2 for 1 h, rinsed with DI water, and dried in a nitrogen stream. The PDMS microfluidics was placed on the graphene FRET aptasensor to obtain the multichannel device.
EXPERIMENTAL SECTION Materials A Si(100) wafer with a 285 nm thick SiO2 layer (Si/SiO2, SUMCO) and a coverslip (Matsunami Glass Ind., Ltd.) were used after carrying out hydrophilic treatment. A CVD-grown piece of graphene (50 mm square) transferred onto a Si(100) wafer with a 100 nm thick SiO2 layer was purchased from Graphene Platform Corporation (Tokyo, Japan). The wafer was covered with a spin-coated polymethylmethacrylate (PMMA) film and cut into 10 mm squares using a scriber. The PMMA film was removed in hot acetone prior to chemical modification. A CVD-grown piece of graphene on Cu foil was also purchased from the same company. The GO was synthesized by Hummers’ method.31 An aqueous dispersion of GO with appropriate thin concentration was spin-coated on Si/SiO2 to obtain a substrate with isolated pieces of GO fixed to it. 1-Pyrenebutanoic acid-succinimidyl ester (1, Invitrogen), N,N-dimethylformamide (DMF, Kanto Chemical Co. Inc), phosphate buffered saline (PBS, pH = 7.0, Nacalai Tesque), PSA from human semen (Sigma–Aldrich) and FeCl3 (Aldrich) were used as received. The synthetic oligonucleotide with a PSA aptamer sequence and an extra 10 thymine sequence with an amino group and 6carboxyfluoroscein (FAM) at the 5’ and 3’ termini, 5’NH2TTTAATTAAAGCTCTCCATCAAATAGCTTTTTTTTTTFAM3’ (2), was purchased from Sigma Genosys. Deionized (DI) water (Millipore, >18 MΩ·cm) was used throughout the work. Preparation of graphene FRET aptasensor The process typically used to prepare the graphene FRET aptasensor on a glass substrate with microchannels is shown in Scheme 1. CVD-grown graphene on Cu foil was cut into a piece of the required size (typically 5-10 mm square). The graphene surface was covered with spincoated PMMA. The piece was floated on FeCl3 for about two hours to etch the Cu. The FeCl3 was replaced with pure water to wash the bottom surface of the graphene with a PMMA top layer. The graphene floated on water
Scheme 1. Preparation scheme of graphene FRET aptasensor.
Apparatus An Olympus BX51-FV300 upright type confocal LSM was used to obtain fluorescence images of the graphene FRET aptasensor fabricated on the Si/SiO2 surface. We used a 505-525 nm band-pass filter with a 488 nm laser light source for the FAM fluorescence observations. The space between the sensor chip and the objective lens was filled with solution throughout the observations for which a water-immersion objective lens Plan Apo 40×WLSM (Olympus) was used. An Olympus FV1200 inverted type confocal LSM was used to obtain fluorescence images of the graphene FRET
ACS Paragon Plus Environment
Page 3 of 9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors
aptasensor fabricated on a glass substrate. We used a 10×UPlanSApo (Olympus) objective lens to reserve a large observation window. A Renishaw Raman spectrometer with a StreamLine module was used to obtain Raman spectra at an excitation wavelength of 532 nm with a ×100 objective lens. PSA Detection Time-lapse LSM observations of the prepared graphene and/or GO aptasensors were started in DI water (40 µL). PSA solution (20 µL, 100 µg/mL) was then added during the time-lapse observations. After performing several observations under constant PSA concentration conditions, we added more DI water to dilute the solution.
We also examined the repeated use of the graphene aptasensor. The graphene aptasensor used for the PSA detection was washed with DI water, dried in a nitrogen gas stream, and then used again for PSA detection. The sensor was dark before PSA addition and exhibited fluorescence after PSA addition in a similar manner to that in Figs. 1 and 2. It is notable that the sensor that was preserved in the dark for a couple of weeks also worked as a protein sensor in the same manner. The robustness of the sensor is advantageous in terms of potential applications.
PSA detection within a microchannel was undertaken as follows. A graphene aptasensor with microfluidics was placed on an inverted type LSM stage (Olympus FV1200). The microchannels were filled with DI water when the time-lapse observations started. We used a passive pumping method33 to replace water with a PSA solution. RESULTS AND DISCUSSION PSA detection with graphene FRET aptasensor First, we confirmed the operation and performance of the graphene FRET aptasensor. We adopted time-lapse measurement to examine the graphene aptasensor response to the PSA concentration (Figs. 1 and 2). The aptasensor was filled with DI water without PSA at t = 0. The image obtained under these conditions is therefore dark as shown in Fig. 1a, which was captured at t = 80. While keeping the sample position and observation parameters of the microscope constant, we added PSA and obtained an image of the same area at t = 100 (Fig. 1b). The graphene aptasensor showed the fluorescence of FAM in response to PSA. The dark area in the right edge of the observation window corresponds to a crack in the graphene. The fluorescence intensity appears homogeneous at the graphene surface. There are the small dark spots of the small crevices in the graphene. We thus demonstrate the successful operation of our FRET aptasensor built on a pristine graphene platform. We also observed the dependence of the fluorescence intensities on the PSA concentrations. Figs. 1c-f show images obtained in the same area after the addition of DI water to dilute the PSA. The fluorescence intensities became weaker as the sample solution was diluted. It is clear that we observed fluorescence in exactly the same area, which suggests that the fluorescence only varies on the graphene surface. Figure 2 plots the average fluorescence intensity of the graphene aptasensor area. The intensities changed shortly after a change in PSA concentration. The intensities were maintained at a similar level while the concentrations stayed constant. This indicates that the fluorescence was not quenched by the excitation laser light under the observation conditions. Technically, the excitation laser power was set weaker than that used for our GO based aptasensors.
Figure 1. Fluorescence images of a graphene aptasensor in different PSA concentrations. The concentrations are (a) 0, (b) 33, (c) 20, (d) 14, (e) 11, and (f) 9 µg/mL, respectively. Scale bar: 20 µm. The excitation laser power and the photomultiplier detector bias voltage are 0.5% (of the full laser power) and 800 V, respectively.
Figure 2. Plot of the average fluorescence intensity of the graphene aptasensor area, which is identified by the solid white rectangle in the inset. In 40 µL of DI water (initial condition, t = 0–80 s), 20 µL PSA solution (100 µg/mL) was added between 80 and 100 s. 40 µL of DI water was repeatedly added between 280 and 300, 480 and 500, 680 and 700, 880 and 900 s to dilute the solution. The incident laser power and the photomultiplier detector bias voltage were 0.5% and 800 V, respectively.
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Selectivity and detection limit of graphene FRET aptasensor determined by using devices with a multiple microchannel configuration We examined the selectivity of the graphene FRET aptasensor using a device with a three-microchannel configuration. This is the same test that we used to show the selectivity of the GO FRET aptasensor in our latest report.27 We used 1 mM PBS buffer to examine the possible effect of a buffer on fluorescence recovery. The result is shown in Fig. 3. The 1 mM PBS solution of PSA (50 µg/mL) and albumin (50 µg/mL), and the PBS buffer as a reference were introduced into the top, middle and bottom channels, respectively. We found that the top line, i.e. the one filled with solution containing the target protein, yielded obvious green fluorescence. By contrast, the other two lines both yielded a small fluorescence at a similar level. This suggests that albumin was not recognized by the graphene FRET aptasensor prepared for the PSA target. The result also confirms that the buffer solution has a limited effect on fluorescence.
Page 4 of 9
Those in the sample areas for the 100 and 200 ng/mL PSA concentration samples are also at a similar level. The intensity more than doubles when the concentration is increased to 500 ng/mL. This is a significant and clearly detectable level. From the results in Fig. 4, we can estimate the detection limit of our present device to be several hundred ng/mL. We need to improve this sensitivity for medical use, which requires the 1 ng/mL order detection of PSA. A possible strategy for increasing the sensitivity is to design the surface-modifying molecule, especially the DNA part. For instance, we have demonstrated that the fluorescence intensity increases when we add a base sequence between the aptamer and the dye as a spacer.26
Figure 3. Fluorescence images of a graphene aptasensor with three microchannels. Top: PSA (50 µg/mL in 1 mM PBS); middle: albumin (50 µg/mL in 1 mM PBS); bottom: 1 mM PBS. Scale bar: 200 µm. The excitation laser power is 5% and the photomultiplier detector bias voltage is 900 V.
Taking advantage of the microchannel device configuration, we also examined the detection limit of our sensor. We used a device with a two-microchannel configuration in which the top channel is used for PSA detection and the bottom channel for a reference. If we observe a difference between the fluorescence in the two channels, we can evaluate the detection limit. The device was first filled with 100 ng/mL of aqueous PSA (top) and water (bottom) (Fig. 4a). Then the solution in the top channel was changed to 200 and 500 ng/mL aqueous PSA with a passive pumping method,33 while the bottom channel was kept filled with water. We took the images in the same area of the same device. There is no clear difference between the fluorescence intensities of the two channels with 100 ng/mL aqueous PSA and water (Fig. 4a). This is also the case with 200 ng/mL and water. However, when the PSA concentration was 500 ng/mL, we observed a clear difference in fluorescence. The average intensities of the sample area (top channel) and the reference area (bottom channel) are summarized in Fig. 4b. The fluorescence intensities in the reference areas are almost same for all the observations.
Figure 4. (a) Fluorescence images of a graphene aptasensor with two microchannels. The top channel is filled with left: 100 ng/mL aqueous PSA; middle: 200 ng/mL; right: 500 ng/mL. The bottom channel is filled with DI water. Scale bar: 200 µm. The excitation laser power is 10% and the photomultiplier detector bias voltage is 900 V. Note that the dark area in the 500 ng/mL test is most likely where the graphene has peeled off during the device fabrication process. (b) Average fluorescence intensities in the microchannel areas in (a) with standard deviations as error bars.
ACS Paragon Plus Environment
Page 5 of 9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors
Fluorescence response of graphene and GO FRET aptasensor We also prepared the GO aptasensor at the same time as the above graphene aptasensor using the same chemicals and reaction conditions. By comparing the sensing performance of the two aptasensors, we can extract the difference between graphene and GO as an aptasensor platform. The GO aptasensor response is shown in Fig. 5. Fluorescence is observed by adding PSA. Judging from the sizes and shapes, the bright green areas in Fig. 5 correspond to GO pieces.25 By comparing the results in Figs. 1 and 5, we can discuss the dependence of the aptasensor response on the platform; graphene or GO. However, the observation conditions such as the excitation laser power and photomultiplier detector bias voltage are different for Figs. 1 and 5. In addition, a slight difference in focus may greatly affect the fluorescence intensities in observations using a confocal fluorescence microscope. To evaluate the fluorescence recovery of the graphene aptasensor and the GO aptasensor quantitatively, we must fabricate both sensors on the same solid surface and simultaneously observe the fluorescence intensities upon the addition of the target molecules. For this purpose, we prepared a substrate with both graphene and GO pieces and fabricated the aptasensor on the substrate.
can be seen at the bottom of Fig. 6b, which are characteristic of GO.34 The intensity of the band around 2680 cm-1 is not sharp and is limited in the spectrum. The distributions of graphene and GO are indicated by Raman mapping images, which are shown in Fig. 6c and d, respectively. Figure 6c plots the peak intensities of the band around 2680 cm-1 after the Gaussian function fitting in the surrounding area. Figure 6d plots the peak intensities at 1350 cm-1. Thus, Fig. 6c corresponds to the position of the graphene, while Fig. 6d corresponds to that of GO. It is clear that the right side of the borderline in the center of Fig. 6a is covered by graphene (red area in Fig. 6c). It is also clear that the GO pieces are well dispersed on the left side (yellow area in Fig. 6d). It is seen that some GO pieces are deposited on the graphene. The graphene/GO aptasensor performance is examined in a similar manner in Figs. 1 and 2. Figure 7 shows a fluorescence image of the graphene/GO aptasensor in PSA solution, taken in the same area as Fig. 6. Fluorescence is observed in both the graphene and GO aptasensors. The right side is homogeneously fluorescent because the whole area is covered with graphene. The fluorescence pattern on the left side corresponds to the position of GO.
Figure 5. Fluorescence image of GO aptasensor in PSA solution (33 µg/mL). Scale bar: 20 µm. The excitation laser power is 5% and the photomultiplier detector bias voltage is 900 V.
Quantitative comparison of fluorescence response The graphene and GO aptasensors prepared on one chip were observed with an optical microscope (Fig. 6a). The right side of the image shows the graphene area, and the left side shows the area in which the GO pieces are dispersed. The contrast in the optical image clearly indicates two areas. Part of the optical image was also observed with Raman spectroscopy. The Raman spectra at the graphene and GO positions indicated by filled circles 1 and 2 in Fig. 6a are shown in Fig. 6b. At the top of Fig. 6b, the two sharp peaks at around 1590 and 2680 cm-1 can be assigned to the G and 2D-bands both of which are characteristic of graphene. From the ratio of the Raman intensities of the two bands, we confirmed that the graphene is a single layer. By contrast, two broad peaks at around 1350 and 1600 cm-1
Figure 6. Optical and Raman spectroscopy observations of graphene and GO aptasensors prepared on one chip. (a) Optical microscope image of the aptasensors. Scale bar: 100 µm. (b) Raman spectra observed at points 1 and 2 indicated in (a). (c) Raman intensity mapping image of the peak around 2685 -1 cm after fitting with a Gaussian function. (d) Raman inten-1 sity mapping image at 1350 cm . Images (c) and (d) are superimposed on optical image (a).
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 9
This can extract the difference induced solely by the platform, graphene and GO.
Figure 7. Fluorescence images of graphene and GO aptasensors coexisting on one chip in PSA solution (33 µg/mL). Scale bar: 200 µm. The excitation laser power and the photomultiplier detector bias voltage are 1% and 900 V, respectively.
We clearly show that the fluorescence intensity of the graphene aptasensor is 3.3 times higher than that of the GO aptasensor. For the estimation, we have chosen the area where the GO appears the densest in Fig. 8 for comparison. Thus the average intensity from entire GO area becomes lower, which makes the graphene platform more advantageous for practical applications. However, the predominant microscopic mechanism accounting for the difference is still an open question. For instance, it may include the difference between the probe molecule densities on the platform surface and the platform-to-dye distance dependence of the FRET efficiency.35,36 Graphene FRET aptasensor operation under solution flow conditions
Figure 8. Average fluorescence intensities of the area indicated by white (graphene) and red (GO) rectangles in the inset. The PSA concentrations were 0 (t = 0–80), 33 (100–280), 20 (300–380), 14 (400–480), 11 (500–580), and 9 (600–680) µg/mL.
The average fluorescence intensities in the areas shown by white (graphene) and red (GO) rectangles in the inset are plotted in Fig. 8. The fluorescence intensities change depending on the PSA concentrations in the same manner as in Fig. 2. We observe that the graphene and GO aptasensors exhibit the same response to the PSA concentrations. This supports the idea that the detection mechanism is the same for graphene and GO aptasensors: it is the recovery of fluorescence by escaping the FRET process after forming a complex between the aptamer and the target protein at the surface at the graphene or GO surface. Our purpose is to quantitatively compare the fluorescence intensities in the graphene and GO regions. The double-headed arrows in Fig. 8 correspond to the increased fluorescence intensities for the detection of an identical PSA solution. They are obtained by subtracting the background fluorescence (the average fluorescence intensities before PSA addition, t = 0–80 in Fig. 8) from the maximum fluorescence intensities after PSA detection. The graphene aptasensor yields a larger intensity than GO, and the ratio reaches 3.3. It is noteworthy that our estimation is quantitative thanks to the comparison of the fluorescence intensities of the two sensors built on one chip.
We also demonstrated the graphene aptasensor performance under solution flow conditions. We implemented a PDMS equipped with two microchannels on the graphene aptasensor (Fig. 9). The top channel was used for flow measurements with sequential flows of DI water/aqueous PSA/DI water, while the bottom was filled with DI water as a reference. Figure 9 plots the average fluorescence intensity of each channel area. Initially, both channels were filled with DI water in which almost no fluorescence was observed (Fig. 9a). We observed clear and bright fluorescence from the top channel when the PSA solution was introduced into the channel (Fig. 9b) via a passive pumping method.33 We did not observe any leakage of the aqueous media, which means the contact between the PDMS and the graphene aptasensor surface was sufficiently robust to endure the flow measurements. The average fluorescence intensities within each channel area are also plotted in Fig. 9 in terms of relative time t. We observed fluorescence in the corresponding channel within 20 s of the PSA solution replacing the DI water in the top channel after the observation between t = 520 and 540. DI water replaced the PSA solution between t = 640 and 660, and we again observed slight fluorescence similar to the initial level. The on-off ratio of the fluorescence intensity reached almost 10 in the present observations. The advantage of using microfluidics is that it requires only a small amount of sample: a sample of several µL is sufficient for an examination. Our observations also reveal the robustness of the aptamer fixation through pyrene linker. The signal can be repeatedly observed, which indicates that the tethered probe is not washed away by the alternating flow of DI water and PSA solution. This suggests that the sensor is useful for the continuous monitoring of the target in addition to static examinations.
ACS Paragon Plus Environment
Page 7 of 9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Sensors †Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 6691337 Japan
Funding Sources This work was supported in part by JSPS KAKENHI Grant Number 26286018.
Notes The authors declare no competing financial interest.
REFERENCES
Figure 9. The fluorescence images of a graphene aptasensor under microfluidic conditions observed at (a): 520, (b): 580, (c): 680 s, respectively. The sensor has two channels both of which are filled with DI water at the initial stage (relative time < 520 s), where only the top channel is replaced by 100 µg/mL PSA solution (after the observation at 520 s) and DI water (after the observation at 640 s). The dotted lines indicate the microchannel borders. The plot is the average fluorescence intensities of the top and bottom channel areas over time.
CONCLUSIONS We prepared and demonstrated the first graphene FRET aptasensor. This was achieved by extending our previous technology for the development of a GO aptasensor fixed on a solid support. The target protein, in the present case PSA, was successfully detected by the graphene aptasensor. The fluorescence response was quantitatively compared by simultaneous observations of the responses of both graphene and GO aptasensors prepared on the same chip. We estimated that the sensitivity of the graphene FRET aptasensor was more than three times that of the GO aptasensor. Taking advantage of the graphene FRET aptasensor homogeneously covering a substrate, we combined microfluidics technology with the graphene aptasensor. We demonstrated graphene FRET aptasensor operation under flow conditions in the microchannels, and it exhibited a good time response (within 20 s) and repeated detection. Our experimental design with a mulitichannel configuration also has an advantage in that we can use one channel as an internal reference. This makes our graphene FRET aptasensor even more suitable for the quantitative comparison of multiple samples.
AUTHOR INFORMATION Corresponding Author * E-mail:
[email protected]. Tel: +81-46-2403551; Fax: +81-46- 270-2364
Present Address
(1) Novoselov, K. S.; Geim, A. K.; Morozov, S. V.; Jiang, D.; Zhang, Y.; Dubonos, S. V.; Grigorieva, I. V.; Firsov, A. A. Electric Field Effect in Atomically Thin Carbon Films. Science 2004, 306, 666–669. (2) Zhang, Y.; Tan, Y.-W.; Stormer, H. L.; Kim, P. Experimental observation of the quantum Hall effect and Berry’s phase in graphene. Nature 2005, 438, 201–204. (3) Novoselov, K. S.; Jiang, Z.; Zhang, Y.; Morozov, S. V.; Stormer, H. L.; Zeitler, U.; Maan, J. C.; Boebinger, G. S.; Kim, P.; Geim, A. K. Room Temperature Quantum Hall Effect in Graphene. Science 2007, 315, 1379. (4) Geim, A. K.; Novoselov, K. S. The rise of graphene. Nat. Mater. 2007, 6, 183–191. (5) Castro Neto, A. H.; Guinea, F.; Peres, N. M. R.; Novoselov, K. S.; Geim, A. K. Rev. Mod. Phys. 2009, 81, 109–162. (6) Dreyer, D. R.; Ruoff, R. S.; Bielawski, C. W. From Conception to Realization: An Historial Account of Graphene and Some Perspectives for Its Future. Angew. Chem. Int. Ed. 2010, 49, 9336– 9344. (7) Park, S.; Ruoff, R. S. Chemical methods for the production of graphenes. Nat. Nanotech. 2009, 4, 217–224. (8) Zhu, Y.; Murali, S.; Cai, W.; Li, X.; Suk, J. W.; Potts, J. R.; Ruoff, Graphene and graphene oxide: synthesis, properties, and applications. R. S. Adv. Mater. 2010, 22, 3906–3924. (9) Dreyer, D. R.; Park, S.; Bielawski, C. W.; Ruoff, R. S. The chemistry of graphene oxide. Chem. Soc. Rev. 2010, 39, 228–240. (10) Loh, K. P.; Bao, Q.; Eda, G.; Chhowalla, M. Graphene oxide as a chemically tunable platform for optical applications. Nat. Chem. 2010, 2, 1015–1024. (11) Treossi, E.; Melucci, M.; Liscio, A.; Gazzano, M.; Samorì, P.; Palermo, V. High-contrast visualization of graphene oxide on dye-sensitized glass, quartz, and silicon by fluorescence quenching. J. Am. Chem. Soc. 2009, 131, 15576–15577. (12) Liu, F.; Choi, J. Y.; Seo, T. S. Graphene oxide arrays for detecting specific DNA hybridization by fluorescence resonance energy transfer. Biosensors and Bioelectronics 2010, 25, 2361– 2365. (13) Lu, C.-H.; Yang, H.-H.; Zhu, C.-L.; Chen, X.; Chen, G.-N. A graphene platform for sensing biomolecules. Angew. Chem. Int. Ed. 2009, 48, 4785–4787. (14) Chang, H.; Tang, L.; Wang, Y.; Jiang, J.; Li, J. Graphene fluorescence resonance energy transfer aptasensor for the thrombin detection. Anal. Chem. 2010, 82, 2341–2346. (15) Dong, H.; Gao, W.; Yan, F.; Ji, H.; Ju, H. Fluorescence Resonance Energy Transfer between Quantum Dots and Graphene Oxide for Sensing Biomolecules. Anal. Chem. 2010, 82, 5511–5517. (16) Huang P.-J. J; Liu, J. Molecular beacon lighting up on graphene oxide. Anal. Chem. 2012, 84, 4192–4198. (17) Lu, C.-H.; Li, J.; Lin, M.-H.; Wang, Y.-W.; Yang, H.-H.; Chen, X.; Chen, G.-N. Amplified aptamer-based assay through catalytic recycling of the analyte. Angew. Chem., Int. Ed. 2010, 49, 8454–8457. (18) Song, Y.; Qu, K.; Zhao, C.; Ren, J.; Qu, X. Graphene oxide: intrinsic peroxidase catalytic activity and its application to glucose detection. Adv. Mater. 2010, 22, 2206–2210.
ACS Paragon Plus Environment
ACS Sensors
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
(19) Wang, Y.; Li, Z.; Hu, D.; Lin, C.-T.; Li, J.; Lin, Y. Aptamer/graphene oxide nanocomplex for in situ molecular probing in living cells. J. Am. Chem. Soc. 2010, 132, 9274–9276. (20) Jung, J. H.; Cheon, D. S.; Liu, F.; Lee, K. B.; Seo, T. S. A Graphene Oxide Based Immuno‐biosensor for Pathogen Detection. Angew. Chem. Int. Ed. 2010, 49, 5708–5711. (21) Bock, L. C.; Griffin, L. C.; Latham, J. A.; Vermaas, E. H.; Toole, J. J. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 1992, 355, 564–566. (22) Wang, Y.; Li, Z.; Wang, J.; Li, J.; Lin, Y. Graphene and graphene oxide: biofunctionalization and applications in biotechnology. Trends in Biotech. 2011, 29, 205–212. (23) Liu, A.; Liu, B.; Ding, J.; Liu, J. Fluorescence sensors using DNA-functionalized graphene oxide. Anal. Bioanal. Chem. 2014, 406, 6885–6902. (24) Tang, L; Wang, Y, Li, J.The graphene/nucleic acid nanobiointerface. Chem. Soc. Rev. 2015, 44, 6954–6980. (25) Furukawa, K.; Ueno, Y.; Tamechika, E.; Hibino, H. Protein recognition on single graphene oxide surface fixed on solid support. J. Mater. Chem. B 2013, 1, 1119–1124. (26) Ueno, Y.; Furukawa, K.; Matsuo, K.; Inoue, S.; Hayashi, K.; Hibino, H. Molecular design for enhanced sensitivity in FRET aptasensor built on graphene oxide surface. Chem. Comm. 2013, 49, 10346–10348. (27) Ueno, Y.; Furukawa, K.; Matsuo, K.; Inoue, S.; Hayashi, K.; Hibino, H. On-chip graphene oxide aptasensor for multiple protein detection. Anal. Chim. Acta 2015, 866, 1–9. (28) Ueno, Y.; Furukawa, K.; Tin, A.; Hibino, H. On-chip FRET Graphene Oxide Aptasensor: Quantitative Evaluation of Enhanced Sensitivity by Aptamer with a Double-stranded DNA Spacer. Anal. Sci. 2015, 31, 875-879. (29) Li, X.; Cai, W.; An, J.; Kim, S.; Nah, J.; Yang, D.; Piner, R.; Velamakanni, A.; Jung, I.; Tutuc, E.; Banerjee, S. K.; Colombo, L.; Ruoff, R. S. Large-area synthesis of high-quality and uniform graphene films on copper foils. Science 2009, 324, 1312–1314. (30) Li, X. S.; Magnuson, C. W.; Venugopal, A; Tromp, R. M.; Hannon, J. B.; Vogel, E. M.; Colombo, L.; Ruoff, R. S. Large area graphene single crystals grown by low pressure chemical vapor deposition of methane on copper. J. Am. Chem. Soc. 2011, 133, 2816–2819. (31) Hummers, W. S.; Offeman, R. E. Preparation of Graphitic Oxide. J. Am. Chem. Soc. 1958, 80, 1339. (32) Chen, R. J.; Zhang, Y.; Wang, D.; Dai, H. Noncovalent Sidewall Functionalization of Single-Walled Carbon Nanotubes for Protein Immobilization. J. Am. Chem. Soc. 2001, 123, 3838– 3839. (33) Walker, G. M.; Beebe, D. J. A passive pumping method for microfluidic devices. Lab Chip 2002, 2, 131–134. (34) Kudin, K. N.; Ozbas, B.; Schniepp, H. C.; Prud’homme, R. K.; Aksay, I. A.; Car, R. Raman spectra of graphite oxide and functionalized graphene sheet. Nano Lett. 2008, 8, 36–41. (35) Swanthi, R. S.; Sebastiana, K. L. Resonance energy transfer from a dye molecule to graphene. J. Chem. Phys. 2008, 129, 054703. (36) Swanthi, R. S.; Sebastiana, K. L. Long range resonance energy transfer from a dye molecule to graphene has (distance)-4 dependence. J. Chem. Phys. 2009, 130, 086101.
ACS Paragon Plus Environment
Page 8 of 9
Page 9 of 9
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47
ACS Sensors
Sample with Target Protein Reference
Graphene FRET Aptasensor with microchannel device
For TOC only ACS Paragon Plus Environment
