HER2 Dual-Targeting

Subscriber access provided by University of Winnipeg Library

Article

Discovery of Non-peptide, Reversible HER1/HER2 Dual-Targeting Small Molecule Inhibitors as NIR Fluorescent Probe for Efficient Tumor Detection, Diagnostic Imaging and Drug Screening Shengnan Liu, Weijie Song, Xiangqian Gao, Yanxin Su, Emily Gao, and Qingzhi Gao Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b04633 • Publication Date (Web): 21 Dec 2018 Downloaded from http://pubs.acs.org on December 21, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Discovery of Non-peptide, Reversible HER1/HER2 Dual-Targeting Small Molecule Inhibitors as NIR Fluorescent Probe for Efficient Tumor Detection, Diagnostic Imaging and Drug Screening

Shengnan Liu1, Weijie Song2, Xiangqian Gao3, Yanxin Su1, Emily Gao4, and Qingzhi Gao*1,2

1. School of Life Sciences, Health Science Platform, Tianjin University, 92 Weijin Road, Nankai District, Tianjin 300072, P. R. China 2. Tianjin Key Laboratory for Modern Drug Delivery & High-Efficiency, Collaborative Innovation Center of Chemical Science and Engineering, School of Pharmaceutical Science and Technology, Tianjin University, 92 Weijin Road, Nankai District, Tianjin 300072, P. R. China 3. Department of Biology, Gudui BioPharma Technology Inc., 5 Lanyuan Road, Huayuan Industrial Park, Tianjin 300384, P. R. China 4. UCI School of Biological Sciences, University of California, Irvine, Irvine, CA 92697 Corresponding Author * Tel: +86 135-1247-9137. Fax: +86 22-2789-2050. E-mail: [email protected]

1

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

ABSTRACT The abnormal expression of epidermal growth factor receptors HER1(EGFR) and HER2 is strongly associated with cancer invasion, metastasis, and angiogenesis. Their molecular detection is mainly executed using genetically-encoded or antibody-based diagnostic tracers, but no dual-targeting small molecule bioprobe has been achieved. Here, we report the novel small molecule fluorescent probes CY3-AFTN and Cy5-AFTN as potent dual-targeting inhibitors for efficient detection of HER1/HER2 expression in cancer cells and in vivo tumor diagnostic imaging. Unlike the irreversible HER1/HER2 inhibitors, Cy3-AFTN and Cy5-AFTN were designed as reversible/noncovalent probes based on the clinical drug: afatinib, by making the molecule structurally impossible for receptor-mediated Michael additions. The synthesized probes were validated with live cell fluorescence imaging, flow cytometry and confocal-mediated competitive binding inhibition, molecular docking study, and in vivo xenograft tumor detection. The probes are competitively replaceable by other HER1/HER2 inhibitors, thus they are potentially useful in fluorometric high-throughput screening for drug discovery.

KEYWORDS: EGFR, HER1, HER2, fluorescent probe, dual-targeting, tumor imaging

2


Page 3 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Human epidermal growth factor receptors HER1(EGFR) and HER2 as two of the most important tumor-drug targets both play essential roles in regulating cancer cell proliferation, invasion, differentiation and migration. Overexpression and aberrant activities of HER1 and HER2 have been found to be associated with a number of cancers, including non-small cell lung cancer (NSCLC),1 breast cancer,2,3 ovarian cancer4 and many other phenotypes of malignant tumors.5,6 Afatinib, as a dual HER1 and HER2 kinase inhibitor, has been successfully developed by scientists of Boehringer Ingelheim and approved as first-line treatment for metastatic NSCLC by FDA in 2013. The broad spectrum anticancer activities and unique irreversible action mechanism of afatinib have been postulated to be associated with its dual-targeting of the two key-receptors (HER1/HER2) when compared with first-generation HER1 or HER2 single-targeted tyrosine kinase inhibitors (TKIs). Furthermore, dual inhibitions of HER1 and HER2 with afatinib also provide an additional benefit of treating specific types of NSCLC that harbor EGFR mutations (e.g. Del19 or L858R), which cause drug resistances and remain a major challenge for current clinical oncology.7 Many different approaches have been reported to develop HER1 and HER2 single-targeted theranostic bioimaging probes. Amongst these achievements, genetically-encoded fluorescent biosensors and antibody- or peptidomimetics-mediated EGFR diagnostic tracers have continued to make significant progresses in the field as many of the antibody- or peptide-coupled positron emission tomography (PET) and single-photon emission computed tomography (SPECT) imaging agents have been successfully developed and tested in different stages of clinical trials.8-12 Conversely, despite the generation and evaluation of numerous novel TKIs, there are only a limited number of reports on non-genetic and non-peptide small molecule bioprobes that target TKs or their cell surface receptors.13-16 Yet, there was no reports, to our knowledge, on HER1/HER2 dual-targeted small molecule imaging agents. Compared to the “large molecule” imaging agents, a rationally designed TK selective small molecule bioprobe would be particularly useful as a rapid readout to monitor changes in expression profile of TKs as well as their reversible response to the biotargets, if any, that enables biological activity prediction of new compounds for high throughput new drug discovery and 3



Page 4 of 23

screening. In this study, we report the first example of non-genetic, non-peptide small molecule fluorescent probes as HER1/HER2 dual-targeting inhibitors for their synthesis, HER1 and/or HER2 selective live cell imaging and HER1/HER2 dual-targeted tumor detection. As above-mentioned, afatinib has been characterized to be HER1/HER2 dual-targeting TKI. T enamide functionality of afatinib undergoes Michael addition with the cysteine residues from receptor side to form a covalent adduct that makes afatinib irreversibly bind to and inhibit HER1 and HER2.17,18 Compared to the irreversible suicide-type inhibitors, noncovalent binding probes may provide extra benefit as they are applicable in fluorescence-based competitive drug screening. Therefore, our strategy in the current study is driven by the following objectives: 1) based on the chemical structure of afatinib, to design HER1/HER2 dual-targeting small molecule fluorescent probes for efficient EGFR detection and tumor imaging, 2) to develop “reversible noncovalent” type of dual-targeting probes by making the molecule structurally impossible for Michael addition. The design concept has been illustrated in Figure 1. To avoid Michael addition attack, a glycine promoiety was introduced between afatinib core structure and the enamide functional group, thereby, making the probes regiochemically unable to accept the neucleophilic approach. Furthermore, cyanine fluorophores were conjugated through a long flexible side-chain by keeping it away from binding pharmacophores of the afatinib ligand. This conjugation circumvented potential interference of the fluorophore to the binding affinity of the probes with the receptors. With this strategic molecular design, we anticipate that the fluorescent probes will preserve “structural inheritance” from afatinib on selective interactions with the dual-targets and would be potentially effective in HER1 and/or HER2 overexpressing tumorimaging and diagnosis.

4


Page 5 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1

EXPERIMENTAL SECTION Materials and Instrumentation. Afatinib was purchased from Suzhou Chiral Pharmaceutical Co., Ltd. (China). Cyanine 3 (Cy3) and Cyanine 5 (Cy5) carboxylic acid were synthesized according to the reported procedures. All other chemicals were obtained from commercial suppliers and were used as received. NMR spectra were recorded with a Bruker Avance 400 or 600 MHz spectrometer for 1H and 13C at the School of Pharmaceutical Science and Technology of Tianjin University, PRC. NMR data were reported as chemical shifts (δ) in parts per million (ppm) relative to the solvent peak. Scalar coupling constants (J) were reported in units of hertz (Hz). The fluorescence spectrum was measured using a Varioskan LUX Multimode Microplate Reader (Thermo Fisher Scientific). High resolution mass spectra (HRMS, m/z) were recorded on a Bruker MicroTOF spectrometer using positive (ESI+). Realtime fluorescence quantitative PCR was performed on the QuantStudio™ 6 Flex Real-Time PCR Applied Biosystems. 5



Page 6 of 23

Synthesis of Cy3-AFTN and Cy5-AFTN. As shown in Scheme S1, start with the key intermediate

of

6-Amino-4-[(3-chloro-4-fluorophenyl)amino]-7-[(S)-(tetrahydrofuran-3-yl)oxy]quinazoline

(1)

which constitutes the core pharmacophores for afatinib to be recognized by HER1 and HER2. The glycine inserted compound (4) was prepared using Boc-protected glycine in the presence of triethyl amine and 2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetramethyl uronium tetrafuoroborate (TBTU) as a coupling reagent, followed by trifluoroacetic acid catalyzed deprotection. The desired Cy3-AFTN and Cy5-AFTN were synthesized from 4 with the Cy3- and Cy5-derived chromophore intermediates (5) using the same coupling reaction conditions. The Cy3-AFTN was afforded as a dark-purple amorphous solid, and the Cy5-AFTN was obtained as a dark-blue amorphous solid. All new compounds were unambiguously characterized by 1H-NMR and

13C-NMR

spectroscopy as well as

electrospray ionization (ESI) mass spectrometry (see Supporting Information for details). Cell Lines and Cell Culture. Three tumor cell lines, A549, SKOV3, and MCF-7 cells used in the present study, were all purchased from ATCC.

SKOV3 and MCF-7 cells were cultured in

Dulbecco’s modified Eagle’s medium (DMEM 1x, High Glucose; Gibco, Invitrogen) and supplemented with 10% fetal bovine serum (FBS; Gibco, Invitrogen) and 1% penicillin/streptomycin solution (Gibco, Invitrogen) in humidified atmosphere with 5% CO2. A549 cells were cultured in RPMI 1640 medium (High Glucose; Gibco, Invitrogen) with 10% fetal bovine serum under a 5% CO2 environment. Quantitative RT-PCR Analysis and Cytotoxicity Study. The mRNA sequences of the HER1 [GenBank: NM_057410.4 (human)], HER2 [GenBank: NM_004448.3 (human)], and the housekeeping gene GAPDH [GenBank: NM_002046.5 (human)] were obtained from the nucleotide database at the National Center for Biotechnology Information (NCBI) website. Oligonucleotide primers were designed using Primer-Blast and are listed in Table 1. Human tumor cell lines A549, SKOV3, and MCF-7 cells were seeded in 6-well plates and cultured for 48 h. Total RNA was extracted from cells using a Trizol RNA extraction kit (Tiangen Biotech, Beijing, China) from cells, and was dissolved in diethylpyrocarbonate (DEPC)-treated water. Protocols for total RNA purification were followed as described by the manufacturer. The cDNA was synthesized from the total RNA by using a Transcriptor First Strand cDNA Synthesis Kit (Roche). Isolated DNA samples 6


Page 7 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were diluted to 0.2 µg/mL with nuclease-free water and used as template in qPCR. PCR runs were performed in a volume of 20 µL qPCR reaction system contained 2 µL cDNA, 1 µL of 10 µmol primer pairs, 10 µL of Master Mix, and 6 µL PCR Grade water. Subsequent qPCR analyses were performed on the LightCycler 96 Real-Time PCR System (Roche Diagnostics, Mannheim, Germany) using the two step amplication qPCR method. Table 1 Target gene

5’ primer

3’ primer

HER1(Human)

GACAGGCCACCTCGTCG

CCGGCTCTCCCGATCAATAC

HER2(Human)

TAGGGTTAAGGGAAGGCGGA

CATGGGGAAGCAATCACCCT

GAPDH(Human)

CCCACTCCTCCACCTTTGAC

CATACCAGGAAATGAGCTTGA

The cytotoxicity determination of the probes were performed using MTT method following the procedure described in the in the Supporting Information. Assessment of HER1 and HER2 Protein Expression. To investigate the HER1 and HER2 expression level in tumor cells, Western blotting analysis was performed. Briefly, HER1 and HER2 protein extraction were prepared in RIPA Lysis Buffer. The detergent soluble protein samples were separated on a 6% SDS-polyacrylamide gel and transferred onto 0.45 m pore size polyvinylidene difluoride (PVDF) membranes (GE healthcare) for 1.5 h at 23 V in transfer buffer (1x: 25 mM Tris, 192 mM glycine, pH 8.3). Membranes were blocked with blocking solution (5% non-fat milk/Tris-buffered saline/0.1% Tween 20) for 1 h at 4°C, followed by incubation of primary antibodies (HER1, HER2 and β-actin), diluted in blocking solution overnight at 4°C. On the next day, the membranes were washed three times with Tris-Buffered Saline + Tween 20 (TBST) (0.1% Tween-20), and incubated in the fluorescent secondary antibody diluted in TBST for 1 h. Fluorescence detection was visualized by chemiluminescence (Thermo Scientific Pierce ECL Western Blotting), and protein expression levels were quantified by densitometry analysis using Quantity One software (BioRad). Confocal Fluorescence Imaging Analysis. For confocal fluorescence imaging analysis, approximately 5×104 cells (1 mL) were seeded into culture dishes and cultured overnight. Subsequently, cells were divided to “afatinib pre-treatment group” and “probe treatment group”. For 7



Page 8 of 23

“afatinib pre-treatment group”, cells were first treated with 30 nM afatinib (final concentration) and cultured at 37°C for 60 min. Then all groups were treated with 30 nM of Cy3-AFTN and 30 nM Cy5-AFTN respectively at 37°C for 60 min. Before imaging analysis, the adherent cells were washed three times with cold PBS, and followed by counterstained with 1000 ng/ml 4, 6-diamidino-2-phenylindole (DAPI, Solarbio) at room temperature for 5 min. Then cell imaging was conducted on an Olympus FV1000-IX81 confocal-laser scanning microscope with 488 nm and 641 nm excitation respectively for Cy3-AFTN and Cy5-AFTN through a 100 × 1.4 NA oil immersion objective lens. Emission was collected between 520 nm and 674 nm. All parameters of the microscope were set to be the same for all samples to allow parallel comparisons of the compounds. Flow Cytometry. Different cells (A549, SKOV3, MCF7) were prepared using 12 well plates and were seeded at 1×104 cells/well. After 24 h incubation at 37°C, cells were divided to different groups pretreated with and without Cy3-AFTN (10 μM) for 60 min. Then cells were washed with cold PBS for three times and respectively further treated with 10 μM afatinib cultured at 37°C for 60 min. Afterwards, cells were washed with cold PBS for three times, detached by trypsin-EDTA (Gibco) and centrifuged. Cell pellets were resuspended in 1.0 mL PBS and were detected by flow cytometers (BD Bioscience). Data was analyzed by using FlowJo software. In vivo Fluorescence Imaging. All animal experiments were carried out in compliance with the Animal Management Rules of the Ministry of Health of the People's Republic of China. Male 4 to 6 week-old athymic nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. A549 cells (8 × 106) were injected subcutaneously into the lower back of the nude mice (n = 3). When tumor size reached 0.3- 0.4 cm in diameter, mice were used for NIR imaging and probe treatment. To investigate the dynamic distribution and tumor targeting ability of Cy3-AFTN in nude mice, Cy3-AFTN (0.05 mg/mouse) and the negative control (PBS) were injected intravenously though tail vein. The fluorescence imaging was performed at various time points post-injection using Xenogen IVIS in vivo imaging system. Image analysis is performed by the living image software complemented with the imaging system (ex. 540 ± 10 nm and em. 560 ± 20 nm). After completion of the experiment, the nude mice were sacrificed and the main organs as well as tumors were harvested. The fluorescence images of these organs were individually taken as above. 8


Page 9 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS AND DISCUSSION Synthesis and Characterization of Cy3-AFTN and Cy5-AFTN. The synthesis of the afatinib-based fluorescent probes Cy5-AFTN is presented in Scheme S1. The key intermediate 6-Amino-4-[(3-chloro-4-fluorophenyl)amino]-7-[(S)-(tetrahydrofuran-3-yl)oxy]quinazoline (1) was prepared following a reported method.19 Boc-protected glycine was used to couple with the amino group of compound 1 with 2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetramethyl uronium tetrafuoroborate (TBTU) as coupling reagent in the presence of triethylamine at 30°C to afford the desired compound of 3. After deprotection of the Boc group, the free amine compound 4 was obtained after purification by chromatography on silica gel with dichloromethane/methanol as eluent. Fluorophore containing compound 5 was prepared starting with commercially available cyanine 3 and cyanine 5 though amidation reaction employing N, N-disuccinimidyl carbonate (DSC) as coupling reagent in dimethylformamide (DMF) in the presence of diisopropylethylamine under an argon atmosphere at ambient temperature. The desired target compounds Cy3-AFTN (6) and Cy5-AFTN (7) were synthesized by employing the same TBTU coupling reagent and other conditions as described for compound 3. After silica-gel mediated chromatography purification, the Cy3-AFTN was obtained as a dark-purple amorphous solid, while Cy5-AFTN was as a dark-blue amorphous powder. All new compounds produced were unambiguously characterized by 1H-NMR and 13C-NMR spectroscopy as well as electrospray ionization (ESI) mass spectrometry (see Figure S1-S12 and Supporting Information for detailed procudures).

The obtained fluorescent probes were also photophysically

characterized in PBS containing a minimum amount (< 0.5% v/v) of DMSO using Varioskan LUX Multimode Microplate Reader (Thermo Fisher Scientific). As depicted in Figure S13-S16, there were no significant changes both in the UV-vis and fluorescence spectra (excitation and emission) between the starting materials (Cy3 and Cy5) and the corresponding afatinib-derived bioprobes (Cy3-AFTN and Cy5-AFTN). This is in agreement with the design concept that the fluorophores are kept separately on both ends of the molecule by a flexible side chain. Therefore, their physical and chemical properties will not be affected by each other. HER1/HER2 Expression Analysis of Tested Tumor Cell Lines. To assess the in vitro HER1/HER2 targeting ability and the reversible receptor binding property of the probes, three 9



Page 10 of 23

different cell lines were selected based on their intrinsic HER1 and HER2 expression levels. Namely, the HER1 highly overexpressing A549 human lung cancer cells,20 both HER1 and HER2 overexpressing SKOV3 human ovarian carcinoma cells,21,22 and the HER2 highly overexpressing MCF-7 human breast cancer cell lines.23 The actual expression levels of HER1 and HER2 in these selected cancer cells were further confirmed by qPCR analysis and Western blot mediated gene expression assessment. As shown in Figure 2, A549 cells exhibit an elevated level both on mRNA trascription and protein synthesis for HER1. The similar result observed for MCF-7 cells that the expression of HER2 is significantly elevated in this cell line compared to HER1. For SKOV3, both HER1 and HER2 overexpression has been recorded, and the result revealed that this cancer cell line exhibits the highest HER2 expression level among the three cell lines.

Figure 2

Competitive Inhibition of HER1/HER2 Specific Binding. To elucidate the reversible binding characteristics as well as the binding specificity of the probe, competitive replacement studies using afatinib (the irreversible dual-targeting TKI) were conducted. Flow cytometry mediated mean fluorescence intensity (MFI) analysis was performed for quantitative evaluation of the tumor (HER1/HER2) targeting ability of the probe. 24 h precultured A549, SKOV3 and MCF-7 cells in 12 well plates were treated with or without Cy3-AFTN (10 μM) at 37°C for 60 min. After washing with cold PBS for three times, all cells were subsequently treated with 10 μM of the irreversible HER1/HER2 dual-targeting inhibitor afatinib and further incubated for 60 min. At the end of the 10


Page 11 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


experiment, growth media were removed and cells were washed with cold PBS, then detached from culture vessels using trypsin-EDTA. After centrifugation, all cell pellets were resuspended in 1.0 mL PBS and subjected to flow cytometry determination. Untreated cells (MOCK) were used as negative control for blank fluorescence background deduction. As depicted in Figure 3B, MFI levels of Cy3-AFTN in different cell lines are correlated with the expression level of HER1/HER2 receptors. For instance, SKOV3 recorded with highest probe binding (MFI=173) compared to other two cell lines as SKOV3 overexpresses both HER1 and HER2. This result is also supported by the cytotoxicity assay of the synthesized probes in selected three cancer cell lines (Figure S17 and Table S1, see supporting information). Lowest IC50 values were detected for both Cy3- and Cy5-AFTN against SKOV3 accordingly to its high expression level for both HER1 and HER2. The non-covalent reversible binding properties of the designed probes were confirmed by this experiment. As shown in Figure 3C, significant decrease in MFI was observed for all Cy3-AFTN treated cells after conpetitive treatment with the native HER1/HER2 inhibitor afatinib. This is indicating that the binding mode of the designed probes was a non-covalent interaction with the ligand-binding domains as they can competitively be replaced by other inhibitors. Such reversible binding property of the designed probes may further provide possibilities for HER1/HER2 dual-targeted drug screening with higher throughput competitive fluorometric assay. To contribute to a cell-based drug screening method, more detailed survey and validations including the sensitivity of the probe, time course for the dye treatment and competitive drug incubation, need to be thoroughly reinvestigated.

11



Page 12 of 23

Figure 3

Confocal Microscopy-mediated Competitive Blocking Study. To further demonstrate the synthesized probes are HER1 and HER2 specific inhibitors, we conducted a competitive blocking study by using confocal laser microscopy analysis. A549, MCF-7 and SKOV3 cells were preincubated with the native inhibitor afatinib (30 nM) at 37°C for 60 min, afatinib will therefore irreversibly occupy the binding site of HER1 and HER2 by forming a covalent adduct with the receptors.24 Compared to aforementioned competitive replacement study, this experiment can verify whether the synthesized fluorescent probes are sharing the same interaction pocket or binding site with the parent compound (afatinib), because the competitive blockade will only happen when the probes are sharing the same binding domain and recognized by the same binding site with the native inhibitor. Based on this hypothesis, A549, SKOV3 and MCF-7 cells were first pretreated with the native inhibitor afatinib, followed by treatment with Cy3- and Cy5-AFTN probes. The differences of 12


Page 13 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


receptor binding and cellular internalization of the probes were analyzed and compared between the “afatinib pre-treatment group” and the cells treated with probe alone. According to the experimental protocol, cells were precultured in 6-well plates for 12 h to achive 60% confluence before drug treatment. For the “afatinib pre-treatment group”, cells were first treated with 30 nM afatinib at 37°C for 60 min. Then all cells were subjected to further treatment with 30 nM Cy3-AFTN and Cy5-AFTN respectively 37°C for another 60 min. Before confocal analysis, cells were washed three times

with

cold

PBS,

and

followed

by

counterstained

with

1000

ng/mL

4,

6-diamidino-2-phenylindole (DAPI, Solarbio) at room temperature for 5 min. All fluorescence signals were collected using Olympus FV1000-IX81 confocal-laser scanning microscope at 500-700 nm. As shown in Figure 4, intense fluorescence emission of the internalized probes was observed from Cy3- and Cy5-AFTN treated cells (A549, SKOV3 and MCF-7). With afatinib pre-treatment group, the fluorescence intensity of the probes deminished significantly for all tested cell lines (Figure 4, afatinib+Cy3-AFTN and afatinib+Cy5-AFTN). This result proved that afatinib pre-treatment obviously impeded the receptor binding, internalization and cytoplasmic diffusion of the probes in the HER1 and HER2 expressing cells, indicating that the probes sharing the same binding targets, that is, HER1 and HER2, with afatinib. As transmembrane protein, with ligand binding, both HER1 and HER2 have been proven can move to endoplasmic reticulum, mitochondrion or even traffick to nucleus depends upon different activation mode and cell contexts.25 From our current result, the 60 min ligand incubation (afatinib and Cy3- and Cy5-AFTN) have caused remarkable cytoplasmic diffusion of the receptors, which was visualized from the distribution of bound fluorescent probes. Based on this result, we anticipate that these two probes are potentially useful as biological tools to evaluate intracellular receptor trafficking and/or molecular mechanisms of HER1/HER2 mediated cellular signaling process, as well as the receptor degradation/metabolization kinetics.

13



Page 14 of 23

Figure 4

Comparative Molecular Docking Analysis. Further experiments were aimed at understanding the binding modes of the synthesized probes with the targeted HER1 and HER2 receptors. In this respect, molecular docking simulation was carried out utilizing SYBYL Surflex-Dock as a robust and fully automatic flexible molecular docking tool (See Supporting Information P-S16).26 The crystal structure of afatinib bound human HER1 (EGFR, PDB code: 4G5J) was obtained from the protein data bank (PDB; http://www.rcsb.org/pdb/) as the 3D structure of a complex between afatinib and the ligand-binding domain of EGFR has been solved by crystallography.27 For HER2, a crystal structure of the kinase domain of HER2 in complex with a HER2/HER1 dual inhibitor 2-{2-[4-({5-chloro-6-[3-(trifluoromethyl)phenoxy]pyridin-3-yl}amino)-5H-pyrrolo[3,2-d]pyrimidin14


Page 15 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5-yl]ethoxy}ethanol (PDB code: 3PP0) was used due to the fact that there was not successful capture of crystal structure for afatinib/HER2 complex.28 The initial 3D-structures for Cy3- and Cy5-AFTN were generated with SYBYL-X 2.0 software package and optimized using DFT calculations according to the methods described in Supporting Information. After extracting the corresponding bound ligands from the ligand/protein complex, Cy3- and Cy5-AFTN were flexibly docked into the active site using SurFlex-Dock GeomX protocol. After docking, 20 conformations as the top-ranked poses were present for each docked ligand, and the conformations with the high C_score values which integrate multiple types of scoring functions for ranking the affinity of ligands bound to a receptor,29 were compared with the native bound inhibitors. As shown in Figure 5A and 5B, both Cy3- and Cy5-AFTN were observed to share exactly the same binding pose with the native ligand (afatinib) in HER1, and the receptor-binding moiety of the probes aligned perfectly with the co-crystalized afatinib in the same binding sites. From the HER2 docking results, although the receptor recognition pattern of the probes were different with the native ligand, a high similarity of conformational alignment can be determined between the probes and the co-crystalized inhibitor as they are sharing the same binding site in the HER2 receptor (Figure 5C and 5D).

The docking

results revealed that the synthesized probes bearing the structural promoiety of afatinib can also be effectively recognized by HER1/HER2 receptors and act as high affinity ligands.

Figure 5

15



Page 16 of 23

In vivo Fluorescence Imaging of Cy3-AFTN in A549-Bearing Xenograft Mice. In order to assess the biodistribution and tumor targeting ability of the probe, human lung cancer xenograft model was used for optical in vivo imaging study. As test group, A549 cells were injected subcutaneously into the lower back of the nude mice (n = 3). 30 nmol/kg of single dose Cy3-AFTN was used for the optical imaging study. After drug injection, the distribution of Cy3-AFTN in lung cancer nude mouse models was monitored for up to 48 h by Xenogen IVIS in vivo imaging system at lateral, supine and prone positions. As shown in Figure 6, fluorescent signals of i.v. injected Cy3-AFTN in subcutaneous tumor tissues were clearly differentiated from the surrounding tissues from 12 h post-injection. Fluorescent signals in tumor tissues gradually increased and accumulated in tumor site, indicating Cy3-AFTN probe could selectively accumulate in the tumor tissue and efficiently target and identify A549 cancer cells in the xenograft model (Figure 6A, 6B). In addition, the ex vivo fluorescence imaging of major organs in test group shows that Cy3-AFTN mainly accumulated in the tumor tissue of xenograft mice. No obvious fluorescent signal was detected in the lung, spleen, heart and kidney organs of the tested mice, and weak fluorescent signals were found in the liver tissue of the xenograft model (Figure 6C, 6D). In this study, our results demonstrated that the HER1/HER2 dual-targeted probe Cy3-AFTN could effectively recognize and accumulate in A549 tumors in vivo. In addition to lung cancer xenograft model, nude mice with other HER1 and/or HER2 overexpress cancer cells were also prepared and a comprehensive study evaluating in vivo theranostic potentials for both probes is under way.

16


Page 17 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6

CONCLUSION Based on the irreversible HER1/HER2 dual inhibitor afatinib, we designed and synthesized the substrate-competitive (reversible) NIR fluorescent molecules Cy3-AFTN and Cy5-AFTN. Both probes exhibit cytotoxicities against the HER1 highly expressing A549, HER1 and HER2 co-overexpressing SKOV3, and HER2 overexpressing MCF-7 cell lines. Through in vitro and in vivo investigations, we identified Cy3-AFTN and Cy5-AFTN as potent theranostic probes for HER1 and/or HER2 over-expressing tumor cells and showed their potential in live cell and xenograft tumor imaging. Tumor targeting studies of the probes in A549 xenograft animals demonstrated that the dual-targeting probes are feasible for selective accumulation in xenograft tumors with a single dose administration. Based on the competitively replaceable property of the probes by other HER1/HER2 inhibitors, e.g. afatinib, the probes can potentially be further utilized for fluorometric high-throughput drug screening targeting such tyrosine kinase receptors. 17



Page 18 of 23

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at Supporting data include experimental details for preparation of the probes, NMR spectrum data of the key intermediates and probes, optical spectrum data of the probes, and cytotoxicity analysis results.

AUTHOR INFORMATION Corresponding Author * (Q.G.) E-mail: [email protected]. ORCID Qingzhi Gao: 0000-0001-5092-0487 Notes The authors declare no competing financial interest.

ACKNOWLEDGEMENTS We would like to thank Prof. Lizhi Mi of School of Life Sciences, Tianjin University, for his advice and discussion on the project planning. We would also like to thank Ms. Aijia Gao at Wake Forest University for her help to improve the English writing of the revised manuscript. This research was supported by grants from the National Key Research & Development (R&D) Program of China (2017YFD0201400, 2017YFD0201403), the Project of National Basic Research (973) Program of China (2015CB856500, 2015CB856504), and the National Natural Science Foundation of China (21772144). REFERENCES (1) Hirsch, F. R.; Varella-Garcia, M.; Cappuzzo, F. Predictive value of EGFR and HER2 overexpression in advanced non-small-cell lung cancer. Oncogene 2009, Suppl 1, S32-37. (2) Rimawi, M. F.; Shetty, P. B.; Weiss, H. L.; Schiff, R.; Osborne, C. K.; Chamness, G. C.; Elledge, R. M. Epidermal growth factor receptor expression in breast cancer association with biologic phenotype and clinical 18


Page 19 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


outcomes. Cancer 2010, 116, 1234-1242. (3) Burstein, H. J. The distinctive nature of HER2-positive breast cancers. N. Engl. J. Med. 2005, 353, 1652-1654. (4) Bartlett, J. M.; Langdon, S. P.; Simpson, B. J.; Stewart, M.; Katsaros, D.; Sismondi, P.; Love, S; Scott, W. N.; Williams, A. R.; Lessells, A. M.; Macleod, K. G.; Smyth, J. F.; Miller, W. R. The prognostic value of epidermal growth factor receptor mRNA expression in primary ovarian cancer. Br. J. Cancer 1996, 73, 301-306. (5) Day, K.C.; Lorenzatti Hiles, G.; Kozminsky, M.; Dawsey, S. J.; Paul, A.; Broses, L. J.; Shah, R.; Kunja, L. P.; Hall, C.; Palanisamy, N.; Daignault-Newton, S.; El-Sawy, L.; Wilson, S. J.; Chou, A.; Ignatoski, K. W.; Keller, E.; Thomas, D.; Nagrath, S.; Morgan, T.; Day, M. L. HER2 and EGFR overexpression support metastatic progression of prostate cancer to bone. Cancer Res. 2017, 77, 74-85. (6) Ooi, A.; Takehana, T.; Li, X.; Suzuki, S.; Kunitomo, K.; Iino, H.; Fujii, H.; Takeda, Y.; Dobashi Y. Protein overexpression and gene amplification of HER-2 and EGFR in colorectal cancers: an immunohistochemical and fluorescent in situ hybridization study. Mod. Pathol. 2004, 17, 895-904. (7) Mitsudomi, T.; Kobayashi, Y. Afatinib in lung cancer harboring EGFR mutation in the LUX-Lung trials: six plus three is greater than seven? Transl. Lung Cancer Res. 2016, 5, 446-449. (8) Henry, K. E.; Ulaner, G. A.; Lewis, J. S. Human epidermal growth factor receptor 2-targeted pet/single-photon emission computed tomography imaging of breast cancer: noninvasive measurement of a biomarker integral to tumor treatment and prognosis. PET Clin. 2017, 12, 269-288. (9) Warram, J. M.; de Boer, E.; Sorace, A. G.; Chung, T. K.; Kim, H.; Pleijhuis, R. G.; van Dam, G. M.; Rosenthal, E. L. Antibody-based imaging strategies for cancer. Cancer Metastasis Rev. 2014, 33, 809-822. (10) Yun, M.; Kim, D. Y.; Lee, J. J.; Kim, H. S.; Kim, H. S.; Pyo, A.; Ryu, Y.; Kim, T. Y.; Zheng, J. H.; Yoo, S. W.; Hyun, H.; Oh, G.; Jeong, J.; Moon, M.; Min, J. H.; Kwon, S. Y.; Kim, J. Y.; Chung, E.; Hong, Y.; Lee, W.; Kim, H. S.; Min, J. J. A high-affinity repebody for molecular imaging of EGFR-expressing malignant tumors. Theranostics 2017, 7, 2620-2633. (11) Kitamatsu, M.; Yamamoto, T.; Futami, M.; Sisido, M. Quantitative screening of EGF receptor-binding peptides by using a peptide library with multiple fluorescent amino acids as fluorescent tags. Bioorg. Med. Chem. Lett. 2010, 20, 5976-5978. (12) Ponde, D. E.; Su, Z.; Berezova, A.; Zhang, H.; Alavi, A.; Greene, M. I.; Murali, R. Development of anti-EGF receptor peptidomimetics (AERP) as tumor imaging agent. Bioorg. Med. Chem. Lett. 2011, 21, 2550-2553. (13) Blair, J. A.; Rauh, D.; Kung, C.; Yun, C. H.; Fan, Q. W.; Rode, H.; Zhang, C.; Eck, M. J.; Weiss, W. A.; Shokat, K. M. Structure-guided development of affinity probes for tyrosine kinases using chemical genetics. Nat. Chem. Biol. 2007, 3, 229-238. (14) Lee, H.; Liu, W.; Brown, A. S.; Landgraf, R.; Wilson, J. N. Fluorescent kinase probes enabling identification and dynamic imaging of HER2(+) cells. Anal. Chem. 2016, 88, 11310-11313. (15) Morris, M. C. Fluorescent biosensors-probing protein kinase function in cancer and drug discovery. Biochim. Biophys, Acta. 2013, 1834, 1387-1395. (16) Lee, H.; Landgraf, R.; Wilson, J. N. Synthesis and photophysical properties of a fluorescent cyanoquinoline probe for profiling ERBB2 kinase inhibitor response. Bioorg. Med. Chem. 2017, 25, 6016-6023. (17) Solca, F.; Dahl, G.; Zoephel, A.; Bader, G.; Sanderson, M.; Klein, C.; Kraemer, O.; Himmelsbach, F.; Haaksma, E.; Adolf, G. R. Target binding properties and cellular activity of afatinib (BIBW 2992), an irreversible ErbB family blocker. J. Pharmacol. Exp. Ther. 2012, 343, 342-350. (18) Nelson, V.; Ziehr, J.; Agulnik, M.; Johnson, M. Afatinib: emerging next-generation tyrosine kinase inhibitor for NSCLC. Onco. Targets. Ther. 2013, 6, 135-243. (19) Jain, A. N. Surflex: fully automatic flexible molecular docking using a molecular similarity-based search engine. J. Med. Chem. 2003, 46, 499-511. (20) Solca, F.; Dahl, G.; Zoephel, A.; Bader, G.; Sanderson, M.; Klein, C.; Kraemer, O.; Himmelsbach, F.; Haaksma, E.; Adolf, G. R. Target binding properties and cellular activity of afatinib (BIBW 2992), an irreversible ErbB family blocker. J. Pharmacol. Exp. Ther. 2012, 343, 342-350. (21) Aertgeerts, K.; Skene, R.; Yano, J.; Sang, B. C.; Zou, H.; Snell, G.; Jennings, A.; Iwamoto, K.; Habuka, N.; Hirokawa, A.; Ishikawa, T.; Tanaka, T.; Miki, H.; Ohta, Y.; Sogabe, S. Structural analysis of the mechanism 19



(22)

(23) (24)

(25) (26) (27)

(28) (29)

Page 20 of 23

of inhibition and allosteric activation of the kinase domain of HER2 protein. J. Biol. Chem. 2011, 286, 18756-18765. Zhang, L.; Yang, Y.; Zhou, H.; Zheng, Q.; Li, Y.; Zheng, S.; Zhao, S.; Chen, D.; Fan, C. Structure-activity study of quinazoline derivatives leading to the discovery of potent EGFR-T790M inhibitors. Eur. J. Med. Chem. 2015, 102, 445-463. Ding, L.; Tian, C.; Feng, S.; Fida, G.; Zhang, C.; Ma, Y.; Ai, G.; Achilefu, S.; Gu, Y. Small sized EGFR1 and HER2 specific bifunctional antibody for targeted cancer therapy. Theranostics 2015, 5, 378-398. DeFazio-Eli, L.; Strommen, K.; Dao-Pick, T.; Parry, G.; Goodman, L.; Winslow, J. Quantitative assays for the measurement of HER1-HER2 heterodimerization and phosphorylation in cell lines and breast tumors: applications for diagnostics and targeted drug mechanism of action. Breast Cancer Res. 2011, 13, R44. Wang, K.; Li, D.; Sun, L. High levels of EGFR expression in tumor stroma are associated with aggressive clinical features in epithelial ovarian cancer. OncoTargets Ther. 2016, 9, 377-386. Jain, A. N. Surflex-Dock 2.1: robust performance from ligand energetic modeling, ring flexibility, and knowledge-based search. J. Comput. Aided Mol. Des. 2007, 21, 281-306. Li, D.; Ambrogio, L.; Shimamura, T.; Kubo, S.; Takahashi, M.; Chirieac, L. R.; Padera, R. F.; Shapiro, G. I.; Baum, A.; Himmelsbach, F.; Rettig, W. J.; Meyerson, M.; Solca, F.; Greulich, H.; Wong, K. K. BIBW2992, an irreversible EGFR/HER2 inhibitor highly effective in preclinical lung cancer models. Oncogene 2008, 27, 4702-4711. Sebastian, S.; Settleman, J.; Reshkin, S. J.; Azzariti, A.; Bellizzi, A.; Paradiso, A. The complexity of targeting EGFR signalling in cancer: from expression to turnover. Biochim. Biophys. Acta. 2006, 1766, 120-39. Jain, A. N. Surflex-Dock 2.1: robust performance from ligand energetic modeling, ring flexibility, and knowledge-based search. J. Comput. Aided Mol. Des. 2007, 21, 281-306.

20


Page 21 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure captions Figure 1. Design concept of the reversible HER1/HER2 dual target fluorescent probes based on the irreversible HER1/HER2 inhibitor afatinib. (A) Strategy of the molecular design from irreversible afatinib to the afatinib-based reversible fluorescent probe. (B) Hypothesized binding mode of the probe and the anticipated mechanistic diagram.

Figure 2. The expression level of EGFR(HER1) and HER2 in A549, SKOV3 and MCF7 tumor cells. (A) qPCR analysis of EGFR/GAPDH in A549, SKOV3 and MCF7 cells. (B) qPCR analysis of HER2/GAPDH in A549, SKOV3 and MCF7 cells. (C) Western Blotting analysis of EGFR expressing in A549, SKOV3 and MCF7 cells. (D) Western Blotting analysis of HER2 expressing in A549, SKOV3 and MCF7 cells. The Western Blotting analysis for both EGFR and HER2 has been performed in one experiment.

Figure 3. Flow cytometry-mediated competitive replacement study of Cy3-AFTN with irreversible HER1/HER2 dual-targeting drug afatinib. (A) (C) (E) Mean fluorescence intensities (MFI) measured by flow cytometer for A549, MCF-7 and SKOV3 cells treated with blank, Cy3-AFTN and afatinib+Cy3-AFTN. (B) (D) (F) Binding inhibition effect between afatinib and Cy3-AFTN in A549, MCF-7 and SKOV3 cells. Bars represent mean ± SE. *** represents statistical differences (p

HER2 Dual-Targeting

Recommend Documents