Highly Sensitive and Selective Surface-Enhanced ... - ACS Publications

Subscriber access provided by UNIV OSNABRUECK

Article

Highly Sensitive and Selective SERS Label-free Detection of PCB-77 using DNA Aptamer Modified Ag-nanorod Arrays Kexi Sun, Qing Huang, Guowen Meng, and Yilin Lu ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.5b12866 • Publication Date (Web): 05 Feb 2016 Downloaded from http://pubs.acs.org on February 10, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Highly Sensitive and Selective SERS Label-free Detection of PCB-77 using DNA Aptamer Modified Ag-nanorod Arrays Kexi Sun1, Qing Huang*, 1,2, Guowen Meng,3 and Yilin Lu1 1

Key Laboratory of Ion Beam Bioengineering, Key Laboratory of Environmental Toxicology

and Pollution Control Technology of Anhui Province, Institute of Technical Biology and Agriculture Engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, China 2

3

University of Science & Technology of China, Hefei 230026, China Key Laboratory of Materials Physics and Anhui Key Laboratory of Nanomaterials and

Nanotechnology, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031, China

*corresponding author: [email protected]

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

ABSTRACT: An improved label-free approach for highly sensitive and selective detection of 3,3’,4,4’-tetrachlorobiphenyl (PCB-77), a type of polychlorinated biphenyls, via surfaceenhanced Raman spectroscopy (SERS) using DNA aptamer modified Ag-nanorod arrays as the effective substrate is reported. The devised system consists of Ag-nanorod (Ag-NR) arrays with the PCB-77 binding aptamers anchored covalently to the Ag surfaces through a thiol linker. The aptamers are made of single stranded DNA (ssDNA) oligomers with one end standing on the Ag surface, and upon conjugation with PCB-77, the ssDNA molecules can change their conformation to hairpin loops so that the Raman intensity of guanines at the other end of the DNA strand increases accordingly. As such, the intensity ratio I(656 cm-1) /I(733 cm-1) increases concomitantly with the increase of concentration of PCB-77, making the quantitative evaluation of trace amounts of PCB-77 attainable. Moreover, it is found that the DNA aptamer based AgNR arrays can be more responsive with a lower and optimal density of the DNA molecules modified on the substrate surface, and the best sensitivity for detection of PCB-77 can be achieved with the lower detection limit approaching 3.3×10-8 M. This work therefore demonstrates that the design of aptamer-modified Ag-NRs can be utilized as a practically promising SERS substrate for label-free trace detection of persistent organic pollutants (POPs) in the environment.

KEYWORDS: Surface enhanced Raman spectroscopy (SERS), label-free detection, aptamers, polychlorinated biphenyls, Ag nanorod arrays


2

Page 3 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Polychlorinated biphenyls (PCBs) are notorious classes of persistent organic pollutants (POPs) that threaten the ecosystem and cause significant toxicity to human beings due to their high toxicity and bioaccumulation.1 Nowadays, the PCBs can still be found in soils, waste disposal sites and natural waters with high concentrations.2, 3 Traditional methods for the detection of PCBs such as high-resolution capillary gas chromatography,4 high-resolution mass spectrometry,5 and immunoassays6 are normally expensive, time-consuming and complicated. Hence, new methods for the rapid and sensitive detection of PCBs are pressingly requested. Recently, surface-enhanced Raman scattering spectroscopy (SERS) has drawn much attention in chemical, biological, and environmental fields for its ultra-sensitivity, real-time detection, and fingerprint identification.7-9 It has also been utilized to analyze PCBs. For example, the researchers have achieved a series of high sensitivity SERS substrates such as Ag-NRs,10 Ag hierarchical nanostructure arrays,11 SiO2@Au@Ag core/shell nanoparticles,12 Ag-capped Au nanopillars13 and Ag nanosheet-assembled micro-hemispheres,14 for the successful SERS detection of PCBs. However, the detection sensitivity for PCBs is not yet very satisfactory since PCBs do not adsorb easily onto Ag and Au surfaces.14 Even with certain modification of the metal surface with chemicals such as mono-6-thio-β-cyclodextrin or decanethiol, which can capture the target PCB molecules to the SERS substrate surface, the overall detection sensitivity did not improve significantly (usually with only one order of magnitude of increase).14,

15

Therefore, although the use of the intrinsic fingerprints for detection and identification of PCBs by SERS is highly desired, it still remains a big challenge for the SERS application in the trace detection and analysis of POPs such as PCBs in practice.


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 23

Fortunately, there now emerge some new solutions such as the label-free detection method for the SERS technique,16 and in some label-free detection protocols, DNA or RNA molecules are employed as the aptamers for designing and building of novel and versatile sensors that can guarantee high sensitivity and selectivity in detection. The principle can be easily understood as the following. In the presence of target molecules, the selected DNA and RNA aptamers can interact with the target molecules and then fold themselves into three-dimensional configurations such as hairpin loop, T-junction and G-quadruplex.17 Accordingly, the DNA conformational changes on the surface of metallic substrate can thus lead to the changes of the responsive SERS signals, which then can be monitored directly and measured selectively and sensitively.18-20

Figure 1. Schematic of the design of label-free SERS based biosensor for high sensitive and selective detection of PCB-77 using the aptamer modified Ag-NR arrays. With this idea, therefore, herein we presented a label-free approach to detection of PCB-77 by utilizing the PCB-77-binding aptamers, and in particular, we employed large-scale uniform Agnanorod (Ag-NR) arrays as the highly sensitive and reproducible SERS substrate. The design conception is schematically depicted in Figure 1. In this work, the ssDNA oligomer PCB-77 binding

aptamer

containing

the

sequence

(5’-3’)

SH-(CH2)6-

GGCGGGGCTACGAAGTAGTGATTTTTTCCGATGGCCCGTG (40 bases) was used, which had been used and confirmed to be effective by the previous work.21,

22

The aptamers were


4

Page 5 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


covalently connected to the surface of the Ag-NRs through the thiol linker, and upon binding of PCB-77, the ssDNA would fold itself into a hairpin loop conformation through the hybridization of the complementary sequence, leading to the increase of the SERS signals of guanines as the 3’ end (which contains a higher proportion of guanines) got the closer proximity to the Ag-NRs. Because the change of the SERS signals depended on the number of PCB-77 molecules captured by the DNA aptamers, by analyzing the intensities of relevant Raman bands, namely, the 656 cm1

band and the 733 cm-1 band, we could then probe the trace amount of PCB-77. As such, the

sensitivity and selectivity for the PCB-77 detection was achieved, with the detection limit as low as 3.3×10-8 M, being the best result so far as reported for the PCB-77 detection to the best of our knowledge. MATERIALS AND METHODS 2.1 Materials Oxalic acid (H2C2O4), phosphoric acid (H3PO4), triscarboxyethylphosphine (TCEP), mercaptoethanol (MCH), p-aminothiophenol (p-ATP) and dimethyl sulfoxide (DMSO) were purchased from Sinopharm Chemical Reagent limited corporation. 4-Chlorobiphenyl (PCB-3), 2,3-Dichlorobiphenyl (PCB5), 2,4,4’-Trichlorobiphenyl (PCB28), 2,2’,5,5’-Tetrachlorobiphenyl (PCB52), 3,3’,4,4’-Tetrachlorobiphenyl (PCB-77) and 2,2’,4,5,5’-Pentachlorobiphenyl (PCB101) were obtained from AccuStandard Inc. The DNA aptamer sequences of the oligonucleotides used

in

the

present

study

(5’-SH-(CH2)6-

GGCGGGGCTACGAAGTAGTGATTTTTTCCGATGGCCCGTG-3’) were synthesized by Sangon Biotechnology Inc. All of the chemicals were used without further purification. The real lake water was collected from a local lake, and was filtered through 0.22 µm filter to remove any


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 23

particulate suspension after dissolving of PCBs in the mixture of 5% DMSO and real lake water solution. 2.2 Preparation of conical-pore AAO templates Al foil (99.99%) of 0.5 mm thickness was anodized at 40 V in a 0.3 M oxalic acid solution at 8 o

C for 6 h. Then the formed porous aluminum layer was dissolved in a mixed solution of 6 vol%

phosphoric and 1.8 wt% chromic acids. To fabricate aluminum nanotips on the conical-pore AAO templates, a repeated multi-step process of anodization (40 V, 40 s) and pore widening (2 min in a 5 wt% phosphoric acid solution at 40 oC) was performed. 2.3 Preparation of Ag-NR arrays The Ag-NRs on the nanotips and the nanoparticles on the upper rim of the conical-pores in the AAO template were achieved via 16 min top-view ion-sputtering Ag with a deposition rate of about 10 nm min-1 (with an electric current of 20 mA). To obtain uniformly distributed Ag-NRs, the conical pore-AAO template was rotated at a rate of 2 circles per minute during the sputtering. 2.4 Fabrication of aptamer modified SERS substrate First, the DNA was dissolved at 50 µM in ultrapure water. Then the DNA solution was heated to 90 oC for 10 min in water bath and then cooled in ice water immediately for 30 min. The thiolmodified oligonucleotide was incubated in 400 µM TCEP for 2 h at room temperature. The solution was then diluted to different concentrations by ultrapure water. Then 10 µL pretreated ssDNA solution was dropped on tailored SERS substrate under wet condition at 4oC. The samples were then kept in fridge for 10 h. The ssDNA modified substrates were rinsed with pure water to remove unbounded ssDNA. And the substrates were then immersed in 0.1 µM MCH water solutions for 2 h, with MCH working as a spacer to remove the non-covalently attached


6

Page 7 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ssDNA and avoided the molecules absorbed on metal surface directly. Finally, the substrates were rinsed with pure water several times and dried with Ar gas flow. 2.5 Measurement of SERS spectra and spectral analysis For the SERS detection of PCBs, all samples of PCBs were dissolved in the mixture of 5% DMSO and ultrapure water or 5% DMSO and real lake water. DMSO can improve the solubility of PCBs and have negligible interference to the SERS spectra.22 For the SERS detection of PCBs, small pieces of the freshly prepared aptamer modified Ag-NR arrays were immersed in different concentrations of PCBs (0 to 10-6 M) solution for about 1 h. Then, the SERS substrates were taken out, rinsed with pure water to remove the DMSO and non-specifically adsorbed PCBs. The SERS spectra were recorded using a XploRA Raman microspectrometer (Horiba Jobin Yvon) with a 532 nm laser and an Olympus 10× long working distance lens. The beam size was 2 µm in diameter and worked at a power of approximately 0.2 mW. The acquisition time of 60 s was used for Raman measurements at each point. For the Raman mapping experiments, the acquisition time was 30 s and the step length was 10 µm, while the other parameters were the same as the single point spectra.

RESULTS AND DISCUSSION 3.1 Fabrication and characterizations of the Ag-NR arrays


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 23

Figure 2. SEM images of Ag-NR arrays. (a) is top view. (b) is tilted view at 45 deg. One of the key issues for the reliable label-free SERS detection of PCBs is the building of structurally uniform and highly sensitive SERS substrates. In this work, the Ag-NR arrays were fabricated according to the protocol described previously.23 The Ag-NR arrays SERS substrate was constructed by sputtering Ag on top of the conical-pore-AAO template with highly ordered nanotip arrays on the pore joints, which was fabricated by a repeated multi-step process of oxalic acid anodizing Al foil for pore growth downwards and phosphoric acid widening the formed pores. A representative example of the periodic Ag-NR arrays is shown in Figure 2, with the hexagonally patterned Ag-NRs periodically distributed on the conical-pore-AAO template. The diameter of the Ag-NRs is about 50 nm, and most of the gaps between the nearest neighboring Ag-NRs fall into the sub-10 nm range, and some gaps are even less than 5 nm.


8

Page 9 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The SERS measurements demonstrated that the as-fabricated Ag-NR arrays could serve as highly sensitive (the detection limits is about 10-12 M and the enhancement factor is about 4.8×107 for p-ATP) and reproducible SERS substrates, as confirmed by the relative standard deviation of 6% within a 210×210 µm2 point-to-point Raman-mapping area (see details in the Supporting Information, Part S1). The effect of the dimension of the Ag-NRs on the SERS sensitivity in our former work.23 Generally, the SERS activity of the Ag-NRs improves with the growth of the diameters of the Ag-NRs as the narrowing of the gaps between the nearest neighboring

Ag-NRs

occurs

but

diminishes

with

overlapping

of

the

Ag-NRs.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 23

Figure 3. (a) and (b) SERS spectra of 10 µM and 2.5 µM DNA aptamers on the Ag-NRs in response to different concentrations of PCB-77. (c) The plots of Raman intensity ratio I(656 cm1

)/I(733 cm-1) versus PCB-77 concentration applied in (a) and (b).

3.2 Detection and quantification of PCB-77 Another key ingredient in the design of label-free aptamer-based SERS substrate is the selection of the PCB binding aptamer, which can be working as the recognition and the signal output units. In this work, the ssDNA oligomer PCB-77 binding aptamer containing the sequence SH-(CH2)6-GGCGGGGCTACGAAGTAGTGATTTTTTCCGATGGCCCGTG was chosen by SELEX approach and confirmed to be effective by the previous work.21,

22

Figure 1

schematically illustrates the sensing mechanism for the detection of PCB-77 using the aptamermodified Ag-NR arrays. According to the secondary-structure simulation of the aptamer, upon conjugation with PCB-77 the ssDNA undergoes a conformational change to form a hairpin loop (as is shown schematically in Figure 3c).21 Thus the guanines at 3’ end of the DNA aptamer get closer to the surface of the Ag-NRs, resulting in the increase of the SERS intensity of the guanines (656 cm-1 bands). For the label-free SERS detection of PCB-77, 10 µM and 2.5 µM DNA aptamer were immobilized on the Ag-NR arrays SERS substrates, respectively. And the SERS spectra of the aptamer modified SERS substrates with the addition of PCB-77 of different concentrations are shown in Figure 3a and 3b, respectively. Generally, a typical Raman spectrum of DNA can be characterized by three regions, such as the vibrations of bases (500-800 cm-1), the vibrations of phosphate group and sugars (800-1200 cm-1) and the vibration of the skeleton of DNA (1200-1600 cm-1) which is sensitive to the secondary structure of DNA.24, 25 Specifically, the peaks at 656 cm-1, 733 cm-1, 790 cm-1, 960 cm-1, 1336 cm-1 and 1449 cm-1 are assigned to the in-ring breathing mode of guanine, the in-ring breathing mode of adenine, the in-ring breathing


10

Page 11 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mode of cytosine, the -NH2 group mode of adenine, the skeletal ring-vibration mode and the vibration mode of deoxyribose and adenine, respectively (Table 1).22, 26, 27 Table 1. The Assignment of corresponding SERS bands22, 26, 27 Raman band (cm-1)

Assignment

656

In-ring breathing mode of G

733

In-ring breathing mode of A

790

In-ring breathing mode of C

960

-NH2 group vibration on A

1136

In-bending C8-H, str C4−N9, rock NH2 of G

1336

skeletal ring-vibration mode

1449

vibration mode of deoxyribose and adenine

It can be seen from Figure 3a and 3b that the Raman intensity of guanine increases with increasing concentration of PCB-77 while the Raman intensity of adenine and the skeleton of the DNA almost remains unchanged. With more PCB-77 binding with the DNA aptamers, more aptamer molecules change their conformations, leading to larger variation of the corresponding Raman band intensity. However, according to previous studies, the SERS signals of the DNA depend on multiple factors such as the DNA sequence,28 orientation of the DNA on the substrates surface,19 DNA hybridization,29 pH value, temperature, ions in the solution,30 and etc.31 And the orientation of the DNA attached on the surface of substrates can be reflected by its packing density and revealed by their corresponding SERS intensity changes, the DNA chains tend to extend vertically at high packing density and lie down at low packing density.19,

22

However, no study of DNA orientation on large-scale Ag-NR arrays via SERS has been reported. Thus to confirm the conformation changes of the DNA aptamers upon binding PCB-77, SERS


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 23

spectra of DNA aptamers prepared with different concentrations on the Ag-NR arrays were measured (Figure S5a). It can be seen that the Raman intensities of guanine and the skeleton of DNA increase slightly with the decreasing concentration of DNA aptamer, while the intensities of the adenine show only a slight decrease. Thus the DNA aptamers is more likely to form a hairpin loop than being flat on the Ag-NRs surface considering the almost unchangeable of the skeleton of DNA upon binding PCB-77, which is in good agreement with the structure simulation of the aptamer.19 The sensitivity of the SERS substrates is one of the key issues for SERS detection and quantification of PCB-77. And the ratios of I(656 cm-1)/I(733 cm-1) were evaluated to show the changes of the spectral. Figure 3c shows the plots of Raman intensity ratios of I(656 cm-1)/I(733 cm-1), which increases with the increase of concentration of the PCB-77. The ratio of I(656 cm1

)/I(733 cm-1) increases about 76% for 10 µM DNA aptamer modified on Ag-NR arrays (Figure

3c, with addition of 3.3×10-7 M PCB-77). However, the ratio of I(656 cm-1)/I(733 cm-1) increases almost 159% under the same conditions for 2.5 µM DNA aptamer modified on Ag-NRs, which is more than double for 10 µM DNA aptamer modified on the Ag-NRs (Figure 3c). Apparently, the SERS substrates with 2.5 µM DNA aptamer immobilized on the Ag-NRs dramatically improves the SERS sensitivity, compared with the 10 µM DNA aptamer immobilized on the AgNRs. Moreover, to get a better insight into the SERS sensitivity improvement with the lower concentration of the aptamers linked to the Ag-NR arrays, different concentrations of DNA aptamers modified on the Ag-NR arrays in response PCB-77 were measured (Figure S5b). Compared with the spectra without addition of PCB-77 (Figure S5a), the spectra with addition of PCB-77 show the conspicuous increase of Raman intensity of guanine (656 cm-1 bands), while


12

Page 13 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the intensities of the adenine and the skeleton of DNA are almost unchanged. Figure S5c shows the plots of the increase of ratio of I(656 cm-1)/I(733 cm-1) in response to 3.3×10-7 M PCB-77 for different density of DNA aptamers modified on the Ag-NR arrays. Apparently, the Raman intensity ratio of I(656 cm-1)/I(733 cm-1) increases with the number of PCB-77 conjugated with the aptamers, and the increase is more conspicuous for lower density of aptamers linked to the Ag-NR arrays. The PCB77 detection sensitivity of the lower detection limit of the SERS substrate is estimated better than 3.3×10-8 M using the Ag-NRs modified with 2.5 µM DNA aptamer (the ratio of I(656 cm-1)/I(733 cm-1) increased about 31%) and the detection limits is calculated to be 10-8 M for 10 µM DNA aptamer modified Ag-NRs, which is about 3 orders of the magnitude lower than that achieved by using the bare Ag-NR arrays (the lower detection limit for the PCB-77 non-specifically attached on the bare Ag-NRs is estimated to be 10-5 M as confirmed by our former work 23), and it is about 2 orders of magnitude lower than that achieved by using the DNA aptamer modified SiO2@Au core/shell nanoparticles (10-6 M).22 There are two main reasons for the high SERS sensitivity to PCB-77 compared with the DNA aptamer modified SiO2@Au core/shell nanoparticles. Firstly, the SERS sensitivity of the Ag-NRs is much higher.12, 22, 23 Secondly, the density of the DNA aptamers linked to the Ag-NR arrays is so low that the subtle change of the DNA conformation can be sensitively detected. The almost linear response range of the SERS substrate is another key issue for SERS detection and quantification of PCB-77. The ratio of I(656 cm-1)/I(733 cm-1) displays an excellent linear range for detecting 0 and 10-6 M PCB-77 using the 10 µM aptamer modified AgNR arrays, whereas the linear response using the 2.5 µM aptamer modified Ag-NR arrays is much narrower. The ratio of I(656 cm-1)/I(733 cm-1) for the 2.5 µM aptamer modified Ag-NRs is almost unchanged when the concentration of PCB-77 is higher than 3.3×10-7 M, which is due to


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 23

the saturation of PCB-77 bound with the aptamers. Therefore, higher density of aptamers on the substrate sacrifice the sensitivity but improves the linear response range. Because the characteristic bands can be easily distinguished in the Raman spectra even at the low concentration of 0.1 µM with good reproducibility (Figure S5d), and the ratios of I(656 cm1

)/I(733 cm-1) has a linear correlation with the number of PCB-77, the PCB-77 concentrations

can thus be determined by the evaluation of the Raman intensity ratio of I(656 cm-1)/I(733 cm-1). The monotonous change of the spectral ratio with the PCB-77 concentration therefore makes the quantitative measurement of trace amount of PCB-77 attainable. 3.3 The reproducibility and stability of the DNA aptamer modified Ag-NRs Next, the homogeneity of the aptamer modified Ag-NRs as the SERS substrate was evaluated by two dimensional point-to-point SERS mapping. Firstly, the good spectral reproducibility was checked for the 10 µM aptamer on the Ag-NRs without adding PCB-77 to the substrate. Figure S6a in the Supporting Information illustrates the SERS maps obtained at the Raman intensity ratio I(656 cm-1)/I(733 cm-1) of PCB-77 binding aptamer and no significant variation was observed on the area of 210 µm×210 µm with 441 measuring points, with a mean intensity ratio of 0.42 and a relative standard deviation of 7%. It thus demonstrates that the Ag-NRs SERS substrates can offer excellent reproducibility for the SERS measurements. Secondly, the spectral reproducibility was also checked via SERS mapping for the aptamer modified substrates in Figure S6a with adding 3.3×10-7 M PCB-77 (Figure S6b). The mapping with a mean intensity ratio of 0.77 and a relative standard deviation of 8% proves that the conformational changes of PCB-77 aptamers are basically homogeneous and the aptamer modified Ag-NRs substrate could be retained for at least 1 month without obvious changes of the Raman intensity ratios of I(656 cm-1)/ I(733 cm-1) (see details in the Supporting Information, Figure S6), indicating that the


14

Page 15 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


label-free SERS detection of PCB-77 using aptamer-modified Ag-NR arrays method is reproducible and reliable.

Figure 4. The Raman intensity ratios of I(656 cm-1)/ I(733 cm-1) measured in response to PCB77 and other various of PCBs. I0: the Raman intensity ratio of I(656 cm-1)/ I(733 cm-1) measured after treated with the 5% DMSO but before adding PCBs. 3.4 The selectivity of the SERS detection of PCB-77 The selectivity of this novel aptamer-based SERS sensor for PCB-77 detection was also checked. The SERS spectra of PCB-3, PCB-4, PCB-5, PCB-28, PCB-52 and PCB-101 were chosen as negative control molecules which share similar molecular structures (Figure S8 in the Supporting Information). Before the measurements, the freshly prepared aptamer modified AgNR arrays were immersed in different PCBs solutions for about 1 h, followed by rinsing with pure water to remove the DMSO and non-specifically adsorbed PCBs. DMSO has negligible interference to the SERS spectra (Supporting Information, Part S2). The concentrations of the tested PCBs were all the same (at 3.3×10-7 M) for comparison. Figure 4 compares the changes of the Raman intensity ratios (I(656 cm-1)/I(733 cm-1)) in the absence and presence of PCBs,


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 23

respectively. To be noted, although the DNA aptamer has been chosen for PCB-77 by SELEX method, it also shows certain moderate specificity toward other PCBs structurally similar to PCB-77.21 Anyway, however, the results unambiguously show that the changes of Raman intensity ratios of I(656 cm-1)/I(733 cm-1) for PCB-77 is significantly stronger than that of other PCBs. This relatively high specificity ensures the high SERS detection selectivity of PCB-77. Owing to the sensitivity and selectivity of the aptamer modified Ag-NR arrays, this sensor was also tested by measuring PCB-77 in natural media such as real lake water which was taken from a local lake. PCB-77 at concentration of 3.3×10-7 M in real lake water could be detected using the aptamers modified Ag-NR arrays (Figure S9). It is also worth noting that the optical detection approach developed by this study can also be utilized for SERS detection of other organic pollutants given that the corresponding aptamers are selected and employed.

CONCLUSION In summary, we have presented a new approach to selective SERS detection of PCB-77 using aptamer-modified ordered Ag-NR arrays. Upon binding PCB-77, the ssDNA aptamer changes its conformation to form a hairpin loop, resulting in the increase of the SERS signals of the guanines in the aptamer. Based on the evaluation of the Raman intensity ratio of I(656 cm1

)/I(733 cm-1), quantitative measurement of trace amount of PCB-77 with low concentration

down to 3.3×10-8 M has thus been achieved, which is about three orders of magnitude lower than that obtained from the bare Ag-NR arrays. Such aptamer modified Ag-NRs arrays have the advantages of high SERS sensitivity and good reproducibility, as well as high selectivity in the identification of target molecules. Therefore, this work may open up a new avenue for preparation of large-scale highly ordered and aptamer-modified SERS substrates for trace


16

Page 17 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


detection of environmental pollutants such as POPs with high sensitivity, selectivity and reproducibilty.

Supporting Information Characterization of the Ag-NRs, the influence of the DMSO, SERS spectra of the DNA aptamers, SERS mapping of the DNA aptamers, the stability of Ag-NRs and the DNA aptamer modified Ag-NRs, chemical structures of PCBs used in this paper and the detection of PCB-77 in real lake water. This material is available free of charge via the Internet at http://pubs.acs.org

AUTHOR INFORMATION Corresponding Author: Prof. Qing Huang, E-mail: [email protected]

Notes The authors declare no competing financial interest. ACKNOWLEDGMENT This work was financially supported by the National Basic Research Program of China (grant No. 2013CB934304), the National Natural Science Foundation of China (grant No. 11175204), and Natural Science Foundation of Anhui Province, China (grant No. Y49AH51586).

REFERENCES


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1.

Page 18 of 23

Shields, P. G. Understanding Population and Individual Risk Assessment: The case of

Polychlorinated Biphenyls. Cancer Epidemiol., Biomarkers Prev. 2006, 15, 830-839. 2.

Lewis, D. L.; Garrison, A. W.; Wommack, K. E.; Whittemore, A.; Steudler, P.; Melillo,

J. Influence of Environmental Changes on Degradation of Chiral Pollutants in Soils. Nature 1999, 401, 898-901. 3.

Ying, G. G.; Rawson, C. A.; Kookana, R. S.; Warne, M. S. J.; Peng, P. A.; Li, X. M.;

Laginestra, E.; Tremblay, L. A.; Chapman, J. C.; Lim, R. P. Distribution of Inorganic and Organic Contaminants in Sediments from Sydney Olympic Park and the Surrounding Sydney Metropolitan Area. J. Environ. Monitor. 2009, 11, 1687-1696. 4.

Mullin, M. D.; Pochini, C. M.; Mccrindle, S.; Romkes, M.; Safe, S. H.; Safe, L. M. High-

Resolution PCB Analysis ： Synthesis and Chromatographic Properties of All 209 PCB Congeners. Environ. Sci. Technol. 1984, 18, 468-476. 5.

Matsumoto, R.; Nguyen Phuc Cam, T.; Haruta, S.; Kawano, M.; Takeuchi, I.

Polychlorinated Biphenyl (PCB) Concentrations and Congener Composition in Masu Salmon from Japan: A Study of All 209 PCB Congeners by High-Resolution Gas Chromatography/HighResolution Mass Spectrometry (HRGC/HRMS). Mar. Pollut. Bull. 2014, 85, 549-557. 6.

Tsutsumi, T.; Amakura, Y.; Ashieda, K.; Okuyama, A.; Tanioka, Y.; Sakata, K.;

Kobayashi, Y.; Sasaki, K.; Maitanit, T. PCB 118 and Aryl Hydrocarbon Receptor Immunoassays for Screening Dioxins in Retail Fish. J. Agric. Food Chem. 2008, 56, 2867-2874. 7.

Papadopoulou, E.; Bell, S. E. J. Label-Free Detection of Single-Base Mismatches in

DNA by Surface-Enhanced Raman Spectroscopy. Angew. Chem. Int. Ed. 2011, 50, 9058-9061.


18

Page 19 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8.

Rycenga, M.; Xia, X. H.; Moran, C. H.; Zhou, F.; Qin, D.; Li, Z. Y.; Xia, Y. A.

Generation of Hot Spots with Silver Nanocubes for Single-Molecule Detection by SurfaceEnhanced Raman Scattering. Angew. Chem. Int. Ed. 2011, 50, 5473-5477. 9.

Sun, Y. H.; Liu, K.; Miao, J.; Wang, Z. Y.; Tian, B. Z.; Zhang, L. N.; Li, Q. Q.; Fan, S.

S.; Jiang, K. L. Highly Sensitive Surface-Enhanced Raman Scattering Substrate Made from Superaligned Carbon Nanotubes. Nano Lett. 2010, 10, 1747-1753. 10. Huang, Z. L.; Meng, G. W.; Huang, Q.; Chen, B.; Zhu, C. H.; Zhang, Z. Large-Area Ag Nanorod Array Substrates for SERS: AAO Template-Assisted Fabrication, Functionalization, and Application in Detection PCBs. J. Raman Spectrosc. 2013, 44, 240-246. 11. Zhu, C. H.; Meng, G. W.; Huang, Q.; Wang, X. J.; Qian, Y. W.; Hu, X. Y.; Tang, H. B.; Wu, N. Q. ZnO-Nanotaper Array Sacrificial Templated Synthesis of Noble-Metal BuildingBlock Assembled Nanotube Arrays as 3D SERS-Substrates. Nano Res. 2015, 8, 957-966. 12. Lu, Y.; Yao, G.; Sun, K.; Huang, Q. Beta-Cyclodextrin Coated SiO2@Au@Ag CoreShell Nanoparticles for SERS Detection of PCBs. Phys. Chem. Chem. Phys. 2015, 17, 2114921157. 13. Huang, Z. L.; Meng, G. W.; Huang, Q.; Yang, Y. J.; Zhu, C. H.; Tang, C. L. Improved SERS Performance from Au Nanopillar Arrays by Abridging the Pillar Tip Spacing by Ag Sputtering. Adv. Mater. 2010, 22, 4136-4139. 14. Zhu, C.; Meng, G.; Huang, Q.; Zhang, Z.; Xu, Q.; Liu, G.; Huang, Z.; Chu, Z. Ag Nanosheet-Assembled Micro-Hemispheres as Effective SERS Substrates. Chem. Commun. 2011, 47, 2709-2711.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 23

15. Li, Z. B.; Meng, G. W.; Huang, Q.; Zhu, C. H.; Zhang, Z.; Li, X. D. Galvanic-CellInduced Growth of Ag Nanosheet-Assembled Structures as Sensitive and Reproducible SERS Substrates. Chem. Eur. J. 2012, 18, 14948-14953. 16. Han, X. X.; Zhao, B.; Ozaki, Y. Label-Free Detection in Biological Applications of Surface-Enhanced Raman Scattering. TrAC, Trends Anal. Chem. 2012, 38, 67-78. 17. Mcgown, L. B.; Joseph, M. J.; Pitner, J. B.; Vonk, G. P.; Linn, C. P. The Nucleic-Acid Ligand - a New Tool for Molecular Recognition. Anal. Chem. 1995, 67, A663-A668. 18. Pagba, C. V.; Lane, S. M.; Wachsmann-Hogiu, S. Conformational Changes in Quadruplex Oligonucleotide Structures Probed by Raman Spectroscopy. Biomed. Opt. Express 2011, 2, 207-217. 19. Barhoumi, A.; Zhang, D. M.; Halas, N. J. Correlation of Molecular Orientation and Packing Density in a dsDNA Self-Assembled Monolayer Observable with Surface-EnhancedRaman Spectroscopy. J. Am. Chem. Soc. 2008, 130, 14040-14041. 20. Papadopoulou, E.; Bell, S. E. J. DNA Reorientation on Au Nanoparticles: Label-Free Detection of Hybridization by Surface Enhanced Raman Spectroscopy. Chem. Commun. 2011, 47, 10966-10968. 21. Xu, S. M.; Yuan, H.; Chen, S. P.; Xu, A.; Wang, J.; Wu, L. J. Selection of DNA Aptamers Against Polychlorinated Biphenyls as Potential Biorecognition Elements for Environmental Analysis. Anal. Biochem. 2012, 423, 195-201.


20

Page 21 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


22. Lu, Y. L.; Huang, Q.; Meng, G. W.; Wu, L. J.; Zhang, J. J. Label-Free Selective SERS Detection of PCB-77 Based on DNA Aptamer Modified SiO2@Au Core/Shell Nanoparticles. Analyst 2014, 139, 3083-3087. 23. Sun, K. X.; Meng, G. W.; Huang, Q.; Zhao, X. L.; Zhu, C. H.; Huang, Z. L.; Qian, Y. W.; Wang, X. J.; Hu, X. Y. Gap-tunable Ag-nanorod arrays on alumina nanotip arrays as effective SERS substrates. J. Mater. Chem. C 2013, 1, 5015-5022. 24. Puppels, G. J.; Otto, C.; Greve, J.; Robertnicoud, M.; Arndtjovin, D. J.; Jovin, T. M. Raman Microspectroscopic Study of Low-Ph-Induced Changes in DNA-Structure of Polytene Chromosomes. Biochemistry 1994, 33, 3386-3395. 25. Lu, Y.; Huang, Q. Label-Free Selective Detection of Coralyne Due to Aptamer-Coralyne Interaction Using DNA Modified SiO2@Au Core-Shell Nanoparticles as an Effective SERS Substrate. Anal. Methods 2013, 5, 3927-3932. 26. Papadopoulou, E.; Bell, S. E. J. Structure of Adenine on Metal Nanoparticles: pH Equilibria and Formation of Ag+ Complexes Detected by Surface-Enhanced Raman Spectroscopy. J. Phys. Chem. C 2010, 114, 22644-22651. 27. He, L. J.; Langlet, M.; Bouvier, P.; Calers, C.; Pradier, C. M.; Stambouli, V. New Insights into Surface-Enhanced Raman Spectroscopy Label-Free Detection of DNA on Ag degrees/TiO2 Substrate. J. Phys. Chem. C 2014, 118, 25658-25670. 28. Prado, E.; Daugey, N.; Plumet, S.; Servant, L.; Lecomte, S. Quantitative Label-Free RNA Detection Using Surface-Enhanced Raman Spectroscopy. Chem. Commun. 2011, 47, 7425-7427.


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 23

29. Guerrini, L.; Krpetic, Z.; van Lierop, D.; Alvarez-Puebla, R. A.; Graham, D. Direct Surface-Enhanced Raman Scattering Analysis of DNA Duplexes. Angew. Chem. Int. Ed. 2015, 54, 1144-1148. 30. Esmaielzadeh Kandjani, A.; Sabri, Y. M.; Mohammad-Taheri, M.; Bansal, V.; Bhargava, S. K. Detect, Remove and Reuse: a New Paradigm in Sensing and Removal of Hg(II) from Wastewater via SERS-Active ZnO/Ag Nanoarrays. Environ. Sci. Technol. 2015, 49, 1578-1584. 31. Masetti, M.; Xie, H. N.; Krpetic, Z.; Recanatini, M.; Alvarez-Puebla, R. A.; Guerrini, L. Revealing DNA Interactions with Exogenous Agents by Surface-Enhanced Raman Scattering. J. Am. Chem. Soc. 2015, 137, 469-476.


22

Page 23 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC


23

Highly Sensitive and Selective Surface-Enhanced ... - ACS Publications

Recommend Documents