Highly Sensitive Protein Detection Based on Smart Hybrid

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

Highly Sensitive Protein Detection Based on Smart Hybrid Nanocomposite-Controlled Switch of DNA Polymerase Activity Yue Huang, Hao Li, Lei Wang, Xiaoxia Mao, and Genxi Li ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b09270 • Publication Date (Web): 29 Sep 2016 Downloaded from http://pubs.acs.org on September 29, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Highly Sensitive Protein Detection Based on Smart Hybrid Nanocomposite-Controlled Switch of DNA Polymerase Activity Yue Huang,†,§ Hao Li,†,§ Lei Wang,† Xiaoxia Mao,‡ Genxi Li*,†,‡ †

State Key Laboratory of Pharmaceutical Biotechnology and Collaborative Innovation Center of

Chemistry for Life Sciences, Department of Biochemistry, Nanjing University, Nanjing 210093, P. R. China ‡

Center for Molecular Recognition and Biosensing, School of Life Sciences, Shanghai

University, Shanghai 200444, P. R. China KEYWORDS: signal amplification, hybrid nanocomposite, switchable enzyme activity, STIP1, clinical application

ABSTRACT: In this work, we have successfully designed a smart and flexible signal amplification method based on a newly synthesized hybrid nanocomposite with switchable enzyme activity for specific and sensitive protein detection. The smart hybrid nanocomposite synthesized here is initially loaded with quenched fluorophore and a unique aptamer-inhibited DNA polymerase. It then undergoes target protein-triggered release of the fluorophore and

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 19

activation of the DNA polymerase, which can thereby promote multiple catalytic reactions and recycled use of the target protein, resulting in the generation of highly amplified signals. Therefore, a small amount of target protein can lead to a large amount of signal without being consumed. In addition, the programmable control of DNA polymerase activity may effectively reduce background signal and avoid false positive results, which may further facilitate an efficient detection of small amounts of protein. By taking the detection of human stress-induced phosphoprotein 1 (STIP1) as an example, the excellent performance of this method has been verified. Furthermore, the proposed method has been used to analyze serum STIP1 from patients of ovarian cancer, showing promising application in clinical practice.

1. INTRODUCTION The measurement of tumor-associated proteins, especially biomarkers that are specifically indicative of cancer, is of high diagnostic value for cancer patients and would improve the chances for early diagnosis.1-3 So, great effort has been made to develop new methods with excellent performance for protein assay.4-6 Currently, various researches have concentrated on the exploration of strategies by incorporating enzymes for signal amplification so as to achieve sensitive detection.7-11 However, the application of enzyme may be restricted due to the failure in the precise control of enzyme activity. For instance, the introduction of covalent conjugation may have negative influence on the natural structure and normal function of enzymes, while hyperactive enzymatic effects would produce obvious background signal or false positive results, which may affect the performance of detection. Therefore, design of the smart protein detection


2

Page 3 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


strategies with the capability of precise and autonomous control of enzyme function, is an important step to achieve high detection sensitivity and intelligent disease diagnosis. Hybrid nanomaterials consisted of biological molecules, such as enzymes, proteins, DNAs or RNAs, and non-biological inorganic nanomaterials (for instance, semiconductor quantum dots and metal nanoparticles) have recently been developed.12-15 Due to the highly recognizing specificity of DNAs and the distinctive characteristics of nanomaterials, a great many strategies based on nanomaterials coupled with DNA-assembly have been proposed for application in the fields of bio-analysis and bio-diagnostics.16-19 Therefore, we propose that it would be an efficient way for improving the performance of protein assay by using nanomaterial-DNA-assembly to achieve flexible control of enzyme activity. Herein, we have successfully designed a smart signal amplification method based on a newly synthesized hybrid nanocomposite with switchable enzymatic activity for the highly sensitive and selective assay of proteins. The smart hybrid nanocomposite synthesized here is initially loaded with quenched fluorophore and a unique aptamer-inhibited DNA polymerase. It can undergo target protein-triggered release of the fluorophore and activation of the DNA polymerase, which may thereby promote multiple catalytic reactions and recycled use of the target protein, resulting in the generation of highly amplified signals. Therefore, a small amount of target protein can lead to a large amount of signal without being consumed. The introduction of anti-DNA polymerase aptamer directly links DNA with target proteins and the catalysis of enzymes, facilitating the accurate detection of target protein and flexible control of the detection system. In addition, the smart modulation of DNA polymerase activity may effectively reduce background signal and avoid false positive signal, which may further facilitate an efficient detection of trace amount of protein.


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 19

To demonstrate the utility of our rationale, we have taken the detection of human stressinduced phosphoprotein 1 (STIP1) as an example. STIP1 is a valuable serum biomarker of ovarian cancer and its overexpression is usually associated with tumor progression,20-24 Moreover, measurement of serum STIP1 concentration for diagnosing human ovarian cancer is supported.25,26 Because this one-step signal amplification strategy can rapidly detect target protein without laborious experimental procedures, which may greatly moderate the interference from the complicated biological context, the assay of serum STIP1 concentration from ovarian cancer patients has also been conducted. The STIP1 level and its variation measured by using this strategy are positively correlated with the cancer progression, indicating promising application in clinical practice. 2. EXPERIMENTAL SECTION 2.1. Chemicals and Materials. Recombinant human STIP1 and EpCAM (epithelial cell adhesion molecule) were purchased from Abnova (Taipei City, Taiwan). All of the DNAs were synthesized and purified by Sangon Biotechnology Co., Ltd. These DNA sequences were: SDNA (5’-SH-CTCTGGATCAATGTACAGTATTG-3’), C-DNA (5’-Cy5-ATCCAGAGTGACG C-3’), A-DNA (5’-ATCCAGAGTGACGCAGCACGGCACTCACTCTTTGTTAAGTGGTCTG CTTCTTAACCTTCATCGACACGGTGGCTTAAAAAAAAAGCGTCACTCTGGAT-3’). All the DNAs were purified by HPLC. Bovine serum albumin (BSA), tris(2-carboxyethyl) phosphine (TCEP) and thrombin were acquired from Sigma. Thermus aquaticus DNA polymerase (Taq DNA polymerase) was acquired from NEB (New England Biolabs). Chloroauric acid (HAuCl4•3H2O, 99.9%) and other reagents were directly utilized with analytical grade. Solutions for the experiments were prepared with doubly distilled water (18 MΩ cm). Blood samples of ovarian cancer patients were acquired from the Affiliated Hospital of


4

Page 5 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Nanjing University and were pretreated by being centrifugated for 5 minutes at 3000 rpm. Then the resulted supernatants were collected, dialyzed and ready for assay. 2.2. Preparation of the New Hybrid Nanocomposite. Firstly, citrate-capped GNPs (diameter 13 nm) were prepared using the citrate reduction method.27 Then the S-DNA-functionalized GNPs were prepared according to the previous protocol with slight modifications:28,29 S-DNA strand was activated by soaking the strands in a buffer containing 10 mM TCEP solution for 1 h. Then the reduced strands (final concentration 3 μM) were incubated with as-prepared GNPs colloid for 16 h at 25°C. After that, 100 μl NaCl solution (1 M) was added to the reaction mixture through a stepwise process to reach the final salt concentration of 0.1 M NaCl, followed by being added 3 μM C-DNA to make C-DNA hybridize with S-DNA, and the hybridization and “ageing” lasted at room temperature for another 24 h. Finally, 0.1% BSA was added to equilibrate at 25°C for 2 h, followed by being added Taq DNA polymerase (final concentration 0.5 U μl-1) to incubate for 90 min. BSA was utilized to enhance the stability and minimize any non-specific adsorption. The solution was centrifugated for 20 min at 13,000 rpm by three times, and then resuspended in 1 ml solution (10 mM Tris-HCl buffer with 100 mM NaCl, pH 7.4), stored at 4°C before use. 2.3. Characterization. Transmission Electron Microscopy (TEM) images were obtained from a Jeol JEM-2100 microscope. Ultraviolet-visible (UV-vis) spectra were measured by a Shimadzu UV-2450 spectrophotometer. Dynamic light scattering (DLS) measurements were conducted on a particle size analyzer (Brookhaven 90Plus, USA) at 25 °C with a scattering angle of 15°. Gel electrophoresis analysis of 1% agarose gel was employed for the characterization of the functionalized GNPs. Electrophoresis was carried out at room temperature in TBE buffer for 40 min with a constant voltage of 100 V.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 19

2.4. Signal Amplification Reaction for the Detection of STIP1. For STIP1 protein detection, the prepared hybrid nanocomposite was incubated with the target protein STIP1 of varying concentrations in the reaction buffer (10 mM Tris-HCl, 4 mM MgCl2, 100 mM KCl, 100 μg ml-1 BSA, pH 8.3) containing 500 μM dNTPs, 450 nM A-DNA at 25°C for 60 min. The fluorescence measurements were all achieved by Hitachi F-2500 fluorescence spectrometer (Hitachi. Ltd., Japan). The Cy5 fluorescence was recorded at 664 nm with an excitation wavelength of 643 nm, and the recording emission range was 655-710 nm. All these detections were measured at room temperature and were repeated at least three times, error bars are included in the figures.

Figure 1. (A) Fabrication of the hybrid nanocomposite. (B) Schematic illustration of the STIP1 assay.


6

Page 7 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. RESULTS AND DISCUSSION 3.1. Design Principle. Figure 1 may illustrate the principle of this new method for protein detection by taking the assay of STIP1 as an example. In Figure 1A, S-DNA, the DNA aptamer sequence of DNA polymerase labeled with a mercapto group at the 5’ end, possesses a hairpin conformation which is composed of a conserved region (in red) and a specific variable overhang region (in black). The unique DNA aptamer can reversibly bind with DNA polymerase and modulate its activity.30 When the variable overhang region hybridizes with the complementary DNA, the DNA polymerase will be trapped in the inactive state. On the contrary, without the involvement of the complementary sequence, the DNA polymerase is free and becomes active. For another, C-DNA, a single DNA sequence labeled with a 5’ fluorophore Cy5, is designed to simultaneously contain a complementary region of the overhang sequence of S-DNA and a toehold region complementary to the A-DNA. The novel hybrid nanocomposite is composed of a GNP nucleus which is thickly capped by the S-DNA sequence through Au-S bonds. The 5’ overhang sequence of S-DNA can then hybridize with the C-DNA. Consequently, the Cy5 fluorescence is quenched by the GNPs, meanwhile the DNA polymerase is bound and subsequently inhibited due to the particular characteristic of anti-DNA polymerase aptamer mentioned above, leading to the formation of the initially non-fluorescent and inactive hybrid nanocomposite. As shown in Figure 1B, A-DNA, which is a hairpin structure containing the specific recognizing DNA aptamer sequence of STIP1 (in magenta), undergoes a structure transformation triggered by the specific binding of the target STIP1 with its aptamer sequence, resulting in the liberation of the 3’ single strand region. Due to the existence of a toehold region in C-DNA, the liberated single strand then competitively hybridizes with the C-DNA trapped in the hybrid


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 19

nanocomposite by the strand displacement reaction. When C-DNA is freed from the hybrid nanocomposite, the Cy5 fluorescence restores, while the S-DNA alone cannot act binding or inhibitory function for DNA polymerase. As a result, DNA polymerase is free and activated. The free and activated DNA polymerase can subsequently operate normally to conduct a primer extension reaction to elongate the 3’ end of the C-DNA. Consequently, a fluorescent DNA duplex can be formed, meanwhile the target STIP1 is concomitantly substituted and freed to induce the sequent cycle reactions, generating an increasing number of free and active DNA polymerase, leading to an associated intense fluorescence signal. Thus, through the multiple catalytic reactions and the recycle of the target protein, a low concentration of target protein can trigger the generation of a significantly amplified signal, enabling the highly selective and sensitive detection of target STIP1 protein.

Figure 2. UV-Vis spectra of the C-DNA, DNA polymerase and the functionalized GNPs.

3.2. Characterization of Functionalized GNPs and Validation of Design Principle. Firstly, the functionalized GNPs has been successfully prepared and characterized. TEM images (Figure


8

Page 9 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


S1) reveal the uniform functionalized GNPs, both the original gold particles and the hybrid nanocomposite are spherical in shape and well-dispersed. In the DLS measurements, data show that the average hydrodynamic diameter of the GNPs is 12.8 nm while the average hydrodynamic diameter of the hybrid nanocomposite is increased to 31.5 nm (Figure S2). UVvis spectroscopy has been further used to verify successful preparation of the hybrid nanocomposite. As shown in Figure 2, the hybrid nanocomposite exhibits a slightly red-shifted UV/Vis spectrum with the characteristic peaks of GNP, DNA, and Cy5 as well as DNA polymerase, confirming the well formation of the nanocomposite.

Figure 3. (A) Agarose gel electrophoresis verification of the successful stepwise modification of the GNPs and the corresponding color images. 1: GNP/S-DNA, 2: GNP/S-DNA/C-DNA, 3: the hybrid nanocomposite. (B) Fluorescence signals to characterize the hybrid nanocomposite and to confirm the STIP1-triggered reaction.

Agarose gel electrophoresis has also been utilized to validate the successful functionalization. As shown in Figure 3A, from lane 1 to lane 3, the band displays a gradually slower mobility, which can be ascribed to the well stepwise modification of the GNPs. We have then employed fluorescence signal to characterize the hybrid nanocomposite and verify the design principle. As


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 19

shown in Figure 3B, the reaction solution without target STIP1 exhibits nearly background signal, implying that the hybrid nanocomposite is initially in non-fluorescent and inhibited inactive state. Upon the introduction of STIP1, the great raise of fluorescence intensity appears, validating the STIP1-triggered cycle reaction, as well as indicating that the prepared hybrid nanocomposite can function correctly and effectively. Furthermore, as shown in Figure S3, the hybrid nanocomposite solution is very stable, which favors further applications of the hybrid nanocomposite.

Figure 4. (A) Fluorescent response to the varying STIP1 concentrations, a~i (ng ml-1): 0.01, 0.05, 0.2, 1, 5, 20, 100, 500, 1000. (B) Calibration curve based on variation of fluorescent signal versus STIP1 concentration, inset displays the linear relation of fluorescent response versus logarithm of STIP1 concentration.

3.3. Experimental Optimization. Several critical parameters for the experiment have been optimized to achieve the best detection effect. As shown in Figure S4, the fluorescent intensity responds to different concentrations of A-DNA and reaches a plateau at the concentration of 400


10

Page 11 of 19

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nM. Thus, we choose to use 450 nM of A-DNA for the detection experiments. Figure S5 displays a time dependent generation of increasingly intense fluorescence signals, and the maximum fluorescent intensity is obtained at 60 min. Therefore, 60 min is enough for the amplification process as optimal reaction time.

Figure 5. Control experiments to validate the assay specificity. a: blank control, 10 mM Tris-HCl; b: 500 ng ml-1 BSA; c: 500 ng ml-1 thrombin; d: 500 ng ml-1 EpCAM; e: 500 ng ml-1 denatured STIP1; f: 50 pg ml-1 STIP1.

3.4. Detection Performance. Different concentrations of STIP1 have been measured by the obtained fluorescent signal with the optimal conditions. Figure 4 demonstrates that the fluorescent response rises correspondingly with the elevated STIP1 concentration. A linear relation of the fluorescent response versus the concentration logarithm, ranging from 10 pg ml-1 to 500 ng ml-1, can be built. Moreover, a limit of detection (LOD) as 3.4 pg ml-1 (S: N=3:1) can indicate high sensitivity. Compared with other reported methods, the proposed method exhibits a wider detection range and a lower LOD (Table S1). All repetitive experiments show acceptable reproducibility with a standard deviation below 5%. Negative control experiments by using


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 19

several control proteins have been conducted with the same conditions to verify the detection specificity. As shown in Figure 5, even with 10,000 times higher concentration, these proteins only have signal readouts which are very close to that of the blank control and much lower than that of STIP1. This validates the ability of the proposed strategy in discriminating STIP1 protein from interference proteins.

Figure 6. (A) Distribution of fluorescence intensity in detecting serum STIP1 concentrations of normal controls, benign and cancer patients. (B) Distribution of fluorescence intensity in detecting serum STIP1 concentrations of ovarian cancer patients in different stages. Student’s t test (t-test) shows statistical significance: **P

Highly Sensitive Protein Detection Based on Smart Hybrid

Recommend Documents