HO-1 antioxidant ... - ACS Publications

12. 5. Collaborative Innovation Center for Zhejiang Marine High-efficiency and Healthy. 13. Aquaculture School of Marine Sciences, Ningbo University, ...
1 downloads 0 Views 4MB Size
Download PDF
Article Cite This: J. Agric. Food Chem. 2018, 66, 1551−1559

pubs.acs.org/JAFC

Astaxanthin Induces the Nrf2/HO‑1 Antioxidant Pathway in Human Umbilical Vein Endothelial Cells by Generating Trace Amounts of ROS Tingting Niu,†,⊥,∇ Rongrong Xuan,‡,∇ Ligang Jiang,§ Wei Wu,† Zhanghe Zhen,† Yuling Song,† Lili Hong,† Kaiqin Zheng,† Jiaxing Zhang,† Qingshan Xu,∥ Yinghong Tan,∥ Xiaojun Yan,† and Haimin Chen*,† †

Key Laboratory of Marine Biotechnology of Zhejiang Province, Ningbo University, Ningbo, Zhejiang 315211, China Department of Gynecology and Obstetrics, The Affiliated Hospital of Medical College of Ningbo University, Ningbo, Zhejiang 315211, China § PROYA Companies, Hangzhou, Zhejiang 310012, China. ∥ Chenghai Baoer Bio-Ltd, Lijiang, Yunnan 674202, China ⊥ Collaborative Innovation Center for Zhejiang Marine High-efficiency and Healthy Aquaculture School of Marine Sciences, Ningbo University, Ningbo, Zhejiang 315211, China ‡

ABSTRACT: Astaxanthin is a powerful antioxidant that possesses potent protective effects against various human diseases and physiological disorders. However, the mechanisms underlying its antioxidant functions in cells are not fully understood. In the present study, the effects of astaxanthin on reactive oxygen species (ROS) production and antioxidant enzyme activity, as well as mitogen-activated protein kinases (MAPKs), phosphatidylinositol 3-kinase (PI3K)/Akt, and the nuclear factor erythroid 2related factor 2 (Nrf-2)/heme oxygenase-1 (HO-1) pathways in human umbilical vein endothelial cells (HUVECs), were examined. It was shown that astaxanthin (0.1, 1, and 10 μM) induced ROS production by 9.35%, 14.8%, and 18.06% compared to control, respectively, in HUVECs. In addition, astaxanthin increased the mRNA levels of phase II enzymes HO-1 and also promoted GSH-Px enzyme activity. Furthermore, we observed ERK phosphorylation, nuclear translocation of Nrf-2, and activation of antioxidant response element-driven luciferase activity upon astaxanthin treatment. Knockdown of Nrf-2 by small interfering RNA inhibited HO-1 mRNA expression by 60%, indicating that the Nrf-2/ARE signaling pathway is activated by astaxanthin. Our results suggest that astaxanthin activates the Nrf-2/HO-1 antioxidant pathway by generating small amounts of ROS. KEYWORDS: astaxanthin, human umbilical vein endothelial cells, reactive oxygen species, Nrf-2/HO-1 pathway, antioxidant induction of Nrf-2 phosphorylation.6 In addition, Nrf-2 is a critical regulator of flavonoid-mediated effects.7 Astaxanthin (3,3′-dihydroxy-β-carotene-4,4′-dione) is present in most red-colored aquatic organisms and is a potent antioxidant with 550-fold more potency than vitamin E (VE).8 The biological functions of astaxanthin include anti-inflammatory, antiapoptotic, neuroprotective, and cardioprotective effects.9,10 However, its hydrophilic polyene structure, which has low polarity, makes it difficult to permeate the cell; thus, few studies have been conducted to study its antioxidant effects at the cellular level. It has been shown that the antioxidant mechanisms of astaxanthin include directly scavenging cellular ROS that are trapped inside the phospholipid membrane and at the surface, protecting the mitochondrial redox state and functional integrity and activating antioxidant-related signaling pathways.11−14 However, few of these in vitro studies have reported the effective astaxanthin concentration or the ideal

1. INTRODUCTION Endothelial cells form the inner lining of blood vessels and play a crucial role in many vascular functions including cell adhesion, inflammatory responses, regulation of permeability, and vasoactive.1 These cells, however, are highly sensitive to injury caused by oxidative stress, an imbalance between oxidants and antioxidants in favor of the oxidants, leading to a disruption of redox signaling and control and/or molecular damage.2 Previous studies have indicated that oxidative stress plays a pivotal role in endothelial dysfunction that is closely associated with diabetes, cardiovascular disease, hypertension, and preeclampsia.3,4 To avoid the injury caused by oxidative stress, cells have evolved strategies to overcome this challenge. A major strategy is to activate the nuclear factor erythroid2related factor 2 (Nrf-2)/heme oxygenase-1 (HO-1) signaling pathway,5 which controls the expression of a number of cytoprotective genes that are able to combat the harmful effects of oxidative response. As a result, the Nrf-2/HO-1 signaling pathway has become a therapeutic target of many antioxidants. For example, epigallocatechin-3-gallate (EGCG) derived from green tea induces reactive oxygen species (ROS), leading to the © 2018 American Chemical Society

Received: Revised: Accepted: Published: 1551

November 22, 2017 January 18, 2018 January 30, 2018 January 30, 2018 DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry

protocol was as follows: 0 min, 75% A, 25% B; 4 min, 85% A, 15% B; 12 min, 98% A, 2% B; 13 min, 75% A, 25% B; and 16.5 min, 75% A, 25% B. 2.4. Cell Viability Assay. HUVECs were grown in 96 well plate and incubated with different concentrations of astaxanthin for 18 and 48 h, respectively. The cells were incubated with 20 μL of 3-[4,5dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) for 4 h at 37 °C. After removing the MTT, 150 μL of DMSO was added to each well. The spectrophotometric absorbance of the samples was measured at a wavelength of 492 nm. The data are expressed as the percentage of control, and the experiments were done in triplicate. 2.5. Antioxidant Activity Assays. HUVECs were seeded into 6well culture plates for 24 h until 60−70% confluence, after which cells were treated with astaxanthin for 18 h. Then cells were washed twice with ice-cold PBS and lysed with 200 μL of lysis buffer containing 1 mM phenylmethylsulfonyl fluoride for 30 min on ice. The homogenates were centrifuged at 13 000g for 10 min at 4 °C. Superoxide dismutase (SOD) was measured using a SOD activity assay kit according to the manufacturer’s instructions. One unit of SOD activity was defined as the amount of enzyme needed to exhibit 50% dismutation of superoxide radical. Glutathione peroxidase (GSH-Px) activity was measured using a GSH-Px activity assay kit according to the manufacturer’s instructions. One unit of enzyme activity was defined as the amount of enzyme that caused the oxidation of 1 μmoL of fNADPH to NADP per min at 25 °C. 2.6. Intracellular ROS Assay. The redox-sensitive fluorescent 2,7dichloroflurescenin diacetate (DCFH-DA) probe was used to assess the intracellular levels of ROS. Briefly, HUVECs were seeded into 6well cell culture plates for 18 h until 50−60% confluence. After that, cells were incubated with astaxanthin (1 μM) for either different periods of time or with different concentrations astaxanthin for 18 h. In another experiment, cells were pretreated with VE (30 μM) or Nacetylcysteine (NAC, 10 mM) for 1 h and then incubated with 1 μM astaxanthin for 18 h. Additionally, we also investigated the ROS production of cells induced by hydrogen peroxide (1 mM, 30 min), fucoxanthin (5 μM, 18 h), astaxanthin (1 μM, 18 h), or NAC (10 mM, 1 h). After treatment, cell culture medium was changed with fresh serum-free DMEM. DCFH-DA (15 μM) was then added to the cells and incubated at 37 °C for 45 min, after which cells were trypsinized and washed twice with PBS. ROS measurement was conducted using a Beckman Gallios Flow Cytometer (Beckman Counter, Inc., Brea, CA, U.S.A.), and the data are expressed as mean DCF fluorescence intensity (sum of fluorescence intensities of all cells/the number of cells). 2.7. Real-Time Quantitative PCR. HUVECs were cultured with astaxanthin (1 μM) for different time courses or treated with different concentrations of astaxanthin for 18 and 48 h. After treatment, cells were harvested, and the total RNA was isolated with TaKaLa RNAiso Plus Reagent (TaKaLa, Dalian, China) according to the manufacturer̀s protocol. Total RNA (2 μg) was used as a template to synthesize the first strand of cDNA in a 20 μL reverse transcription (RT) reaction, and 2 μL of RT product was used for PCR amplification using the LightCycler 96 real-time PCR system (Roche, Basel, Switzerland) and SYER-Green I monitoring method. Four pairs of specific primers were used for amplification as previously described,20 namely HO-1-F: AAGTATCCTTGTTGACACG, HO-1-R: TGAGCCAGGAACAGAGTG; NQO1-F: AGACCTTGTGATATTCCAGTTC, NQO1-R: GGCAGCGTAAGTGTAAGC; γ-GCL-F: CAGTGGTGGATGGTTGTG, γ-GCL-R: ATTGATGATGGTGTCTATGC; and β-actin-F: CGGTGAAGGTGACAGCAG, β-actin-R: TGTGTGGACTTGGGAGAGG. β-actin served as the internal control for the real-time quantitative PCR (qPCR) analysis. The concentration of cDNA in each sample was reflected by the threshold cycle (Ct) value, which was compared using the relative quantification method. The relative mRNA expression of each target gene was normalized to that of β-actin. 2.8. Western Blot Analysis. HUVECs were treated with either astaxanthin (1 μM) for different time courses or with different concentrations of astaxanthin for 18 h. In other experiments, HUVECs were pretreated with VE (30 mM) or NAC (10 mM) for 1 h and then

incubation time that can trigger responses in cells. Instead, varied astaxanthin concentrations ranging from 0.025 to 5 mM have been reported,15,16 in addition to the reported incubation periods ranging between 2 and 96 h.17,18 The precise effective utilization ratio and actual concentration of astaxanthin that can permeate the cell membrane remain unclear. For example, Saw et al. demonstrated that astaxanthin protects against oxidative stress via the Nrf-2/antioxidant response element (ARE) pathway in human hepatoma HepG2-C8 cells,19 but the amount of astaxanthin that was taken up by the cells to activate this pathway in vitro was not reported. In this study, we determined the effective concentration and utilization ratio of astaxanthin in HUVECs and investigated the mechanisms underlying stimulation of the Nrf-2/ARE signaling pathway.

2. MATERIALS AND METHODS 2.1. Chemicals. Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), and trypsin were purchased from Gibco BRL (Grand Island, NY, U.S.A.). HPLC grade acetonitrile, n-hexane, ethyl acetate, DMSO, 2,7-dichloroflurescenin diacetate (DCFH-DA) probe, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), and N-acetylcysteine (NAC) were purchased from Sigma (St. Louis, MO, U.S.A.). Lysis buffer, superoxide dismutase (SOD) activity assay kit, and glutathione peroxidase (GSH-Px) activity assay kit were purchased from Beyotime (Shanghai, China). NE-PER nuclear and cytoplasmic extraction kit was purchased from Pierce (Rockford, IL, U.S.A.). Bio-Rad DC Protein assay was purchased from Bio-Rad Laboratories (Hercules, CA, U.S.A.). Anti-HO-1, phosphoJNK (Thr 183 and Tyr 185), NQO1, and histone antibodies were purchased from Cell Signaling Technology (Danvers, MA, U.S.A.). Phospho-extracellular signal-regulated protein kinase 1/2 (ERK1/2) (Thr202/Tyr204), ERK, JNK, phospho-p38 (Thr 180/Tyr 182), p38, phospho-Akt (Ser473), Akt, Nrf-2, and β-actin, horseradish peroxidase (HRP)-conjugated mouse antirabbit IgG, HRP-conjugated goat antimouse IgG secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). Astaxanthin (≥97%) isolated from Haematococcus pluvialis was purchased from Wako Pure Chemical Industries Ltd. (Osaka, Japan). 2.2. Cell Culture and Astaxanthin Preparation. HUVECs were obtained from China Center for Type Culture Collection (Wuhan, China) and maintained in DMEM with 10% (v/v) FBS in a humidified incubator at 37 °C with 5% CO2 and 95% air. Cells were cultured until 50−70% confluence and then treated with astaxanthin at different concentrations for different time courses. To prepare different concentrations of astaxanthin, 10 mg of astaxanthin was solubilized in 500 μL of dimethyl sulfoxide (DMSO, final concentration of 0.03%). Then it was slowly added to FBS and completely mixed, after which the mixture was added to the cell culture medium according to the working concentrations. 2.3. Kinetic Uptake Assay. Cells were treated with a serial dilution of astaxanthin (0.1, 1, and 10 μM) for different time courses (6, 12, 18, 24, 36, or 48 h). At the end of each incubation period, cells were harvested by trypsin treatment and counted by blood counting chamber. Cells were washed three times with ice-cold phosphatebuffered saline (PBS), and lysed with 200 μL of lysis buffer containing 20 mM Tris (pH7.5), 150 mM NaCl, 1% Triton X-100 and sodium pyrophosphate, β-glycerophosphate, EDTA, Na3VO4, and leupeptin. The homogenates containing astaxanthin were extracted with 1 mL of N-hexane:ethyl acetate (1:2, v:v), followed by ultrasonic decomposition for 15 min in an ice-cold container and centrifugation at 13 000g for 10 min at 4 °C. After centrifugation, the organic layer was collected and dried under nitrogen gas and redissolved in methanol. Samples were analyzed by high-performance liquid chromatography− mass spectrometry (Thermo Fisher Scientific, Waltham, MA, U.S.A.). Analyses were performed at 25 °C using a Hypersil Gold C18 column (100 mm × 2.1 mm, 3 μm, Thermo Fisher Scientific). Acetonitrile (A) and deionized water (B) were used for gradient elution. The elution 1552

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry stimulated with 1 μM astaxanthin for 18 h. Nuclear extracts were prepared by using the NE-PER nuclear and cytoplasmic extraction kit according to the manufacturer’s protocol. For total protein, cells were washed twice with ice-cold PBS and lysed with 200 μL of lysis buffer containing 1 mM phenylmethylsulfonyl fluoride for 30 min on ice. The homogenates were centrifuged at 13 000g for 10 min at 4 °C. The protein concentration was determined with the Bio-Rad DC protein assay according to the manufacturer’s instructions. For Western blot analysis, 30 μg of proteins (nuclear extracts or whole cell lysates) was resolved on 10% sodium dodecyl sulfate polyacrylamide gels and then transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% skim milk in Tris-buffered saline with Tween20 (TBST) for 2 h at room temperature and washed with TBST three times. Then the membranes were incubated overnight at 4 °C with antibodies against HO-1 (1:2000), phospho-JNK (1:1000), NQO1 (1:1000), Histone (1:1000), phospho-extracellular signal-regulated protein kinase 1/2 (ERK1/2) (1:500), ERK (1:500), JNK (1:500), phospho-p38 (1:500), p38 (1:500), phospho-Akt (1:1000), Akt (1:1000), Nrf-2 (1:1000), or β-actin (1:1000). The membranes were washed with TBST three times followed by incubation for 1 h at room temperature with horseradish peroxidase (HRP)-conjugated mouse antirabbit IgG (1:2000) or HRP-conjugated goat antimouse IgG (1:8000) secondary antibodies. After three times washing with TBST, immunoreactive proteins were detected with WesternBright ECL (Advansta Inc., Menlo Park, CA, U.S.A.). The results were quantified by measuring the band intensity and comparing it to that of β-actin using AlphaView Software (Alpha Innotech, San Leandro, CA, U.S.A.). Data represent as the % of control. 2.9. Transient Transfection and Luciferase Reporter Assays. To examine the effects of astaxanthin on Nrf-2 activation, HUVECs were transiently cotransfected with 1 μg of firefly luciferase reporter plasmid p-ARE-Luc (Clontech Laboratories, Palo Alto, CA, U.S.A.) and 0.1 μg of p-RL by using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions. 24 h after transfection, cells were treated with astaxanthin for 18 h. Firefly and Renilla luciferase activities were measured in cell lysates using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, U.S.A.). All of the experiments were repeated three times, and the luciferase activity was calculated and normalized to renilla luciferase activity. 2.10. Nrf-2 RNA Interference Assay. Short interfering RNA (siRNA) duplexes were synthesized by GenePharma (Shanghai, China). The Nrf-2 siRNA duplex with the following sense and antisense strands was used: 5′-GGAGGCAAGAUAUAGAUCUTT-3′ (sense) and 5′-AGAUCUAUAUCUUGCCUCCTT-3′ (antisense). HUVECs were cultured in 6-well plates. At 50−60% confluence, the media was replaced with OPTI-MEM reduced serum medium. Transient transfection of siRNAs was conducted using X-tremeGENE siRNA transfection reagent (Roche). Briefly, 2 μg of siRNA and 10 μL of X-tremeGENE siRNA transfection reagent was diluted in 100 μL of OPTI-MEM reduced serum medium and incubated for 5 min at room temperature. Diluted X-tremeGENE siRNA transfection reagent was added to the siRNA dilution and incubated for 20 min at room temperature, after which the transfection compound was directly added to the cells. 8 h after transfection, the cell culture medium was replaced with fresh media containing different concentrations of astaxanthin and incubated for another 48 h. The protein expression of HO-1 and Nrf-2 was determined by Western blot analysis, and the mRNA level of HO-1 gene was determined by qRT-PCR. The GSHPx enzyme activity was examined by GSH-Px Activity Assay Kit. 2.11. Statistical Analysis. Statistical analyses were performed using SPSS software, version 16.0 (SPSS Inc., Chicago, IL, U.S.A.). The results are expressed as mean ± standard deviation (SD), and the statistical significance was analyzed by one-way ANOVA with the Tukey multiple comparison test. P values less than 0.05 were considered statistically significant.

Figure 1. Accumulation of astaxanthin in HUVECs. Cells were incubated with 0.1, 1, and 10 μM astaxanthin for 0, 6, 12, 18, 24, and 48 h.

18 h, and the peak level was reached at 18 h and remained unchanged from 24 to 48 h. In addition, it was shown that the maximum concentration of intracellular astaxanthin was 4.622 nmol/106 cells when cells were incubated with 10 μM astaxanthin for 18 h, indicating an uptake rate of 0.0462%. As a control, astaxanthin was undetectable in parallel untreated cell cultures. 3.2. Astaxanthin Increased Intracellular ROS but Did Not Cause Cytotoxicity. Treatment of cells with astaxanthin (1 μM) for different time courses caused the production of a small amount of ROS. As shown in Figure 2A, incubation of cells with 1 μM astaxanthin for 12, 18, 24, and 48 h resulted in the increase of intracellular ROS levels by 7.87%, 13.28%, 8.79%, and 1.58%, respectively, compared with control cells. We also used various concentrations of astaxanthin to treat HUVECs for 18 h, and low levels of ROS were observed in a concentration-dependent manner (Figure 2B). Specifically, the intracellular ROS level was increased by 18.2% after treatment with 10 μM astaxanthin for 18 h. In addition, it was shown that pretreatment of cells with antioxidants VE or NAC significantly inhibited astaxanthin-induced ROS production. Pretreatment of cells with VE reduced 93.94% of ROS that induced by astaxanthin treatment, while treatment of cells with NAC not only eliminated the astaxanthin-induced ROS production but also caused a reduction of endogenous ROS level by 2.06% compared with control cells (Figure 2C). Furthermore, a previous study showed that treatment of BNL CL.2 cells with fucoxanthin can cause a low level of increase for intracellular ROS, which leads to the activation of intracellular antioxidant pathway.21 Our result also indicated that fucoxanthin caused 28.33% of increase of ROS compared with control cells. To determine whether the amount of ROS produced upon astaxanthin treatment can cause any cellular toxicity, we evaluated cell viability with MTT method. As shown in Figure 3, treatment of cells with astaxanthin did not lead to cytotoxic effect, however, which increased cell survival in terms of concentration and time. Either treatment of cells with 10 μM astaxanthin for 18 h or treatment with 1 or 10 μM astaxanthin for 48 h significantly increased cell survival (p < 0.05). Notably, compared with control cells, cell viability was increased by 73.86% upon treatment with10 μM astaxanthin for 48 h. 3.3. Astaxanthin Increases HO-1 Expression in HUVECs. ROS can induce the expression of HO-1 protein in cells.22 In this study, Western blot analysis showed that

3. RESULTS 3.1. Astaxanthin Uptake. As shown in Figure 1, the intracellular level of astaxanthin was gradually increased within 1553

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry

Figure 2. Effects of astaxanthin on intracellular ROS levels in HUVECs. 2′7′-Dichlorofluorescenin diacetate (DCFH-DA) was used to measure intracellular ROS levels, and mean DCF fluorescence intensity was analyzed by flow cytometry. (A) HUVECs were treated with 1 μM astaxanthin for 0, 12, 18, 24, and 48 h. (B) Cells were treated with 0.1, 1, and 10 μM for 18 h. (C) Cells were pretreated with either VE (30 μM) or NAC (10 mM) for 1 h, followed by treatment with astaxanthin (1 μM) for 18 h. (D) Cells were either treated with 1 μM astaxanthin or 5 μM fucoxanthin for 18 h or treated with 1 mM H2O2 for 30 min or 10 mM NAC for 1 h. **p < 0.01 (n = 8), compared with the control.

evaluate the effect of ROS on HO-1 expression, we pretreated the cells with either 30 μM VE or 10 mM NAC for 1 h, followed by 1 μM astaxanthin treatment for 18 h. It was shown that pretreatment of cells with VE caused 84.54% of reduction of HO-1 expression induced by astaxanthin compared to the astaxanthin treatment only group, whereas NAC completely abrogated the increased expression of HO-1 induced by astaxanthin. Then we used qPCR to analyze the mRNA levels of HO-1, γGCL (the rate-limiting enzyme in GSH biosynthesis that contributes to cytoprotection), and NQO1 (a Nrf-2-regulated phase II enzyme that plays an important role in detoxifying quinones). It was shown that treatment of cells with 1 μM astaxanthin for different time courses led to increased mRNA levels of HO-1, γ-GCL, and NQO1, but only upregulation of HO-1 was statistically significant. Notably, the mRNA levels of three genes were increased from 12 to 18 h, followed by a decrease at 48 h (Figure 4D). Treatment of cells with 0.1, 1, and 10 μM astaxanthin for 18 h led to the significant upregulation of HO-1expression by 2.09-, 2.11-, and 2.28-fold, respectively, compared to the control (p < 0.01; Figure 4E), but only 10 μM astaxanthin treatment increased the mRNA expression of γ-GCL (p < 0.05). In contrast, these treatments did not cause a significant increase of NQO1 mRNA level. With treatment with astaxanthin for 48 h, the mRNA expression of HO-1 upregulated by more than 2 times, compared to the control. Treatment with 10 μM astaxanthin significantly increased the mRNA expression of γ-GCL and NQO1 (Figure 4F). 3.4. Astaxanthin-Mediated Induction of GSH-Px Activity. GSH-Px and SOD are major antioxidant enzymes that are regulated by a common Nrf-2/ARE pathway and

Figure 3. Effects of astaxanthin on HUVEC survival. Cells were incubated with 0.1, 1, or 10 μM astaxanthin for 18 and 48 h, respectively. The data are presented as the mean ± SD of three experiments. *p < 0.05 and **p < 0.01 (n = 3) compared with the control.

treatment of HUVECs with 1 μM astaxanthin led to an increase of HO-1 expression from 12 to 18 h, with a peak increase at 18 h by about 59% (p < 0.01), which gradually decreased from 24 to 48 h (Figure 4A). In addition, treatment of cells with different concentrations of astaxanthin for 18 h also significantly increased the expression of HO-1 (p < 0.01; Figure 4B), and the protein level was increased by 61.42% when cells were exposed to 10 μM astaxanthin. In contrast, it was shown that treatment of cells with 0.1 and 1 μM astaxanthin did not increase the expression of NQO1 protein, although 10 μM treatment increased the NQO1 level markedly (p < 0.05). To 1554

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry

Figure 4. Effects of astaxanthin on protein expression of HO-1 and NQO1, as well as mRNA expression of NQO1, γ-GCL, and HO-1 in HUVECs. Western blotting was used to determine the expression of HO-1 and NQO1 protein, and real-time qPCR was used to determine the mRNA expression of NQO1, γ-GCL, and HO-1. (A) HUVECs were treated with 1 μM astaxanthin for 0, 12, 18, 24, and 48 h. (B) Cells were treated with 0.1, 1, and 10 μM for 18 h. (C) Cells were pretreated with either VE (30 μM) or NAC (10 mM) for 1 h, followed by treatment with astaxanthin (1 μM) for 18 h. (D) HUVECs were treated with 1 μM astaxanthin for 0, 12, 18, 24, and 48 h. (E) Cells were treated with 0.1, 1, and 10 μM astaxanthin for 18 h. (F) Cells were treated with 0.1, 1, and 10 μM astaxanthin for 48 h. *p < 0.05 and **p < 0.01 (n = 3), compared with control. ## p < 0.01 (n = 6) compared with astaxanthin treatment alone.

3.5. Astaxanthin Activates the Nrf-2/HO-1 Pathway. Nrf-2/ARE is the major pathway that regulates phase II antioxidant responses, which can be activated by small amounts of ROS. Some compounds induce HO-1 expression through the activation of the Nrf-2/ARE pathway.23 We therefore investigated whether astaxanthin could also activate this pathway. Because Nrf-2 dissociates from Keap1 upon the oxidative response and translocates to the nucleus, wherein it is phosphorylated at serine 40 by mitogen-activated protein kinases (MAPKs) and phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) signaling pathway,24 we examined the expression of kinases in the MAPK family members (i.e., p38, ERK, and JNK) and PI3K/Akt. Western blot analysis revealed that treatment of cells with different concentrations of astaxanthin did not affect the p-38 level but significantly increased the level of p-ERK (p < 0.05), and incubation with 10 μM astaxanthin for 18 h increased the level by 61% (Figure 6). Although expression of p-Akt was also increased, it showed no statistical significance. We further examined the effect of astaxanthin on Nrf-2 protein expression. Incubation of cells with astaxanthin for 18 h caused a decreased level of Nrf-2 protein in cytoplasm and significantly increased the accumulation of Nrf-2 protein at the nucleus (p < 0.05; Figure 7A). Notably, treatment of cells with 10 μM astaxanthin led to the highest accumulation of protein in the nucleus, which was 1.48-fold higher than that of the control. These results suggested that astaxanthin promoted the translocation of Nrf-2 from cytoplasmic to the nucleus. Furthermore, we analyzed the induction of a luciferase reporter

regulate the redox state of the cell. Here, we determined the effects of astaxanthin on the activity of both enzymes. As shown in Figure 5, treatment of cells with astaxanthin caused an

Figure 5. Effects of astaxanthin on GSH-Px and SOD activities in HUVECs. Cells were incubated with 0.1, 1, or 10 μM astaxanthin for 18 h. The data are presented as mean ± SD *p < 0.05 and **p < 0.01 (n = 3) compared with the control.

increased enzyme activity of GSH-Px. Notably, 10 μM astaxanthin increased GSH-Px enzyme activity by 2.62-fold compared with the control. In contrast, astaxanthin treatment did not cause a significant increase of SOD activity, although 10 μM of astaxanthin treatment resulted in 23% rise but with no statistically significance. 1555

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry

Figure 6. Effect of astaxanthin on MAPK and PI3K signal pathways. HUVECs were treated with different concentrations of astaxanthin for 18 h. Whole cell lysates were prepared and analyzed by Western blotting. *p < 0.05 and **p < 0.01 (n = 3) compared with the control.

microscope. To date, only one study has reported the permeability of astaxanthin into cells. Chew et al. reported that astaxanthin (1 μM) could slowly permeate into HUVECs with maximum uptake at 48 h and maximum utilization of 0.0125%.10 In our study, the maximum uptake of astaxanthin in HUVECs occurred at 18 h, and the amount of astaxanthin utilization was 0.033%. We used the same astaxanthin concentration (1 μM), cell type (HUVECs), and incubation times (12−48 h) as those used in the study by Chew et al.,10 but we changed the solvent from tetrahydrofuran to DMSO. Although astaxanthin is soluble in both solvents, the different maximum uptake times and utilization between the two studies may indicate that DMSO is better for facilitating the cell permeability of astaxanthin. However, even with DMSO as the solvent, the effective concentration of astaxanthin detected in cells was still extremely low and was less than 0.05%. Therefore, the concentration reported in other papers is most likely not the actual amount of astaxanthin that entered the cells.25 Showalter et al. reported that, when a 500 mg/kg single dose of astaxanthin was applied to C57BL/6 mice, the effective oral dose was 338 mg/kg and the distributions of free astaxanthin in liver tissue and plasma were 1.73 and 0.381 μM, respectively, suggesting that the reported dosage should be considered for treating cells in order to obtain the efficient effect.26 Herein, we used astaxanthin with concentrations ranging from 0.1 to 10 μM in our experiments, which covered the reported doses in the tissue and circulation.

containing an Nrf-2-dependent antioxidant response element (ARE-Luc). As shown in Figure 7B, astaxanthin treatment induced ARE-Luc reporter activity, and ARE-luciferase activity was markedly increased after 18 h of incubation (p < 0.05), indicating that astaxanthin activates Nrf-2-dependent transcription. To further investigate whether the Nrf-2/ARE pathway was involved in the expression of HO-1 induced by astaxanthin, we used siRNA to knockdown Nrf-2 in HUVECs. It was shown that transfection of specific siRNA successfully caused 67% reduction of the Nrf-2 protein level within cells. As expected, knockdown of Nrf-2 resulted in 40% reduction of HO-1 in protein level (Figure 7C). Interestingly, it was also shown that siRNA knockdown of Nrf-2 completely inhibited the mRNA expression of HO-1 induced by astaxanthin (Figure 7D). We further examined the effect of siRNA knockdown of Nrf-2 on the activity of GSH-Px enzyme. As shown in Figure 7E, reduction of Nrf-2 with siRNA significantly inhibited the GSHPx enzyme activity induced by astaxanthin.

4. DISCUSSION Astaxanthin has a nonpolar polyene chain in the middle of the molecule, which is the root of its poor cell permeabilization. Our results showed that when astaxanthin was added to the cell culture media most of it was unable to permeate the cell membrane, as evident by the large amount of red crystals observed in the bottom of the cell culture plate with a 1556

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry

Figure 7. Effects of astaxanthin on nuclear accumulation of Nrf-2, ARE activation, mRNA expression of HO-1 and γ-GCL, as well as GSH-Px enzyme activity in HUVECs. (A) HUVECs were treated with 0.1, 1, and 10 μM astaxanthin for 18 h. The Nrf-2 nuclear proteins were analyzed by Western blotting. (B) HUVECs were transiently transfected with the p-ARE-Luc reporter plasmid and then treated with different concentrations of astaxanthin for 18 h. Firefly and Renilla luciferase activities were detected, and fold induction was calculated by normalizing to Renilla luciferase activities. (C) Cells were transiently transfected with Nrf2 siRNA (2 μg) for 8 h and then grown with fresh DMEM medium for additional 48 h. The protein level of Nrf2 was determined by Western blotting. (D) Cells were transiently transfected with Nrf2 siRNA (2 μg) for 8 h and then treated with 1 μM astaxanthin for 48 h. HO-1 mRNA expression was determined by qPCR. (E) Cells were transiently transfected with Nrf2 siRNA (2 μg) for 8 h and then treated with 0.1, 1, and 10 μM astaxanthin for 48 h. The GSH-Px enzyme activity was determined by GSH-Px activity assay kit. *p < 0.05 and **p < 0.01, compared with the control; ##p < 0.01, compared with siRNA group.

NAC (glutathione precursor, which can directly reduce cellular oxidative stress and is used as a source of sulfhydryl to neutralize ROS, or indirectly restores glutathione content) to treat the cells that treated by astaxanthin.29,30 Our result indicated that VE and NAC efficiently reduced the ROS production from cells that were treated with astaxanthin, indicating that astaxanthin can induce the production of small amounts of ROS. However, an interesting characteristic that separates astaxanthin from other antioxidants is that astaxanthin will never become a pro-oxidant because of the oxo functional group in its unique structure.31 In addition, because astaxanthin treatment alone promoted cell proliferation and increased the enzyme activity of GSH-Px and SOD, we concluded that generated ROS was harmless to the HUVECs. In our previous study, it was found that astaxanthin protected HUVECs from H2O2-induced oxidative stress and decreased the ROS generation induced by H2O2.4 It has also been reported that low ROS levels are beneficial for normal physiological actions such as cellular signaling, gene expression, and stimulation of antioxidative defense mechanisms.32,33 Therefore, we speculated that astaxanthin-induced generation of trace amounts of ROS may act as a secondary signal to activate the antioxidant pathway.

The antioxidant mechanisms of astaxanthin have been reported by several studies from different aspects. Astaxanthin can span the cell membrane bilayer (fat/water) because of its unique structure with polar terminal rings. The polar structures have the potent capacity to quench free radicals or other oxidants at the surface, while its polyene chain is able to remove high-energy electrons from free radicals via the carbon−carbon chain.13 Wolf et al. reported that the antioxidant effects of astaxanthin were not achieved by scavenging free radicals but by reducing endogenous oxidative stress and maintaining the mitochondrial membrane potential.12 Wang et al. found that the antioxidant effects of astaxanthin were via upregulation of HO-1 expression through the ERK1/2 pathway in SH-SY5Y cells.27 However, in this study, we found for the first time that astaxanthin can produce trace amounts of ROS, rather than directly quench ROS. Is that possible astaxanthin can be a “prooxidants”, because, under certain conditions, some antioxidants become “pro-oxidants” including some of the better-known carotenoid antioxidants beta carotene, lycopene, and zeaxanthin28 as well as well-known antioxidants such as Vc, VE, and zinc. Therefore, we determined the production of small amounts of ROS by employing antioxidants VE (liposoluble short-chain antioxidant that prevents lipid peroxidation by supplying phenolic hydroxyl group to peroxy radicals) and 1557

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry

astaxanthin-induced activation of Nrf2 and induction of HO-1 in vivo.

The redox-sensitive transcription factor Nrf-2 has been widely studied. Nrf-2 plays an essential role in the AREmediated expression of phase II detoxifying antioxidant enzymes and in the activation of other stress-includible genes in response to oxidative or electrophilic stress.34 HO-1, an enzyme with an obligatory role in the endogenous defense mechanism against oxidative stress,35 is the target gene of the Nrf-2/ARE pathway.36 ROS and electrophilic agents can lead to the nuclear accumulation of Nrf-2 and upregulation of ARElinked gene expression.37 Some antioxidants exert their effects by inducing tiny amounts of ROS to activate the Nrf-2/ARE signal pathway. For example, Wu et al. demonstrated that EGCG caused a mild increase in ROS production, which triggered the signaling pathway that upregulates HO-1 gene expression.38 Farombi et al. reported that ROS derived from curcumin activated Nrf-2-ARE/EpRE signaling by stimulating upstream kinases via the phosphorylation or oxidization of the cysteine thinol of Keap1.29 Liu et al. found that ROS produced by fucoxanthin activated the MAPK pathway to induce Nrf-2/ ARE-HO-1 signaling.21 We also demonstrated that fucoxanthin induced a small amount of ROS with a comparable level induced by astaxanthin, which might be attributed to the fact that both are carotenoid compounds. The relationship between astaxanthin and Nrf2 have already been investigated by some reports. Tripathi et al. showed that astaxanthin can upregulate NQO1 and HO-1 expression by activation of the Nrf-2/ARE pathway in rats.30 Inoue et al. also mentioned that astaxanthin can activate Nrf-2 protein.39 However, it is still unclear how this signaling pathway is activated. In this study, we found that astaxanthin can increase the expression of Nrf-2 protein in nuclear, induce ARE-Luc reporter activity, and up-regulate HO1 mRNA and protein expression in HUVECs. Further study showed that knockdown of Nrf-2 with specific siRNA significantly decreased astaxanthin-induced HO-1 expression and GSH-Px enzyme activity. Meanwhile, preincubation of cells with ROS inhibitors (VE and NAC) blocked astaxanthininduced production of a small amount of ROS, as well as HO-1 expression, indicating that astaxanthin-induced ROS leads to the activation of Nrf-2/ARE signaling pathway as well as HO-1 activation. Additionally, we also investigated the upstream signals causing Nrf-2 activation. It has been reported that MAPK kinases and PI3K/Akt signaling pathway could regulate the Nrf2 action. We detected the activation of PI3K/Akt, as well as p38, ERK, and JNK MAPK kinases and found that astaxanthin induced the phosphorylation of ERK kinase but had no effect on the PI3k/AKT pathway. Li et al. also showed that astaxanthin upregulated the expression of Nrf-2-regulated phase II enzyme through activation of PI3K/Akt in ARPE-19 cells.25 In our study, it was indicated that ERK MAPK may be involved in the activation of the Nrf-2 pathway induced by astaxanthin. In conclusion, this study provides insight into a novel mechanism underlying the antioxidant astaxanthin. Astaxanthin may have a similar antioxidative mechanism as other antioxidants such as polyphenols, flavonoids, and carotenoids. The antioxidant activity of astaxanthin may not by directly scavenging free radicals, but rather by activating their cellular antioxidant defense system through promoting the generation of small amounts of ROS in cells, which activate HO-1 expression and improve the expression and activity of GSH-Px via the ERK-Nrf-2/HO-1 pathway. Further studies will be necessary to clarify the molecular mechanisms underlying

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +86-574-87609574. Fax: +86-574-87609570. E-mail: [email protected]. ORCID

Tingting Niu: 0000-0001-8898-8639 Author Contributions ∇

T.N. and R.X. contributed equally to this work.

Funding

This project was funded by Major Scientific and Technological Project of Zhejiang Province (2016C02055-6B), China Agriculture Research System (CARS-50), Ningbo Programs for Science and Technology Development (2017C110026 and 2017C10020), Zhejiang medical and health science and technology project (2018KY726 and 2018KY710), National Science Foundation of Zhejiang (LY18C190004), Public welfare projects of the state oceanic administration (201505033-2), K.C. Wong Magna Fund in Ningbo University; 151 talents Project; LiDakSum Marine Biopharmaceutical Development Fund; and National 111 Project of China. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Abdelzaher, L. A.; Imaizumi, T.; Suzuki, T.; Tomita, K.; Takashina, M.; Hattori, Y. Astaxanthin alleviates oxidative stress insults-related derangements in human vascular endothelial cells exposed to glucose fluctuations. Life Sci. 2016, 150, 24−31. (2) Sies, H. Oxidative Stress: Impact in Neuroscience Research; Humana Press: New York, 2013; pp 3−7. (3) Donato, A. J.; Morgan, R. G.; Walker, A. E.; Lesniewski, L. A. Cellular and molecular biology of aging endothelial cells. J. Mol. Cell. Cardiol. 2015, 89, 122−135. (4) Xuan, R. R.; Niu, T. T.; Chen, H. M. Astaxanthin blocks preeclampsia progression by suppressing oxidative stress and inflammation. Mol. Med. Rep. 2016, 14 (3), 2697−704. (5) Mcsweeney, S. R.; Warabi, E.; Siow, R. C. Nrf2 as an Endothelial Mechanosensitive Transcription Factor: Going With the Flow. Hypertension 2016, 67 (1), 20. (6) Na, H. K.; Surh, Y. J. Modulation of Nrf2-mediated antioxidant and detoxifying enzyme induction by the green tea polyphenol EGCG. Food Chem. Toxicol. 2008, 46 (4), 1271−8. (7) Lemmens, K. J. A.; Sthijns, M. M. J. P. E.; Vijgh, W. J. F. V. D.; Bast, A.; Haenen, G. R. M. M. The antioxidant flavonoid monoHER provides efficient protection and induces the innate Nrf2 mediated adaptation in endothelial cells subjected to oxidative stress. PharmaNutrition 2014, 2 (3), 69−74. (8) Fassett, R. G.; Coombes, J. S. Astaxanthin in cardiovascular health and disease. Molecules 2012, 17 (2), 2030−48. (9) Wu, H.; Niu, H.; Shao, A.; Wu, C.; Dixon, B. J.; Zhang, J.; Yang, S.; Wang, Y. Astaxanthin as a Potential Neuroprotective Agent for Neurological Diseases. Mar. Drugs 2015, 13 (9), 5750−66. (10) Chew, W.; Mathison, B. D.; Kimble, L. L.; Mixter, P. F.; Chew, B. P. Astaxanthin decreases inflammatory biomarkers associated with cardiovascular disease in human umbilical vein endothelial cells. Am. J. Adv. Food Sci. Technol. 2013, 1, 1−17. (11) Wu, Q.; Zhang, X. S.; Wang, H. D.; Zhang, X.; Yu, Q.; Li, W.; Zhou, M. L.; Wang, X. L. Astaxanthin activates nuclear factor erythroid-related factor 2 and the antioxidant responsive element (Nrf2-ARE) pathway in the brain after subarachnoid hemorrhage in rats and attenuates early brain injury. Mar. Drugs 2014, 12 (12), 6125−41. 1558

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559

Article

Journal of Agricultural and Food Chemistry (12) Wolf, A. M.; Asoh, S.; Hiranuma, H.; Ohsawa, I.; Iio, K.; Satou, A.; Ishikura, M.; Ohta, S. Astaxanthin protects mitochondrial redox state and functional integrity against oxidative stress. J. Nutr. Biochem. 2010, 21 (5), 381−9. (13) Kidd, P. Astaxanthin, cell membrane nutrient with diverse clinical benefits and anti-aging potential. Alternative Medicine Review A Journal of Clinical Therapeutic 2011, 16 (4), 355. (14) Dose, J.; Matsugo, S.; Yokokawa, H.; Koshida, Y.; Okazaki, S.; Seidel, U.; Eggersdorfer, M.; Rimbach, G.; Esatbeyoglu, T. Free Radical Scavenging and Cellular Antioxidant Properties of Astaxanthin. Int. J. Mol. Sci. 2016, 17 (1), 103. (15) Yamada, T.; Ryo, K.; Tai, Y.; Tamaki, Y.; Inoue, H.; Mishima, K.; Tsubota, K.; Saito, I. Evaluation of therapeutic effects of astaxanthin on impairments in salivary secretion. J. Clin. Biochem. Nutr. 2010, 47 (2), 130−7. (16) Liu, X.; Shibata, T.; Hisaka, S.; Osawa, T. Astaxanthin inhibits reactive oxygen species-mediated cellular toxicity in dopaminergic SHSY5Y cells via mitochondria-targeted protective mechanism. Brain Res. 2009, 1254, 18−27. (17) Yang, Y.; Bae, M.; Kim, B.; Park, Y. K.; Koo, S. I.; Lee, J. Y. Astaxanthin prevents and reverses the activation of mouse primary hepatic stellate cells. J. Nutr. Biochem. 2016, 29, 21−6. (18) Wen, X.; Huang, A.; Hu, J.; Zhong, Z.; Liu, Y.; Li, Z.; Pan, X.; Liu, Z. Neuroprotective effect of astaxanthin against glutamate-induced cytotoxicity in HT22 cells: Involvement of the Akt/GSK-3beta pathway. Neuroscience 2015, 303, 558−68. (19) Saw, C. L.; Yang, A. Y.; Guo, Y.; Kong, A. N. Astaxanthin and omega-3 fatty acids individually and in combination protect against oxidative stress via the Nrf2-ARE pathway. Food Chem. Toxicol. 2013, 62, 869−75. (20) Ungvari, Z.; Bagi, Z.; Feher, A.; Recchia, F. A.; Sonntag, W. E.; Pearson, K.; de Cabo, R.; Csiszar, A. Resveratrol confers endothelial protection via activation of the antioxidant transcription factor Nrf2. Am. J. Physiol Heart Circ Physiol 2010, 299 (1), H18−24. (21) Liu, C. L.; Chiu, Y. T.; Hu, M. L. Fucoxanthin enhances HO-1 and NQO1 expression in murine hepatic BNL CL.2 cells through activation of the Nrf2/ARE system partially by its pro-oxidant activity. J. Agric. Food Chem. 2011, 59 (20), 11344−51. (22) Zhang, J.; Ohta, T.; Maruyama, A.; Hosoya, T.; Nishikawa, K.; Maher, J. M.; Shibahara, S.; Itoh, K.; Yamamoto, M. BRG1 interacts with Nrf2 to selectively mediate HO-1 induction in response to oxidative stress. Mol. Cell. Biol. 2006, 26 (21), 7942−52. (23) Zhang, Z.; Cui, W.; Li, G.; Yuan, S.; Xu, D.; Hoi, M. P.; Lin, Z.; Dou, J.; Han, Y.; Lee, S. M. Baicalein protects against 6-OHDAinduced neurotoxicity through activation of Keap1/Nrf2/HO-1 and involving PKCalpha and PI3K/AKT signaling pathways. J. Agric. Food Chem. 2012, 60 (33), 8171−82. (24) Yang, Y. C.; Lii, C. K.; Lin, A. H.; Yeh, Y. W.; Yao, H. T.; Li, C. C.; Liu, K. L.; Chen, H. W. Induction of glutathione synthesis and heme oxygenase 1 by the flavonoids butein and phloretin is mediated through the ERK/Nrf2 pathway and protects against oxidative stress. Free Radical Biol. Med. 2011, 51 (11), 2073−81. (25) Li, Z.; Dong, X.; Liu, H.; Chen, X.; Shi, H.; Fan, Y.; Hou, D.; Zhang, X. Astaxanthin protects ARPE-19 cells from oxidative stress via upregulation of Nrf2-regulated phase II enzymes through activation of PI3K/Akt. Mol. Vis 2013, 19, 1656−66. (26) Showalter, L. A.; Weinman, S. A.; Osterlie, M.; Lockwood, S. F. Plasma appearance and tissue accumulation of non-esterified, free astaxanthin in C57BL/6 mice after oral dosing of a disodium disuccinate diester of astaxanthin (Heptax). Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 2004, 137 (3), 227. (27) Wang, H. Q.; Sun, X. B.; Xu, Y. X.; Zhao, H.; Zhu, Q. Y.; Zhu, C. Q. Astaxanthin upregulates heme oxygenase-1 expression through ERK1/2 pathway and its protective effect against beta-amyloidinduced cytotoxicity in SH-SY5Y cells. Brain Res. 2010, 1360, 159−67. (28) Martin; Ruck, H. D.; Schmidt, C.; Sell, M.; Beutner, S.; Mayer, S.; Walsh, B. Chemistry of carotenoid oxidation and free radical reactions. Pure Appl. Chem. 1999, 71 (12), 2253−2262.

(29) Farombi, E. O.; Shrotriya, S.; Na, H. K.; Kim, S. H.; Surh, Y. J. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-mediated induction of heme oxygenase-1. Food Chem. Toxicol. 2008, 46 (4), 1279−87. (30) Tripathi, D. N.; Jena, G. B. Astaxanthin intervention ameliorates cyclophosphamide-induced oxidative stress, DNA damage and early hepatocarcinogenesis in rat: role of Nrf2, p53, p38 and phase-II enzymes. Mutat. Res., Genet. Toxicol. Environ. Mutagen. 2010, 696 (1), 69−80. (31) Beutner, S.; Bloedorn, B.; Frixel, S.; Hernández Blanco, I.; Hoffmann, T.; Martin, H. D.; Mayer, B.; Noack, P.; Ruck, C.; Schmidt, M. Quantitative assessment of antioxidant properties of natural colorants and phytochemicals: carotenoids, flavonoids, phenols and indigoids. The role of β-carotene in antioxidant functions. J. Sci. Food Agric. 2001, 81 (6), 559−568. (32) Galati, G.; O’Brien, P. J. Potential toxicity of flavonoids and other dietary phenolics: significance for their chemopreventive and anticancer properties. Free Radical Biol. Med. 2004, 37 (3), 287−303. (33) Ray, P. D.; Huang, B. W.; Tsuji, Y. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signalling 2012, 24 (5), 981−90. (34) Xu, C.; Li, C. Y.; Kong, A. N. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch. Pharmacal Res. 2005, 28 (3), 249−68. (35) Pugazhenthi, S.; Akhov, L.; Selvaraj, G.; Wang, M.; Alam, J. Regulation of heme oxygenase-1 expression by demethoxy curcuminoids through Nrf2 by a PI3-kinase/Akt-mediated pathway in mouse beta-cells. Am. J. Physiol Endocrinol Metab 2007, 293 (3), E645−55. (36) Lee, J. S.; Surh, Y. J. Nrf2 as a novel molecular target for chemoprevention. Cancer Lett. 2005, 224 (2), 171−184. (37) Perera, R. M.; Bardeesy, N. Cancer: When antioxidants are bad. Nature 2011, 475 (7354), 43−44. (38) Wu, C. C.; Hsu, M. C.; Hsieh, C. W.; Lin, J. B.; Lai, P. H.; Wung, B. S. Upregulation of heme oxygenase-1 by Epigallocatechin-3gallate via the phosphatidylinositol 3-kinase/Akt and ERK pathways. Life Sci. 2006, 78 (25), 2889−97. (39) Inoue, Y.; Shimazawa, M.; Nagano, R.; Kuse, Y.; Takahashi, K.; Tsuruma, K.; Hayashi, M.; Ishibashi, T.; Maoka, T.; Hara, H. Astaxanthin analogs, adonixanthin and lycopene, activate Nrf2 to prevent light-induced photoreceptor degeneration. J. Pharmacol. Sci. 2017, 134 (3), 147.

1559

DOI: 10.1021/acs.jafc.7b05493 J. Agric. Food Chem. 2018, 66, 1551−1559