Hybridization Cascade Plus Strand-Displacement Isothermal

Feb 11, 2019 - ... Siriraj Hospital, and §Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University , Bangkok , Thailand, ...
2 downloads 0 Views 3MB Size
Download PDF
Article Cite This: Anal. Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/ac

Hybridization Cascade Plus Strand-Displacement Isothermal Amplification of RNA Target with Secondary Structure Motifs and Its Application for Detecting Dengue and Zika Viruses W. Saisuk,†,‡ C. Srisawat,§ S. Yoksan,∥ and T. Dharakul*,‡ Graduate Program in Immunology; ‡Department of Immunology, Faculty of Medicine Siriraj Hospital, and §Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand, 10700 ∥ Institute of Molecular Biosciences, Mahidol University, Nakhon Pathom, Thailand, 73170 Downloaded via UNIV OF NEW ENGLAND on February 11, 2019 at 22:30:23 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

S Supporting Information *

ABSTRACT: Biological RNA generally comprises secondary structure motifs which cause a problem for target RNA detection by isothermal amplification methods. The complexity of the secondary structures makes RNA targets inaccessible for probe hybridization, resulting in decreased sensitivity and selectivity. This is particularly important because the hybridization step of the isothermal amplification method requires a limited temperature range. A strand-displacement strategy can enhance the hybridization efficiency between the probe and target RNA with secondary structure motifs. A short, singlestranded segment within the secondary structure can be used as a toehold for initiating strand displacement. The strategy has been used to establish a highly sensitive isothermal amplification by a combination of a hairpin probe hybridization and stranddisplacement amplification. The hairpin probe is placed on the single-stranded segment of the target RNA’s secondary structure to initiate strand displacement. The probe’s hybridization cascade provides a template for exponential amplification in two directions by strand-displacement amplification, designated hybridization cascade plus strand-displacement isothermal amplification (HyCaSD). The method requires no reverse transcription step. HyCaSD showed an excellent sensitivity with the limit of detection in the femtomolar (fM) range for synthetic targets as well as viral RNAs. Discrimination between DENV/ ZIKV and JEV/CHIKV was successfully demonstrated using real viruses. Therefore, HyCaSD is a promising platform that can be further developed for diagnostic applications.

B

applying this strategy to isothermal amplification. However, only one study has been able to successfully demonstrate detection of the target RNA secondary structure using the integration of the strand-displacement strategy into an isothermal amplification.17 In this study, we established a novel isothermal amplification method based on strand-displacement amplification. A hairpin probe was designed by a combination of a molecular beacon and a toehold-mediated strand displacement. The hairpin probe was placed on the single-stranded segment of the target RNA secondary structure. After target RNA hybridization with the first hairpin probe, the toehold sequence of the second hairpin probe was used to bind the first probe and to initiate probe−probe hybridization through toehold-mediated strand displacement. The hybridization complex was then further amplified by strand-displacement amplification. The dengue

iological RNAs generally tend to fold on themselves to form a stable secondary structure because the complementary base pairs are not thermodynamically stable when they are dissociated.1,2 The folded secondary structure motifs comprise a variety of possible architectures, such as hairpins, bulges, or internal loops.3,4 These stable RNA secondary structures make them inaccessible for probe hybridization.1,5−9 This is particularly important for isothermal amplification. The hybridization in isothermal amplification methods requires a limited range of temperature, unlike conventional polymerase chain reaction (PCR) amplification, with which the RNA secondary structure can be unfolded by heating it in a thermocycler. A strand-displacement strategy has been proposed to enhance the probe hybridization efficiency for the target RNA with the secondary structures.10−16 A short, singlestranded segment in the target RNA secondary structure is used as a toehold for probe binding to initiate strand displacement. With this strategy, the probe can efficiently form a duplex directly with the target RNA and unfold the secondary structure of the target RNA. Therefore, locating the probe binding site on the single-stranded segment is the key to © XXXX American Chemical Society

Received: August 16, 2018 Accepted: February 1, 2019

A

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

virus (DENV) genomic RNA, which is well-known to have secondary structure motifs, was used as the model target.

B

sequence

AGCATATTGACGCTGGGAAAGACCAGAGATCCTGCTGTCTCTACAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAACAGGTTCT TAATACGACTCACTATAGCATATTGACGCTG AGAACCTGTTGATTC CGGGTGAGCGGATCTCTGGTCTTTCCCAGCGTCAAGAATGCCCGCTCACCCGCTCCCT CCCGCTCCCTGATCTCTGGTCTTTCCCAGCGTCAAGAATGCCAGGGAGCGGGTGAGCG 105-nt synthetic target T7-forward primer reverse primer P1 probe P2 probe

Table 1. Sequences of the Synthetic Target, Primers, and DNA Probesa

EXPERIMENTAL SECTION Materials. The probes were simulated and designed by NUPACK web-based software (http://www.nupack.org/)18 and synthesized by Bio Basic Inc. (Markham, Ontario, Canada). A DNA sequence of 105-nt 3′-untranslated region (UTR) of the DENV genome was synthesized and purified by Integrated DNA Technologies (Coralville, IA, U.S.A.). The primers for the in vitro transcription were synthesized by Bio Basic Inc. (Markham, Ontario, Canada). The detailed sequence information on all the DNA and RNA used in this study is in Table 1. The nicking endonuclease Nb.BsmI, NEBuffer 3.1, Bst 2.0 DNA polymerase, and ThermoPol Reaction buffer were purchased from New England Biolabs, Inc. (Ipswich, MA, U.S.A.). The deoxynucleotide solution mixture (dNTP), PCR buffer, and Taq DNA polymerase were purchased from Geneaid (Taipei, Taiwan). SYBR Gold was purchased from Thermo Fisher Scientific (Waltham, MA, U.S.A.). T7 RNA polymerase was purchased from Epicenter (Madison, WI, U.S.A.). The viruses used in the present study were propagated in C6/36 cell lines. The culture supernatant fluid of the DENV-1 strain 16007, DENV-2 strain 16681, DENV-3 strain 16562, DENV-4 strain 1036, Zika virus (ZIKV) ATCC VR-84 strain MR766, Japanese encephalitis virus (JEV) Beijing strain, Chikungunya virus (CHIKV) strain Ss08/363, and uninfected C6/36 cells were obtained from the Center for Vaccine Development, Institute of Science and Technology for Research and Development, Mahidol University (Nakhon Pathom, Thailand). RNA Target Preparation. The PCR reaction mixture consisted of 1× PCR buffer (15 mM Tris−HCl pH 8.75, 50 mM KCl, 2 mM MgCl2), 200 μM dNTPs, 2.5 U of Taq DNA polymerase, 1 mM T7 promoter-forward primer and reverse primer, and 2 μM 105-nt DNA template from 3′-UTR of DENV genome in a total volume of 100 μL. The PCR conditions consisted of an initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 30 s, primer annealing at 54 °C for 40 s, and elongation at 72 °C for 50 s. Then, final elongation was carried out at 72 °C for 3 min. The PCR product was purified by a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) for in vitro transcription by T7 RNA polymerase. After the in vitro transcription, the reaction was purified using a QIAquick nucleotide removal kit according to the manufacturer’s instructions (QIAGEN, Hilden, Germany). The RNA concentration was measured with a NanoDrop 8000 (Thermo Fisher Scientific, Waltham, MA, U.S.A.), and the integrity of the transcript was analyzed using 3% agarose gel. Viral RNA Extraction. RNA was extracted from 140 μL of culture supernatant fluid of DENV, ZIKV, JEV, CHIKV, and uninfected C6/36 cells using a QIAamp Viral RNA Mini kit according to the manufacturer’s instructions (QIAGEN, Hilden, Germany). The concentrations and integrity of the viral RNA samples were analyzed using an absorbance of 260 nm by NanoDrop 8000 and mobility on agarose gel electrophoresis. Quantitative reverse transcription PCR (qRT-PCR) was carried out in a LightCycler 480 (Roche, Germany) with the known-concentration synthetic target DNA to construct a standard curve. The reaction mixture was composed of different concentrations of target DNA, 1 μM each forward

definition

■

a The italic sequence represents an additional T7 promoter sequence, the bold sequence represents the stem structure of the probes, and the underlined sequence represents nicking endonuclease recognition sequence.

Analytical Chemistry

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry and reverse primers, 1× QuantiTect SYBR Green PCR Master Mix (QIAGEN, Hilden, Germany), 3.5 mM Mg2+, and nuclease-free water. The amplification reaction contained a preheat step at 95 °C for 15 min. Forty cycles of amplification step was then performed, including denaturation at 94 °C for 15 s, annealing at 54 °C for 15 s, and extension at 72 °C for 30 s. The extracted RNA of DENV1−4 was converted into cDNA at 42 °C for 1 h. The reaction mixture was composed of 200 U of M-MLV reverse transcriptase (Promega, U.S.A.), 1× reaction buffer (Promega, U.S.A.), 10 mM dNTP (Promega, U.S.A.), 25 U of Rnasin RNase inhibitor (Promega, U.S.A.), 0.5 μM reverse primer. qRT-PCR was then performed as described above. A concentration of viral RNA in copies per microliter was calculated using a standard curve. The extracted RNA was 10-fold serial diluted in Milli-Q water immediately before use. Hybridization Cascade Plus Strand-Displacement Isothermal Amplification (HyCaSD). The probes and the target were diluted to 1 μM in Milli-Q water immediately before use. The diluted probes and the diluted target were then incubated at 95 °C for 5 min and slowly cooled to room temperature for 50 min to let the probes and the target perfectly fold into an appropriate structure. The reaction mixtures for amplification reaction were prepared separately as part A and part B. Part A consisted of 50 nM P1 and P2 probes and different concentrations of the target RNA. Part B consisted of 250 μM dNTPs, 1× NEBuffer 3.1 (100 mM NaCl, 50 mM Tris−HCl pH 7.9, 10 mM MgCl2, and 100 μg/ mL BSA), 1× ThermoPol Reaction buffer (20 mM Tris−HCl pH 8.8, 10 mM [NH4]2SO4, 10 mM KCl, 2 mM MgSO4, and 0.1% Triton X-100), 3 U of Nb.BsmI, 5 U of Bst 2.0 DNA polymerase, and Milli-Q water. After mixing the A and B solutions in a volume of 30 μL, the reaction mixture was incubated at 50 °C for 40 min. Gel Electrophoresis Analysis. Twenty microliters of the reaction products was mixed with 4 μL of gel loading dye and analyzed with 10% non-denaturing polyacrylamide gel electrophoresis (PAGE) in 1× TBE buffer (9 mM Tris−HCl, pH 7.9, 9 mM boric acid, and 0.2 mM EDTA) at 100 V constant voltage for 60 min. The gel was stained by SYBR Gold and imaged by gel documentation G-box (Syngene, Frederick, MD, U.S.A.). Fluorescence Measurement. Forty microliters of the HyCaSD reaction was prepared as described above. The amplified products were then mixed with 1× SYBR Gold stain. The fluorescence measurements were performed in a Synergy H1 hybrid multimode microplate reader (BioTek, VT, U.S.A.) at excitation wavelength of 490 nm and emission wavelength of 540 nm.

Figure 1. Probes structure. The illustrated probes in the hairpin structure were composed of three critical parts, namely, the stem part (C B B* C* of P1 probe and C* A* A C of P2 probe), the target recognition part (D), and the toehold part (A* of P1 probe and B of P2 probe). The orange-highlighted line represents the nicking endonuclease recognition site.

(C B B* C* of P1 or C* A* A C of P2) opens as a singlestranded form. The toehold domain of the second probe (A* of P1 or B of P2) is used to bind the first unfolded probe. The second probe is also unfolded by strand displacement, forming a P1−P2 hybridization complex. The DNA strands are extended from both 3′-ends by Bst 2.0 DNA polymerase. The double-stranded DNA is then recognized by nicking endonuclease (Scheme 1, in orange). As for the amplification, both strands of the dsDNA are nicked by Nb.BsmI endonuclease, strand-displacement amplification is initiated in both directions, and single-stranded DNA (ssDNA) is released. The released ssDNA become a new target for another round of probe hybridization. Therefore, the P1 and P2 probes function not only as a detector to recognize the target, but also as a template for the strand-displacement amplification reaction. These bifunctional probes play a crucial role in HyCaSD. In the absence of the target, the stable hairpin structure of the probes prevents P1−P2 hybridization. The loop domain of the probes can hybridize and initiate the HyCaSD reaction only in the presence of the single-stranded segment in the target RNA secondary structure. Selection of Probe Binding Site on the Target RNA. The purpose of this study was to design a method for detecting DENV of all four serotypes and distinguishing from the other closely related species. Alignment of the DENV genomic sequences (five sequences for each serotype) with the other species showed that most of the conserved regions for these species were located in the 5′- or the 3′-UTR. The 3′-UTR was the only region of the whole DENV genome that was conserved for all DENV serotypes and was distinguished from the other species. The 3′-UTR was composed of approximately 450 nt, which contained more than 70% of the secondary structure motifs.19 Thus, most of the conserved regions were located within the secondary structure. The probe binding site was chosen from the conserved region of DENV serotypes that contained a single deletion to ZIKV. The DENV RNA genomes within the virion and the infected cells were present in a linear form. However, a part of the RNA genome was transformed into a circular form during replication.19,20 Each form contained different secondary structure motifs (Figure S1). Therefore, a single-stranded segment present within both forms was chosen to be the probe binding site to initiate strand displacement for probe hybridization [Figure S1 (in yellow) and Figure S2]. Bifunctional Probe Design. The bifunctional hairpin probes (P1 and P2 probes) were composed of a loop, toehold,

■

RESULTS AND DISCUSSION Principle of HyCaSD. The probes used in the present method were designed as a hairpin structure with 3′-overhang (Figure 1). The principle has been designated HyCaSD, which consists of hybridization and amplification parts (Scheme 1). The initial part involves the hybridization between the target RNA and the hairpin probes. The single-stranded segment in a target RNA secondary structure is chosen as a probe binding site, to which the loop domain (D) of either the P1 or P2 DNA hairpin probe hybridizes. The target RNA secondary structure and the hairpin probe are simultaneously unfolded through strand displacement. The stem domain of the unfolded probe C

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry Scheme 1. Hybridization Cascade plus Strand-Displacement Amplification (HyCaSD)a

a

The schemes for target RNA secondary structure detection with HyCaSD. Part I, target recognition step: probe recognition site (in blue) of the target RNA was hybridized by the loop part (domain D) of either the P1 or P2 probe. The hybridization unfolded the probe’s stem structure into an opened, single-stranded structure (domains B* C* A* or A C B). The first unfolded probe allowed the second probe to hybridize using its toehold sequence (domain A* or B) and initiated the strand-displacement mechanism, forming a P1−P2 probe complex. Then, the Bst 2.0 DNA polymerase extended the DNA strands in two directions, generating a dsDNA complex with a nicking endonuclease recognition site on both strands. Part II, DNA amplification step: the complex was nicked by Nb.BsmI nicking endonuclease, initiating strand-displacement amplification on both strands of the dsDNA complex at once. The released ssDNA became a new target for another round of probe hybridization.

initiated strand displacement, forming a P1−P2 hybridization complex (target−P1−P2). Hybridization of the target−P1 and target−P2 resulted in a target−P1−P2−target complex. The

and stem (Figure 1). The loop domain (D, in blue) was used to hybridize to the target and unfold the hairpin structure (target−P1/P2). The toehold domain (A* of P1 and B of P2) D

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry toehold sequence could be used to initiate the P1−P2 hybridization only when one of the probes was unfolded. Therefore, in the absence of the target, the stability of the stem domain was critical in preventing target-independent complex formation and false-positive amplification. In addition, the loop domain also contained a sequence (in orange) which was complementary to the nicking enzyme recognition site, which was used for strand-displacement amplification. The formation of the three hybridization complexes was predicted using the NUPACK program; they comprised target−P1/P2, target−P1−P2, and target−P1−P2−target. The prediction showed a high equilibrium probability and high stability at 65 °C, which was the optimal temperature for Bst 2.0 DNA polymerase and Nb.BsmI nicking endonuclease (Figure 2A). In the absence of the target, the P1 and P2 probes

Figure 3. Verification of the probe hybridization. The hybridization reaction of the probes with 105-nt target RNA at 25 and 65 °C monitored by 10% PAGE. T represents the target RNA. C1 represents the hybridized complex of one probe (either the P1 or P2 probe) to one target RNA. C2 and C3 represent the hybridized complex of the P1 and P2 probes with one and two target RNAs, respectively.

To verify the probe extension reaction, a Bst 2.0 DNA polymerase was included in the hybridization mixture and incubated at 50, 55, 60, and 65 °C. As shown at Figure 4A, the dsDNA probe extension product band of 110 bp was observed, while the hybridization complex bands (all three complexes mentioned above) were faded out. However, the targetindependent amplification was observed at 55, 60, and 65 °C. This false amplification was not shown at 50 °C, indicating that the stem structures of the probes were stable enough to prevent the target-independent complex formation at this temperature. Therefore, the temperature of the entire reaction was chosen as 50 °C. In addition, the optimal reaction time was evaluated. The reaction was performed for the different incubation times including 20, 30, 40, and 50 min. The result showed that the amplified product was increased over time and saturated at around 40 min (Figure S3). Therefore, the reaction time of 40 min was chosen as the optimal condition. The last experiment was a strand-displacement amplification reaction by Nb.BsmI nicking endonuclease. The enzyme concentration was titrated (Figure 4B), and 3 U of the enzyme per reaction was chosen to demonstrate the stranddisplacement amplification. This enzyme could nick the dsDNA product from the probe extension step. The ssDNA was then produced and released by the strand-displacement amplification. A band of single-stranded DNA product was observed in the reactions with the target RNA, but not in the absence of the target (Figure 4B). The present study demonstrated that HyCaSD effectively amplified the target RNA with secondary structure motifs. The method also eliminated target-independent amplification, which is a limitation of some isothermal amplification methods.21−23 The present study revealed that toehold-mediated strand displacement was successfully applied in HyCaSD to detect the target RNA with secondary structure motifs by using the single-stranded segment in the target RNA secondary structure as a toehold. The issue of the stable secondary structures of the target DNA/RNA interfering with, and reducing the efficiency of, the hybridization has been discussed in several previous studies.1,6−9,17,24 Toehold-mediated strand displacement offers a solution through its ability to destabilize and unfold the secondary structure of the target DNA/RNA.17,24 The unfolded structure is able to hybridize with the probes and enhance the hybridization kinetics.14,16,25 In addition, the toehold-mediated strand displacement was recently applied to the isothermal amplification of a target containing secondary

Figure 2. Predicted probe and hybridization complex structures. (A) The hybridization complexes of target−P1 complex, target−P1−P2 complex, and target−P1−P2−target complex. (B) The P1 and P2 probe structures were simulated by the NUPACK web-based program.

formed a highly stable hairpin structure with no hybridization between the P1 and P2 probes (Figure 2B). This result indicated that the stem structure of the designed probes was stable enough to prevent them from target-independent complex formation. The P1−P2 complex could not be formed without the target because there was no single-stranded structure to initiate strand displacement, despite the P1−P2 hybridization complex having a higher stability than the hairpin structure. HyCaSD Reaction. A 105-nt sequence from the 3′-end of DENV genomic RNA, which contained the probe binding site, was predicted to form the same secondary structure motifs as the 3′-UTR in genomic RNA by the NUPACK program (Figure S2). The 105-nt RNA was thus synthesized to use as a model target. To prove the concept, the hybridization, probe extension, and strand-displacement amplification experiments were verified. The hybridization experiments for the target and the hairpin P1 and P2 probes were completed within 30 min at 25 and 65 °C, and all of the target RNA (T band) was used (Figure 3). As predicted, three hybridization complexes were formed. The C1 band represented the interaction between one probe and one target (target−P1/P2). In addition, C2 represented the complex of both the P1 and P2 probes with one target (target−P1−P2), while C3 represented the hybridization complex of both probes and the two targets (target−P1− P2−target). The designed hairpin probes could efficiently hybridize to the target RNA secondary structure within the study’s temperature ranges. E

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 4. Verification of the HyCaSD method. (A) The DNA extension reaction by Bst 2.0 DNA polymerase on the hybridized complex with and without the 105-nt target RNA at varied temperatures (50, 55, 60, and 65 °C). (B) The HyCaSD reaction with varied concentrations of Nb.BsmI endonuclease. The results were monitored on 10% PAGE.

structure within 16S rRNA of Escherichia coli.17 Furthermore, in the present study, the hairpin probes were designed to have a relatively larger loop domain to better hybridize to the target than a typical molecular beacon probe. This strategy was based on the fact that a probe with a larger loop length tends to have lower dissociation constants and increased kinetic rate constants,26−28 which overcomes the thermodynamically unfavorable hybridization between the hairpin probe and the target with the secondary structure.29,30 Moreover, although shortening the stem is also able to facilitate the hybridization, it also greatly reduces the stability of the hairpin structure.26,27,29 Of note, optimization of the temperature that allowed the probe to retain stability of the hairpin structure and still efficiently hybridize to the target RNA was needed. A high temperature reduced the thermodynamic stability of the stem structure, resulting in a partial opening of the hairpin probe.26,31,32 The opened probes could create a false-positive result, which would reduce the sensitivity of the method. Target Selectivity and Limit of Detection (LOD) Using Viral RNA. To examine the target selectivity of HyCaSD using real viruses, the extracted RNA of all DENV serotypes, two closely related species (ZIKV and JEV), and an unrelated species also transmitted by Aedes aegypti and Aedes albopictus mosquitoes (CHIKV) was tested. The extracted total RNA from uninfected C6/36 cells was included as a negative control. As shown at Figure 5, the method could efficiently amplify the viral RNA of all the DENV serotypes and ZIKV, but not JEV, CHIKV, or the uninfected C6/36 cells. This finding could be explained by the similarity of the probe binding sites. The method could accommodate a complete match of all four DENV serotype sequences as well as a single-nucleotide deletion of ZIKV within the probe binding site (Figure S1). Taken together, the developed HyCaSD demonstrated a successful detection of all DENV serotypes based on a rare conserved sequence within 3′-UTR, even though it possessed secondary structure motifs. A satisfactory selectivity to distinguish DENV/ZIKV from JEV/CHIKV was achieved. A test that can discriminate DENV and ZIKV is of interest. However, the probe binding site in this study has a singlenucleotide deletion in ZIKV compared to DENV. In the present study, the hairpin probes have been designed to have a relatively large loop domain to better hybridize with the target

Figure 5. Selectivity of the HyCaSD method. The detection selectivity of the method with extracted RNA of DENV1−4, Zika virus (ZIKV), Japanese encephalitis virus (JEV), Chikungunya virus (CHIKV), and total extracted RNA from the culture supernatant fluid of uninfected C6/36 cells (UC) as a negative control, respectively.

containing secondary structure motifs. Better binding, due to lower dissociation constants and increased kinetic rate constants, by large loop design is balanced with reduced specificity of the loop. Therefore, it may be possible to reduce the loop size to increase the loop specificity, enabling discrimination between the two viruses. The LOD of HyCaSD was determined using the extracted RNA from DENV-2 and -4. The synthetic 105-nt target RNA was used for comparison (Figures 6, parts A and B, 7, parts A and B, and Figure S4). The developed method was able to consistently detect as low as 3.0 × 103 RNA copies/μL (5 fM) for the viral RNA target as well as the synthetic RNA target by polyacrylamide gel-based assay. In addition, a fluorescence assay, in which SYBR Gold stain was used to detect the amplified product, was performed for more quantitative analysis. An LOD was calculated by 3SD-based linear relationship plotting. The result showed LODs of 2.2 × 103 RNA copies/μL (3.6 fM) and 8.4 × 102 RNA copies/μL (1.4 fM) with R2 of 0.9766 and 0.9189 for the viral RNA target and the synthetic RNA target, respectively. The design of HyCaSD was based on strand-displacement amplification, a method which is known to have high amplification kinetics and efficiency.33−37 The HyCaSD method was designed to exponentially amplify the target RNA. It exhibited an excellent sensitivity with LOD in the femtomolar range. For comparison, other strand-displacement F

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 6. Limit of detection of the HyCaSD for detecting 105-nt synthetic target RNA was estimated with different concentrations of the synthetic target RNA, ranging from 5 × 10−16 to 5 × 10−8 M (* indicates the molar concentration for each lane, which was multiplied by 5). The results were analyzed using (A) 10% PAGE assay and (B) fluorescence assay.

Figure 7. Limit of detection of the HyCaSD for detecting extracted DENV-2 RNA was estimated with different concentrations of the extracted RNA, ranging from 3 × 102 to 3 × 1010 copies/μL (* indicates the concentration in copies/μL for each lane, which was multiplied by 3). The results were analyzed using (A) 10% PAGE assay and (B) fluorescence assay.

amplification to exponentially amplify the target RNA without a reverse transcription step. The single-stranded segment within the domain containing the secondary structure of the target RNA was able to efficiently induce the probe hybridization through toehold-mediated strand displacement. The method showed an excellent sensitivity with LOD in the femtomolar range. Discrimination between DENV/ZIKV and JEV/CHIKV was successfully demonstrated using real viruses. Taken together, the HyCaSD is a promising platform that can be further developed to determine its suitability for clinical diagnostic applications. At present, the commercial clinical diagnostic tests for DENV achieve LOD in the range of 10−25 copies per reaction.49,50 While the LOD of the HyCaSD is much higher (∼2000 copies per reaction), it is the first step in a new development.

amplification methods with hairpin probes exhibited detection limits in the picomolar (pM) to attomolar (aM) ranges.38−48 Those studies amplified the miRNA targets, of which the secondary structure of RNA was not a major obstacle. Both the amplification and detection technologies are the main contributing factors to the different detection limits of those studies. The present study showed a superior sensitivity among those, except for only one study in which the stranddisplacement amplification with a hairpin probe was combined with electrochemiluminescence detection and achieved the attomolar detection limit, 44 whereas the others used colorimetric or fluorescence detection. Therefore, a comparison of the amplification efficiency among those studies is not possible. There is only one other study that has detected the RNA target with a secondary structure. The target containing the secondary structure within the 16S rRNA of E. coli was detected, using a combination of a hybridization chain reaction (HCR) and HRP-mimicking DNAzyme, with LOD of 1 pM.17

■

ASSOCIATED CONTENT

S Supporting Information *

■

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.analchem.8b03736.

CONCLUSION An isothermal amplification method, designated HyCaSD, was successfully developed to detect target RNA with secondary structure motifs. The principle of this novel method was based on hairpin probe hybridization and strand-displacement

Multiple sequence alignment for four DENV serotypes with other species in closely related species, singlestranded segment within the probe binding site in both G

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

■

(22) Zhang, Y.; Zhang, C. Y. Anal. Chem. 2012, 84 (1), 224−31. (23) Suleman, E.; Mtshali, M. S.; Lane, E. J. Vet. Diagn. Invest. 2016, 28 (5), 536−542. (24) Chen, C.; Wang, W.; Wang, Z.; Wei, F.; Zhao, X. S. Nucleic Acids Res. 2007, 35 (9), 2875−2884. (25) Zhang, D. Y.; Winfree, E. J. Am. Chem. Soc. 2009, 131 (47), 17303−17314. (26) Tsourkas, A.; Behlke, M. A.; Rose, S. D.; Bao, G. Nucleic Acids Res. 2003, 31 (4), 1319−1330. (27) Liu, W.; Huang, S.; Liu, N.; Dong, D.; Yang, Z.; Tang, Y.; Ma, W.; He, X.; Ao, D.; Xu, Y.; Zou, D.; Huang, L. Sci. Rep. 2017, 7, 40125. (28) Vet, J. A.; Majithia, A. R.; Marras, S. A.; Tyagi, S.; Dube, S.; Poiesz, B. J.; Kramer, F. R. Proc. Natl. Acad. Sci. U. S. A. 1999, 96 (11), 6394−6399. (29) Nguyen, C.; Grimes, J.; Gerasimova, Y. V.; Kolpashchikov, D. M. Chem. - Eur. J. 2011, 17 (46), 13052−13058. (30) Gao, Y.; Wolf, L. K.; Georgiadis, R. M. Nucleic Acids Res. 2006, 34 (11), 3370−3377. (31) Ying, L.; Wallace, M. I.; Klenerman, D. Chem. Phys. Lett. 2001, 334 (1), 145−150. (32) Bonnet, G.; Tyagi, S.; Libchaber, A.; Kramer, F. R. Proc. Natl. Acad. Sci. U. S. A. 1999, 96 (11), 6171−6176. (33) Alnimr, A.; Alnemer, A. Int. J. Mycobacteriol 2012, 1 (4), 170− 176. (34) Walker, G. T.; Fraiser, M. S.; Schram, J. L.; Little, M. C.; Nadeau, J. G.; Malinowski, D. P. Nucleic Acids Res. 1992, 20 (7), 1691−1696. (35) Walker, G. T.; Nadeau, J. G.; Spears, P. A.; Schram, J. L.; Nycz, C. M.; Shank, D. D. Nucleic Acids Res. 1994, 22 (13), 2670−2677. (36) Walker, G. T.; Little, M. C.; Nadeau, J. G.; Shank, D. D. Proc. Natl. Acad. Sci. U. S. A. 1992, 89 (1), 392−396. (37) Walker, G. T. Genome Res. 1993, 3 (1), 1−6. (38) Zhu, J.; Ding, Y.; Liu, X.; Wang, L.; Jiang, W. Biosens. Bioelectron. 2014, 59, 276−281. (39) Wu, D.; Xu, H.; Shi, H.; Li, W.; Sun, M.; Wu, Z. S. Anal. Chim. Acta 2017, 957, 55−62. (40) Xu, J.; Wu, Z. S.; Shen, W.; Xu, H.; Li, H.; Jia, L. Biosens. Bioelectron. 2015, 73, 19−25. (41) Xu, H.; Wu, D.; Li, C. Q.; Lu, Z.; Liao, X. Y.; Huang, J.; Wu, Z. S. Biosens. Bioelectron. 2017, 90, 314−320. (42) Li, W.; Hou, T.; Wu, M.; Li, F. Talanta 2016, 148, 116−121. (43) Shen, Z. F.; Li, F.; Jiang, Y. F.; Chen, C.; Xu, H.; Li, C. C.; Yang, Z.; Wu, Z. S. Anal. Chem. 2018, 90 (5), 3335−3340. (44) Wang, M.; Zhou, Y.; Yin, H.; Jiang, W.; Wang, H.; Ai, S. Biosens. Bioelectron. 2018, 107, 34−39. (45) Xu, H.; Wu, D.; Jiang, Y.; Zhang, R.; Wu, Q.; Liu, Y.; Li, F.; Wu, Z. S. Talanta 2017, 164, 511−517. (46) Li, Y.; Liu, S.; Zhao, Z.; Zheng, Y.; Wang, Z. Talanta 2017, 164, 196−200. (47) Li, F.; Zhou, Y. Y.; Peng, T.; Xu, H.; Zhang, R. B.; Zhao, H.; Wang, Z. Y.; Lv, J. X.; Wu, Z. S.; Shen, Z. F. Analyst 2016, 141 (14), 4417−4423. (48) Xu, Y.; Li, D.; Cheng, W.; Hu, R.; Sang, Y.; Yin, Y.; Ding, S.; Ju, H. Anal. Chim. Acta 2016, 936, 229−235. (49) Najioullah, F.; Viron, F.; Cesaire, R. Virol. J. 2014, 11, 164. (50) Tsai, H.; Tsai, Y.; Lin, I.; Kuo, P.; Chang, K.; Chen, J.; Ko, W.; Wang, J. PLoS Neglected Trop. Dis. 2016, 10 (10), e0005036.

DENV genome conformations, optimization of the reaction time for the HyCaSD method, and LOD of the HyCaSD method for DENV-4 genomic RNA (PDF)

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

W. Saisuk: 0000-0002-6020-0018 T. Dharakul: 0000-0002-5602-0778 Author Contributions

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS W.S. was supported by a Siriraj Graduate Scholarship, Faculty of Medicine Siriraj Hospital. REFERENCES

(1) Lahoud, G.; Timoshchuk, V.; Lebedev, A.; de Vega, M.; Salas, M.; Arar, K.; Hou, Y. M.; Gamper, H. Nucleic Acids Res. 2008, 36 (10), 3409−3419. (2) Mortimer, S. A.; Kidwell, M. A.; Doudna, J. A. Nat. Rev. Genet. 2014, 15 (7), 469−479. (3) Mahen, E. M.; Watson, P. Y.; Cottrell, J. W.; Fedor, M. J. PLoS Biol. 2010, 8 (2), e1000307. (4) Tian, B.; Bevilacqua, P. C.; Diegelman-Parente, A.; Mathews, M. B. Nat. Rev. Mol. Cell Biol. 2004, 5 (12), 1013−1023. (5) Southern, E.; Mir, K.; Shchepinov, M. Nat. Genet. 1999, 21, 5−9. (6) Armitage, B. A. Drug Discovery Today 2003, 8 (5), 222−228. (7) Lane, S.; Evermann, J.; Loge, F.; Call, D. R. Biosens. Bioelectron. 2004, 20 (4), 728−735. (8) Lima, W. F.; Monia, B. P.; Ecker, D. J.; Freier, S. M. Biochemistry 1992, 31 (48), 12055−12061. (9) Liu, W. T.; Guo, H.; Wu, J. H. Appl. Environ. Microbiol. 2007, 73 (1), 73−82. (10) Dirks, R. M.; Pierce, N. A. Proc. Natl. Acad. Sci. U. S. A. 2004, 101 (43), 15275−15278. (11) Khodakov, D. A.; Khodakova, A. S.; Linacre, A.; Ellis, A. V. J. Am. Chem. Soc. 2013, 135 (15), 5612−5619. (12) Koos, B.; Cane, G.; Grannas, K.; Lof, L.; Arngarden, L.; Heldin, J.; Clausson, C. M.; Klaesson, A.; Hirvonen, M. K.; de Oliveira, F. M.; Talibov, V. O.; Pham, N. T.; Auer, M.; Danielson, U. H.; Haybaeck, J.; Kamali-Moghaddam, M.; Soderberg, O. Nat. Commun. 2015, 6, 7294. (13) Khodakov, D. A.; Khodakova, A. S.; Huang, D. M.; Linacre, A.; Ellis, A. V. Sci. Rep. 2015, 5, 8721. (14) Machinek, R. R.; Ouldridge, T. E.; Haley, N. E.; Bath, J.; Turberfield, A. J. Nat. Commun. 2014, 5, 5324. (15) Zhang, D. Y.; Chen, S. X.; Yin, P. Nat. Chem. 2012, 4 (3), 208− 214. (16) Zhang, D. Y.; Seelig, G. Nat. Chem. 2011, 3 (2), 103−113. (17) Ravan, H. Biosens. Bioelectron. 2016, 80, 67−73. (18) Zadeh, J. N.; Steenberg, C. D.; Bois, J. S.; Wolfe, B. R.; Pierce, M. B.; Khan, A. R.; Dirks, R. M.; Pierce, N. A. J. Comput. Chem. 2011, 32 (1), 170−173. (19) Iglesias, N. G.; Gamarnik, A. V. RNA Biol. 2011, 8 (2), 249− 257. (20) Gebhard, L. G.; Filomatori, C. V.; Gamarnik, A. V. Viruses 2011, 3 (9), 1739−1756. (21) Van Ness, J.; Van Ness, L. K.; Galas, D. J. Proc. Natl. Acad. Sci. U. S. A. 2003, 100 (8), 4504−4509. H

DOI: 10.1021/acs.analchem.8b03736 Anal. Chem. XXXX, XXX, XXX−XXX