1972
Langmuir 2005, 21, 1972-1978
Hybridization with Nanostructures of Single-Stranded DNA Maozi Liu and Gang-Yu Liu* Department of Chemistry, University of California, Davis, California 95616 Received September 29, 2004. In Final Form: November 18, 2004 Nanostructures of single-stranded DNA (ssDNA) were produced within alkanethiol self-assembled monolayers using nanografting, an atomic force microscopy (AFM) based lithography technique. Next, variations of the fabrication parameters, such as the concentration of ssDNA or lines per frame, allowed for the regulation of the density of ssDNA molecules within the nanostructures. The label-free hybridization of nanostructures, monitored using high-resolution AFM imaging, has proven to be highly selective and sensitive; as few as 50 molecules can be detected. The efficiency of the hybridization reaction at the nanometer scale highly depends on the ssDNA packing density within the nanostructures. This investigation provides a fundamental step toward sensitive DNA detection and construction of complex DNA architectures on surfaces.
Introduction Microarrays of single-stranded DNA (ssDNA) have been widely used to bind diverse molecules for applications, including gene mapping, DNA sequencing, and disease diagnosis.1 The element size within the DNA microarrays can be manufactured on the micrometer scale by means of micromachining and photolithography.2,3 The next generation of DNA arrays is expected to have a smaller element size, for example, reaching the nanometer scale. Compared to microarrays, nanoarrays will have a higher density of elements, will have a higher detection sensitivity, and will require a much lesser amount of samples. In addition, DNA nanoarrays should offer faster analysis time, less waste of costly reagents, and massive parallelization.4 Nanosized DNA structures are also important in the realization of DNA based molecular devices and computation.5,6 To realize the advantages and potential applications of DNA nanostructures, two critical steps must be accomplished. The first step is advanced nanofabrication capable of producing DNA nanostructures on surfaces at the desired position, while maintaining the reactivity of DNA molecules. The elegant work of using oligonucleotides to construct complex 2D or 3D DNA nanostructures in aqueous media has been pioneered by Seeman and co-workers.6,7 Many complex structures with various geometries have been designed and produced by means of DNA hybridization.8-10 Complementary to the solution phase use, we focus on the need of constructing complex 2D or 3D DNA nanostructures directly on surfaces * E-mail:
[email protected]. (1) Ramsay, G. Nat. Biotechnol. 1998, 16, 40-44. (2) Lipshutz, R. J.; Fodor, S. P. A.; Gingeras, T. R.; Lockhart, D. J. Nat. Genet. 1999, 21, 20-24. (3) De Bellis, G.; Caramenti, G.; Ilie, M.; Cianci, E.; Foglietti, V. J. Optoelectron. Adv. Mater. 2003, 5, 89-96. (4) Marshall, S. R&D (Cahners) 1999, 41, 18-27. (5) Benenson, Y.; Adar, R.; Paz-Elizur, T.; Livneh, Z.; Shapiro, E. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 2191-2196. (6) Seeman, N. C. Nature 2003, 421, 427-431. (7) Seeman, N. C. Annu. Rev. Biophys. Biomol. Struct. 1998, 27, 225248. (8) Yan, H.; Zhang, X. P.; Shen, Z. Y.; Seeman, N. C. Nature 2002, 415, 62-65. (9) Niemeyer, C. M.; Adler, M. Angew. Chem., Int. Ed. 2002, 41, 3779-3783. (10) Mao, C. D.; Sun, W. Q.; Shen, Z. Y.; Seeman, N. C. Nature 1999, 397, 144-146.
and at the desired location. Advanced techniques must be developed for immobilization of ssDNA on surfaces to form nanostructures, which should be able to hybridize. Secondly, these methods also need to detect or monitor the changes of the ssDNA nanostructures, with molecular level sensitivity and resolution. The production of DNA nanostructures on surfaces has been attempted using atomic force microscopy (AFM) based approaches, including dip pen nanolithography (DPN)11 and meniscus force nanografting.12 In our previous work,13 as well as the work of Zhou et al.,14 nanografting was utilized to produce DNA feature sizes as small as 7 nm × 12 nm. The DNA molecules within those nanostructures maintain their activity, and the hybridization selectivity toward the complementary strands is found to be high. In comparison with the existing detection techniques using labels such as radiochemical, enzymatic, fluorescent,15 chemiluminescent,16 and nanoparticle enhanced detection,17,18 label-free methods such as field effect detection,19,20 surface plasma resonance,21 the electrochemical method,22,23 QCM,24 surface stress measurements,25,26 and AFM force measurements27,28 eliminate (11) Demers, L. M.; Ginger, D. S.; Park, S.-J.; Li, Z.; Chung, S. W.; Mirkin, C. A. Science 2002, 296, 1836-1838. (12) Schwartz, P. V. Langmuir 2001, 17, 5971-5977. (13) Liu, M.; Amro, N. A.; Chow, C. S.; Liu, G.-y. Nano Lett. 2002, 2, 863-867. (14) Zhou, D.; Sinniah, K.; Abell, C.; Rayment, T. Angew. Chem., Int. Ed. 2003, 42, 4934-4937. (15) Fodor, S. P. A. Science 1997, 277, 393-395. (16) Xu, X. H.; Bard, A. J. J. Am. Chem. Soc. 1995, 117, 2627-2631. (17) Cao, Y. C.; Jin, R.; Mirkin, C. A. Science 2002, 297, 1536-1540. (18) Taton, T. A.; Mirkin, C. A.; Letsinger, R. L. Science 2000, 289, 1757-1760. (19) Souteyrand, E.; Cloarec, J. P.; Martin, J. R.; Wilson, C.; Lawrence, I.; Mikkelsen, S.; Lawrence, M. F. J. Phys. Chem. B 1997, 101, 29802985. (20) Fritz, J.; Cooper, E. B.; Gaudet, S.; Sorger, P. K.; Manalis, S. R. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 14142. (21) Heaton, R. J.; Peterson, A. W.; Georgiadis, R. M. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 3701-3704. (22) Thompson, L. A.; Kowalik, J.; Josowicz, M.; Janata, J. J. Am. Chem. Soc. 2003, 125, 324-325. (23) Boon, E. M.; Ceres, D. M.; Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2000, 18, 1096-1100. (24) Okahata, Y.; Kawase, M.; Niikura, K.; Ohtake, F.; Furusawa, H.; Ebara, Y. Anal. Chem. 1998, 70, 1288-1296. (25) Fritz, J.; Baller, M. K.; Lang, H. P.; Rothuizen, H.; Vettiger, P.; Meyer, E.; Gu¨ntherodt, H.-J.; Gerber, C.; Gimzewski, J. K. Science 2000, 288, 316-318.
10.1021/la047586d CCC: $30.25 © 2005 American Chemical Society Published on Web 01/19/2005
Hybridization with Nanostructures of ssDNA
the perturbation from these attached labels. Among all these label-free detection methods, the AFM based method offers the highest sensitivity.14 Using a modified atomic force microscope tip, AFM force measurements may be able to discriminate DNA hybridization with mismatched sequences.27,28 To go beyond the initial trials and achieve the construction of complex 2D and 3D nanoarchitectures on surfaces, both nanofabrication and hybridization steps need to be optimized. Here, we report an investigation on controlling the packing density of DNA molecules within the nanostructures, and further, the hybridization process of these nanostructures is studied as a function of the packing density of ssDNA. AFM is utilized to produce nanostructures of ssDNA with various packing densities as well as to monitor and characterize the subsequent hybridization processes. Experimental Section Matrix Preparation. Gold films on mica substrates were prepared according to a previously reported procedure.29 Gold (Alfa Aesar, 99.999%) was deposited onto freshly cleaved mica substrates (clear ruby muscovite, Mica New York Corp.) at a base pressure of ∼10-7 Torr in a high-vacuum evaporator (Denton Vacuum Inc., model DV502-A). The mica was preheated to 350 °C before deposition using two quartz lamps mounted behind the mica, to enhance the formation of terraced Au(111) domains. Typical evaporation rates were ∼3 Å/s, and the thickness of the gold films ranged from 1500 to 2000 Å. Self-assembled monolayers (SAMs) of decanethiol were prepared by immersing the freshly prepared gold films into an ethanol thiol solution (1 mM) for at least 24 h. Reagents. All DNA or oligo solutions were prepared with Millipore (Milli-Q) water. The sequences of the thiolated ssDNAs used for fabrication were 5′-HS-(CH2)6(T)15 (oligo T15) (Genomed Inc, South San Francisco, CA), 3′-HS-(CH2)6(T)25 (T25), 5′-HS(CH2)6(T)35 (T35), and 5′-HS-(CH2)6ACTGCACATGGCGTGTTGCGGTGATTCGCGTTGGT (oligo 35) (Integrated DNA Technologies, Coralville, IA). Before usage, all of the thiolated ssDNAs were treated with 0.1 M dithiothreitol (DTT) at room temperature for at least 12 h and desalted using a NAP-10 column (Amersham Bioscience, Piscataway, NJ). The ssDNA concentration was determined using the information provided by the manufacturers. PolyA, polyG (approximate molecular weight ranging from 50 000 to 100 000 Da), and other reagents were purchased from Sigma. The 100-mer oligonucleotide (oligo 100) was synthesized by Integrated DNA Technologies, Inc. The sequence is the following: ATCGGTCGTGACACTGACGCAT GACTGTTACAATCGTAATACGGCACTTGACTGTCGGATCAACTACCAACGCGAATCACCGCAACACGCCATGTGCAGT. Atomic Force Microscope. The atomic force microscope employed a home-constructed deflection type scanner controlled by commercial electronics and software (RHK Technology Inc., Troy, MI).30,31 Sharpened Si3N4 microlevers (Veeco/TM Microscopes, Sunnyvale, CA) with a spring constant of 0.1 N/m were used for AFM imaging and nanografting. The home-constructed AFM liquid cell is made of clear Plexiglas, with a capacity of 200 µL. All images were taken, in contact mode, in liquid media and at room temperature. Scan speeds were between 0.5 and 1 Hz. Hybridization. All the hybridization experiments were conducted at room temperature in 1× SSC buffer (0.015 M sodium citrate and 0.15 M NaCl, pH 7.0), and the morphology changes were monitored through in situ AFM imaging. Hybridization (26) McKendry, R.; Zhang, J.; Arntz, Y.; Strunz, T.; Hegner, M.; Lang, H. P.; Baller, M. K.; Certa, U.; Meyer, E.; Gu¨ntherodt, H.-J.; Gerber, C. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 9783-9788. (27) Mazzola, L. T.; Frank, C. W.; Fodor, S. P. A.; Mosher, C.; Lartius, R.; Henderson, E. Biophys. J. 1999, 76. (28) Wang, J.; Bard, A. J. Anal. Chem. 2001, 73, 2207-2212. (29) Hegner, M.; Wagner, P.; Semenza, G. Surf. Sci. 1993, 291, 3946. (30) Liu, G. Y.; Fenter, P.; Chidsey, C. E. D.; Ogletree, D. F.; Eisenberger, P.; Salmeron, M. J. Chem. Phys. 1994, 101, 4301-4306. (31) Kolbe, W. F.; Ogletree, D. F.; Salmeron, M. Ultramicroscopy 1992, 42, 1113-1117.
Langmuir, Vol. 21, No. 5, 2005 1973 took place immediately following DNA nanostructure fabrication within the AFM fluid cell. Before injection of the complementary ssDNA probe solution, the DNA nanostructures were washed thoroughly with ethanol, water, and 1× SSC buffer. After hybridization, all samples were washed with 1% Tween 20 and buffer solutions. Production of Nanostructures of ssDNA. The procedure for fabricating DNA nanostructures has been reported previously.13,32,33 In the first step, an alkanethiol SAM is imaged, in liquid medium containing thiolated ssDNA, using a low load on the atomic force microscope tip. Next, the matrix thiol molecules are removed by the tip, by applying a higher force during scanning. Then, the thiolated ssDNA molecules in the solution immediately adsorb onto the freshly exposed gold area following the scanning track of the atomic force microscope tip. The DNA pattern can then be characterized by the same atomic force microscope tip at a reduced imaging force. Subsequent reactions on the DNA nanostructures can be monitored through AFM imaging. The typical nanografting force is several tens of nanonewtons, depending on the tip’s spring constant and sharpness. All the nanografting was conducted in a mixed solvent of water saturated 2-butanol and ethanol (6:1). Although the nanografting of DNA is more difficult than the nanografting of SAMs, nanostructures of various thiolated DNA molecules have been consistently reproduced by our group and others.13,14 In the present study, multiple nanostructures were fabricated under each experimental condition in order to ensure the reproducibility of each run. The characterization of the produced ssDNA nanostructure was performed using a low imaging force (smaller than 0.5 nN) and a slow scan speed (0.5 Hz). The nanostructures can sustain at least 10 scans without noticeable morphological changes. To be consistent, all the height measurements for nanostructures used for packing density estimation are obtained in the mixed solvent.
Results and Discussion Control of the Packing Density of ssDNA within the Nanostructure. Investigation of DNA microstructures has proven that molecules’ packing density impacts the hybridization efficiency.34 Far fewer molecules are present in a nanostructure than in a microstructure. Therefore, we anticipate that the impact of the molecular packing density, the orientation, and their accessibility on the reactivity of the DNA nanostructures is greater. Our previous study showed that the DNA molecules within the nanostructure adopt a standing-up orientation and form a near close packed structure, when the nanografting of DNA was conducted in a DNA solution at a high concentration.13 The packing density of the ssDNA molecules within the nanostructures may be controlled by varying the fabrication conditions, such as the concentration of ssDNA, the nanografting force, and the line density of atomic force microscope tip shaving. Figure 1A shows a 120 × 200 nm2 nanostructure of oligo T15, which was nanografted into a CH3(CH2)9S/ Au(111) matrix from the ssDNA solution, with a concentration of 40 µM. The cursor profile in Figure 1D shows that the height of the T15 nanostructure is 5.0 ( 0.2 nm. ssDNA molecules within the nanostructure adopt a near fully stretched conformation and a standing-up orientation. This is determined by comparing the apparent height of the DNA structure with the theoretical length of a stretched thiolated 15-mer nucleotide (6.0 or 0.4 nm per base).13 Using a length of 0.4 nm per base and an average diameter of 1.7 nm for a stretched DNA,13,35 one can (32) Xu, S.; Liu, G.-Y. Langmuir 1997, 13, 127. (33) Xu, S.; Miller, S.; Laibinis, P. E.; Liu, G.-Y. Langmuir 1999, 15, 7244-7251. (34) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. Nucleic Acids Res. 2001, 29, 5163-5168. (35) Steel, A. B.; Levicky, R. L.; Herne, T. M.; Tarlov, M. J. Biophys. J. 2000, 79, 975-981.
1974
Langmuir, Vol. 21, No. 5, 2005
Figure 1. Nanostructures of T15 with decreasing DNA density. (A) A 120 × 200 nm2 nanostructure produced in a T15 solution with a concentration of 40 µM. The packing density is estimated as (4.2 ( 0.1) × 1013 molecules/cm2. (B) A 100 × 380 nm2 nanostructure produced in a 18 µM T15 solution. The packing density is (2.1 ( 0.1) × 1013 molecules/cm2. (C) A 100 × 200 nm2 nanostructure fabricated at a T15 concentration of 9 µM. The packing density is (0.6 ( 0.1) × 1013 molecules/cm2. Parts D, E, and F show the corresponding cursor plots as indicated in parts A, B, and C, respectively. The scale bars represent 100 nm.
calculate the volume of each ssDNA. Subsequently, the ssDNA density within the nanostructure can be estimated as (4.2 ( 0.2) × 1013 molecules/cm2. Here, we assume that the DNA molecules are tightly compacted under the atomic force microscope tip pressure. This estimated packing density agrees with the reported maximum packing density achieved by extended immersion (10-20 h) of bare gold with thiolated ssDNA.35,36 Noting that our fabrication was accomplished in
