Identification of Mouse Embryonic Stem Cell-Associated Proteins

Identification of Mouse Embryonic Stem Cell-Associated Proteins Hossein Baharvand,*,† Ali Fathi,† Hamid Gourabi,†,‡ Sepideh Mollamohammadi,† and Ghasem Hosseini Salekdeh*,§ Department of Stem Cells, Royan Institute, Tehran, Iran, Department of Genetics, Royan Institute, Tehran, Iran, and Department of Physiology and Proteomics, Agricultural Biotechnology Research Institute of Iran (ABRII), Karaj, Iran Received August 27, 2007

Over the past few years, there has been a growing interest in discovering the molecular mechanisms controlling embryonic stem cells’ (ESCs) proliferation and differentiation. Proteome analysis has proven to be an effective approach to comprehensively unravel the regulatory network of differentiation. We applied a two-dimensional electrophoresis based proteomic approach followed by mass spectrometry to analyze the proteome of two mouse ESC lines, Royan B1 and D3, at 0, 6, and 16 days after differentiation initiation. Out of 97 ESC-associated proteins commonly expressed in two ESC lines, 72 proteins were identified using MALDI TOF-TOF mass spectrometry analysis. The expression pattern of four down-regulated proteins including Hspd1, Hspa8, β-Actin, and Tpt1 were further confirmed by Western blot and immunofluorescence analyses in Royan B1 and D3 as well as two other mouse ESC lines, Royan C1 and Royan C4. Differential mRNA expression analysis of 20 genes using quantitative real-time reverse transcription PCR revealed a low correlation between mRNA and protein levels during differentiation. We also observed that the mRNA level of Tpt1 increased significantly in differentiating cells, whereas its protein level decreased. Several novel ESC-associated proteins have been presented in this study which warrants further investigation with respect to the etiology of stemness. Keywords: Proteomics • Embryonic stem cells • Differentiation • Mouse

Introduction Embryonic stem cells (ESCs) are pluripotent cells with normal karyotype that maintain their ability to self-renew and give rise to differentiated progeny representing all three embryonic germ layers. The characteristics of ESCs indicate that these cells, in addition to use in developmental biology studies, have the potential to provide an unlimited supply of different cell types for tissue replacement, drug screening, and functional genomics applications. However, signaling events that drive proliferation and specialization of ESCs are largely unknown. Detailed characterization of ESCs and their progeny is essential to control these processes in the laboratory1 before ESC-based therapies can safely be applied in the clinics. Proteome analysis has proven to be a powerful approach to elucidate mechanisms underlying ESC differentiation.2 It has been applied to study neural3,4 and spontaneous5,6 differentiation of mouse ESC (mESC) using two-dimensional electrophoresis (2-DE)5 and Fourier transform ion cyclotron resonance * To whom correspondence should be addressed. Hossein Baharvand, Department of Stem Cells, Royan Institute, P.O. Box 19395-4644, Tehran, Iran. Tel, +98-21-22172330; fax, +98-21-22414532; e-mail, Baharvand50@ yahoo.com. Ghasem Hosseini Salekdeh, Department of Physiology and Proteomics, Agricultural Biotechnology Research Institute of Iran (ABRII), P.O. Box 31535-1897, Karaj, Iran. Tel, +98-261-2702893; fax, +98-2612704539; e-mail, [email protected]. † Department of Stem Cells, Royan Institute. ‡ Department of Genetics, Royan Institute. § Agricultural Biotechnology Research Institute of Iran (ABRII).

412 Journal of Proteome Research 2008, 7, 412–423 Published on Web 11/30/2007

tandem MS (FT-ICR-MS/MS)6 in different mESCs including PKU,3 E14,4 and D3.5,6 Although these studies have generated a wealth of data, it is rather difficult to find commonly expressed mESC-associated proteins in these reports, probably due to variation in the proteomics technologies applied, differentiation methods, and cell lines and origins.2 We report here the first comparative proteomic analysis of two mESC lines, D3, a widely used cell line, as well as Royan B1. Because of this comparative analysis, we identified several new mechanisms involved in ESC proliferation and differentiation. Of 97 ESC-associated proteins commonly expressed in two lines, 72 were identified, including many novel ESC-associated proteins. The expression pattern of four down-regulated proteins were further confirmed by Western blot and immunofluorescence analyses in two other mouse ESC lines, Royan C1 and Royan C4. Quantitative real-time reverse transcription PCR revealed low correlation between mRNA and protein levels. We also observed a negative correlation between mRNA and protein level of Tpt1 which suggests a novel regulatory system in mESC differentiation.

Experimental Procedures Mouse ESC Culture and Sample Preparation. The mouse ESC lines, Royan B1, Royan C1,7 Royan C4,8 and D3 (a gift of Klaus Ingo Matthaei, JCSMR, ANU, Australia), derived from C57BL/6, BALB/c, BALB/c, and 129 mouse strains, respectively, were maintained in an undifferentiated state. Briefly, ESCs were 10.1021/pr700560t CCC: $40.75

 2008 American Chemical Society

Mouse Embryonic Stem Cell-Associated Proteins maintained on precoated gelatin (0.1%, Sigma, G2500)-plastic flasks (Falcon) containing mitomycin C (Sigma, M0503)inactivated feeder layer of primary cultures of mouse embryonic fibroblasts (MEFs) in ESC medium containing Dulbecco’s modified Eagle’s medium (DMEM, Gibco, 10829–018) supplemented with 15% ESC-qualified fetal calf serum (FCS, 10439–024; Gibco), 2 mM glutamine (25030–024; Gibco), 0.1 mM β-mercaptoethanol (M-7522; Sigma), 1% nonessential amino acid stock (11140–035; Gibco), 1% penicillin and streptomycin stock (15070–0663; Gibco) and 1000 IU/mL leukemia inhibitory factor (LIF, Chemicon, ESGRO, ESG1107). Cultures were grown in 5% CO2 at 95% humidity and were routinely passaged every 2 days. For proteome analysis, ESCs were isolated from MEFs by treatment of the cells with trypsin-ethylenediaminetetraacetic acid (EDTA) solution (GIBCO, 15305–014) and replating for 2 × 1.5 h onto precoated gelatin (0.1% w/v) plates containing ESC medium. In each case, the supernatant was collected and centrifuged (6 min, 1200 rpm). The cell pellet was washed with 10 mL of PBS and centrifuged. After discarding the PBS, the cell pellet was frozen in liquid nitrogen, and the samples were stored at -80 °C for sample preparation and proteomic analysis. To promote differentiation, ESCs were first cultured in suspension in ESC medium without LIF, where they developed into multicellular aggregates called embryoid bodies (EBs). The EBs were cultured in suspension for 6 days and then plated on gelatin-coated dishes for 10 days in the same medium to form a pool of spontaneously differentiated cells. We used the term nonlineage-differentiated cells to highlight the fact that these spontaneously differentiated cells represent a mixture of various cell types including skeletal muscle, cardiomyocytes, neuronal cells, and so forth in the outgrowths of the EBs. For proteomics analysis, we collected cells in three independent replications from ESCs and differentiate ESCs (dif-ESCs) at days 6 (d6) and 6 + 10 (d16). Karyotype Analysis. For karyotype analysis, ESCs were isolated from MEFs as described above and treated with colcemid (0.4 µg/mL, Gibco) for 40 min. After washing, the cells were exposed to 0.075 M KCl at room temperature for 20 min. The cells were then fixed with ice-cold 3:1 methanol/glacial acetic acid three times and dropped onto precleaned chilled slides. Chromosome spreads were Giemsa-banded and analyzed for chromosomal status. At least 20 metaphase spreads were screened, and five banded karyotypes were evaluated for chromosomal rearrangements. Flow Cytometric Analysis of ESCs. All staining was performed in staining buffer consisting of PBS supplemented with 1% heat-inactivated FBS, 0.1% sodium azide, and 2 mM EDTA. After determination of the viability of the cells by trypan blue exclusion, cells were washed two times in staining buffer and fixed in 2% paraformaldehyde for 15 min. For permeabilization, Triton X-100 0.5% (v/v) was used for 5 min. Nonspecific antibody binding was blocked for 15 min at 4 °C with combination of 10% heat-inactivated rat and goat serum (prepared in our laboratory) in staining buffer. For each analysis, (1–5) × 105 cells were used per sample. Cells were incubated with appropriate primary antibodies or appropriate isotype matched controls (eBioscience, or Dako Cytomation) for 45 min at 4 °C. Primary antibodies used were antistagespecific embryonic antigen-1 (SSEA-1, 1:50, Chemicon-MAB4301) and Oct-4 (1:50, R&D Systems MAB1759). The cells were washed two times in staining buffer and incubated for 30 min at 4 °C with fluorescein isothiocyanate (FITC)-conjugated goat

research articles F(ab′)2 antirat immunoglobulin (Ig) G2 (1:100, Sigma Immunochemical, F6252) and PE-conjugated rat F(ab′)2 antimouse IgM (1:100, eBioscience, 12–5790) as appropriate. Cells were washed as before and fixed with 2% paraformaldehyde. Flow cytometric analysis was performed with a BD-FACS Calibur Flow Cytometer (Becton Dickinson). The experiments were replicated at least three times. Acquired data was analyzed by using WinMDI software. Fluorescent Immunostaining. We used fluorescent immunostaining for evaluation of ESC and detection of their potency to differentiate cell lineages (ectodermal, mesodermal, and endodermal). The cells were rinsed twice with PBS-Tween 0.05% and fixed with 4% paraformaldehyde or methanol at 4 °C for 20 min or -20 °C for 5 min, respectively. The cells were permeabilized with 0.2% Triton X-100 in PBS, when required. The fixed cells were blocked for 1 h at 37 °C with 10% goat serum/PBS-Tween-20 0.05%. Cells were incubated overnight at 4 °C in a humidity chamber with respective primary antibodies anti-SSEA-1 (1:50 Chemicon, MAB4301) and Oct-4 (1:50, R&D systems, MAB1759) for undifferentiated ESC determination and antineuron-specific tubulin-III (1:250, Sigma, T8660), antitroponin I (1:250, Chemicon, MAB169), and antialbumin (1:200, R&D Systems, ALB) for detection of ectodermal (e.g., neural cells), mesodermal (e.g., muscle cells), and endodermal (e.g., liver cells) derivatives, respectively. Moreover, antiβ-Actin (1:1000, Sigma, A4700), anti-Hsp60/Hspd1 (1:200, Stressgen, SPA-807), anti-Hsc70/Hspa8 (1:200, Stressgen, SPA815), and antitumor protein, translationally controlled 1 (Hrf/ Tpt1, 1:100, MBL, M099–3) were used to confirm proteome results. At the end of the incubation, the cells were rinsed three times with PBS-Tween-20 (0.05%) and incubated with the FITCconjugated secondary antibodies, antimouse (1:250, Chemicon, AP308F) and antirat (1:300, Sigma, F1763) as appropriate for 60 min at room temperature. After a rinse with PBS, the nuclei were counterstained with propidium iodide (1µg/mL, Sigma, P4170), and then the cells were analyzed with a fluorescent microscope (Olympus, BX51, Japan). Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis. RT-PCR was also performed to assess spontaneous differentiation of ESCs into different cell lineages. After the preparation of undifferentiated colonies, several colony pieces were washed with PBS. Total RNA was collected from undifferentiated pooled pieces of each line using a Nucleospin RNA II kit (740955; Macherey-Nagel, Germany). Before reverse transcription, RNA samples were digested with DNase I (EN0521; Fermentas) to remove contaminating genomic DNA. DNaseI was dissolved in 10× reaction buffer with MgCl2, then 1 µL of DNaseI (1 u/µL) was added per 1 µg of RNA and incubated for 30 min at 37 °C. To stop DNaseI activity, 1 µL of 25 Mm EDTA was added and incubated at 65 °C for 10 min. Standard reverse-transcription reactions were performed with 2 µg of total RNA using oligo (dT)18 as primer and RevertAid H Minus First Strand cDNA Synthesis Kit (K1622; Fermentas) according to the manufacturer’s instructions. Reaction mixtures for PCR included 2.5 µL of cDNA, 1× PCR buffer (AMS, Sinagen Co., Iran), 200 µM dNTPs, 0.5 µM of each primer pair, and 1 unit Taq DNA polymerase (EP0403; Fermentas). The sequences of primers were the following: Nestin (ectodermal marker), forward, 5′-TCGAGCAGGAAGTGGTAGG-3′, and reverse, 5′-TTGGGACCAGGGACTGTTA-3′; Brachyury (mesodermal marker), forward, 5′-AGTATGAACCTCGGATTCACATCG3′, and reverse, 5′-GCAGATGAATTGTCCGCATAGG-3′; FoxA2 (HNF3β, endodermal marker), forward, 5′-GTGAGAAGCAACTGJournal of Proteome Research • Vol. 7, No. 01, 2008 413

research articles GCACTG-3′, and reverse, 5′- GGTGGTTGAAGGCGTAATGG-3′; OCT-4, forward, 5′-GGCGTTCTCTTTGGAAAGGTGTTC-3′, and reverse, 5′-CATACTCGAACCACATCCTTCTCTA-3′; β-tubulin, forward, 5′-TCACTGTGCCTGAACTTACC-3′, and reverse, 5′GGAACATAGCCGTAAACTGC-3′. Polymerase chain reactions were performed in a Mastercycler gradient machine (Eppendorf, Germany). Amplification conditions were as follows: initial denaturation at 94 °C for 5 min followed by 30 cycles (for β-tubulin, 25 cycles) of denaturation at 94 °C for 45 s, annealing for 45 s, extension at 72 °C for 30 s, and a final polymerization at 72 °C for 10 min. Products were separated on 1.5% agarose gel. The gels were stained with ethidium bromide (10 µg/mL) and photographed on a UV transiluminator (Uvidoc, U.K.). Protein Extraction. Triplicate cell line samples (at least 106 cells per replication) from two ESClines, Royan B1 and D3, and dif-ESCs (d6 and d16) were ground in liquid nitrogen and suspended in 10% (w/v) trichloroacetic acid in acetone with 0.07% (w/v) dithiothreitol (DTT) at -20 °C for 1 h, followed by centrifugation for 15 min at 35 000g. The pellets were washed with ice-cold acetone containing 0.07% DTT, incubated at -20 °C for 1 h, and centrifuged again at 4 °C. This step was repeated three times, and then the pellets were lyophilized. The sample powder was then solubilized in lysis buffer [9.5 M urea, 2% (w/ v) CHAPS, and 0.8% (w/v) Pharmalyte pH 3–10, 1% (w/v) DTT], and the protein concentration was determined by the Bradford assay (Bio-Rad) with BSA as the standard. 2-D Gel Electrophoresis. Isoelectric focusing (IEF) of approximately 120 µg (for preparative gels 1–1.5 mg) of total protein was carried out on immobilized pH gradient 24-cm pH 4–7L strips on Multiphor II (GE healthcare). The running condition was as follows: 500 V for 1 h, followed by 1000 V for 1 h, and finally 3500 V for 16 h. The focused strips were equilibrated twice for 15 min in 10 mL equilibration solution. The first equilibration was performed in a solution containing 6 M urea, 30% (w/v) glycerol, 2% (w/v) SDS, 1% (w/v) DTT, and 50 mM Tris-HCl buffer, pH 8.8. The second equilibration was performed in a solution modified by the replacement of DTT by 2.5% (w/v) iodoacetamide. Separation in the second dimension was performed by SDS-PAGE in a vertical slab of acrylamide (12% total monomer, with 2.6% cross-linker) using a Dodeca Cell (Bio-Rad). The analytical 2D gels were stained with silver nitrate as described by Blum et al. 9 with some modifications. After termination of the second dimension run, the gels were immersed in fixative solution (methanol/distilled water/acetic acid, 40/50/10). The gels were sensitized by exposure to thiosulfate reagent (0.02% sodium thiosulfate), followed by impregnation with silver nitrate reagent [0.2% silver nitrate and 0.02% formaldehyde (37%)] for 30 min and developed in developing solution [3% sodium carbonate, 0.05% formaldehyde (37%), and 0.0005% sodium thiosulfate]. The development was stopped using 5% Glycin for 5 min, and gels were rinsed with water several times prior to densitometry. Preparative gels were stained with colloidal Coomassie Brilliant Blue (CBB) G 250.10 Image Analysis. The silver-stained gels were scanned at a resolution of 600 dots per inch on a GS-800 densitometer (BioRad) and saved as TIF images for subsequent analysis. Spot quantitation was carried out using the Melanie 3 software (GeneBio, Geneva, Switzerland). The parameters for protein spot detection were as follows: number of smooths, 2; Laplacian threshold, 3; partial threshold, 3; saturation, 90; peakness increase, 100; minimum perimeter, 35. After image treatment, 414

Journal of Proteome Research • Vol. 7, No. 01, 2008

Baharvand et al. spot detection, protein quantification, and spot pairing were carried out with default settings. Then, spot pairs were investigated visually, and the scatter plots between gels of each data point were displayed to estimate gel similarity and experimental errors. The molecular masses of proteins on gels were determined by coelectrophoresis of standard protein markers (Amersham Pharmacia Biotech), and pI values of the proteins were determined by migration of the protein spots on 18 cm IPG (pH 4–7 linear) strips. Three two-dimensional gels per cell line were run, and percent volume of each spot was estimated and analyzed by one-way analyses of variance (ANOVA). Only those statistically significant spots (P e 0.01) were accepted and they had to be consistently present in all replications and show similar expression pattern in two ESC lines. Protein identification and Database Search. Protein spots were excised from CBB-stained gels and analyzed using an Applied Biosystems 4700 Proteomics Analyzer at the Protein and Proteomics Center, University of Singapore (Mass Spectrometry Services, Department of Biological Sciences). Protein digestion, desalting and concentration of samples were carried out using Montage In-Gel Digestion Kits (Millipore and Applied Biosystems, Foster City, CA). The samples were dissolved in solvent consisting of 0.1% trifluoroacetate and 50% acetonitrile (ACN) in MilliQ water. Then 0.5 µL of sample solution was mixed with 0.5 µL of matrix solution (5 mg/mL R-cyano-4hydroxycinnamic acid dissolved in the above solvent), applied to a MALDI sample target plate, and dried in air. Before each analysis, the instrument was calibrated with the Applied Biosystems 4700 Proteomics Analyzer Calibration Mixture. GPS Explorer software Version 3.5 (Applied Biosystems) was used to create and search files with the MASCOT search engine (version 2.0; Matrix Science) for peptide and protein identification. S/N ratio in MS/MS mode for peak identification was greater than 40. Combined MS-MS/MS searches were conducted with the following criteria: NCBInr database 060427 (3 525 863 sequences; 1 211 011 241 residues), all entries, parent ion mass tolerance at 50 ppm, MS/MS mass tolerance of 0.2 Da, carbamidomethylation of cysteine (fixed modification), and methionine oxidation (variable modification). The threshold for positive identification was a MOWSE score of >78 (P < 0.05). Each candidate ID derived from the above search was then manually examined in the Swiss-Prot database to eliminate redundancy of synonymous proteins. A protein’s name and accession number were reported based on SwissProt except for proteins that are only deposited in the NCBI database. The single-protein member of a multiprotein family was singled out by comparing experimental pI and MW with theoretical pI and MW of different members of the gene family, the sequenced covered by PMF and MS/MS, and ion-score of MS/MS data. RNA Extraction and Quantitative Real-Time PCR Analysis. Total RNA from four independent replicates of ESC lines, Royan B1 and D3, and dif-ESCs, d6 and d16 were extracted using Trizol reagent (Invitrogen #15596–018), and 1 µL of each RNA sample was used for constructing cDNA using a iScript cDNA Synthesis kit (Bio-Rad #170–8890). Primer pairs were designed using Beacon Designer ver.2 software. Gene expression was assayed using the iCycler iQ 4, Multicolor Real-Time PCR Detection System (Bio-Rad) and iQ SYBR Green Supermix kit (Bio-Rad #170–8884). The following PCR profile was used: 2 min at 95 °C, followed by 50 cycles of denaturation for 10 s at

research articles

Mouse Embryonic Stem Cell-Associated Proteins

Figure 1. Representative characteristics of mouse ESC (Royan B1). Phase contrast microscopy of ESC colonies with the typical morphology on mouse embryonic fibroblasts (A). Immunofluorescent staining for SSEA1 (B) and Oct-4 (C1-C3). C1, C2, and C3 represent immunofluorescent staining for Oct-4, nuclei staining, and merged C1 and C2, respectively. A karyotype analysis by G-banding (D), and flow cytometry analysis of intracellular Oct-4 and SSEA-1 (E). For a negative control, cells were incubated with an isotype control. The shaded histograms represent negative control, and open histograms represents monoclonal antibody labeled samples. Spontaneous differentiation of ESCs into different cell lineages (ectodermal, mesodermal, and endodermal) were analyzed by RT-PCR (F) and immunocytochemistry with antineuron-specific tubulin III (G), antitroponin (H), and antialbumin (I). RT- (containing no cDNA) PCR were used as a negative control. The nuclei were counterstained with propidium iodide in panels B, C2, C3, and I. Scale bar: 100 µm.

95 °C, annealing for 30 s at 55 °C, extension for 10 s at 72 °C, and a final polymerization for 5 min at 72 °C, followed by recording of a melting curve. 18S rRNA was used as the reference gene. The relative gene expression was evaluated using the comparative cycle threshold method.11 Western Blot Analysis. Fifty micrograms of protein extracted from three independent replications of ESCs and Dif-ESCs of Royan B1 and D3 was separated by 12% SDS-PAGE electrophoresis (120 V for 1 h) using a Mini-PROTEAN 3 electrophoresis cell (Bio-Rad), and proteins were transferred to nitrocellulose membrane (Bio-Rad) by semidry blotting (Bio-Rad) using Dunn carbonate transfer buffer (10 mM NaCHO3, 3 mM Na2CO3, and 20% methanol). Membranes were blocked for 1.5 h using Western blocker solution (Sigma, W0138) and incubated overnight 4 °C with respective primary monoclonal antibodies, anti-β-Actin (1:8000), anti-Hsp60 (1:4000), antiHsc70 (1:10000), and anti-Tpt1 (1:2000). At the end of the incubation time, membranes were rinsed three times (15 min each) with PBS-Tween-20 (0.05%) and incubated with the peroxidase-conjugated secondary antibodies, antimouse (1:180 000, Sigma, A9044) and antirat (1:160 000, Sigma, A5795) as appropriate for 30 min at room temperature. Finally, the blots were visualized using ECL detection reagent (Sigma, CPS1–120). Subsequently, the films were scanned with a densitometer (GS-800, Bio-Rad), and quantitative analysis was performed using UVI bandmap software (UVItec, Cambridge,

U.K.). To investigate the uniformity of proteins loaded onto gels, the membranes were stained by Fast Green (FCF, Sigma, F7252).

Results Characterization of ESC Lines. The ESCs propagated on MEF feeder layers grow as compact colonies with a high nucleus-to-cytoplasm ratio and prominent nucleoli (Figure 1A). Cells grown under these conditions retained expression of key mouse ESC markers including SSEA1 (Figure 1B) and Oct-4 (Figure 1C3). Moreover, the ESC lines had a normal karyotype (40 XY) (Figure 1D). To evaluate the percentage of undifferentiated ESCs, we analyzed the expression of SSEA-1 and Oct-4 using two-color flow cytometry (Figure 1E). Under these conditions, the cells expressed SSEA-1 (Royan B1, 97.66% ( 0.74; and D3, 98.31% ( 0.36), and Oct-4 (Royan B1, 97.30% ( 1.18; and D3, 97.21% ( 0.61). The cells were also double positive for SSEA1/Oct-4 (Royan B1, 96.07% ( 1.78; and D3, 95.7% ( 0.55). The lineage-specific differentiation potential of ESCs was evaluated with antibodies and RT-PCR of representatives of the three germ layers: ectoderm [nestin (Figure 1F) and β-tubulin III (Figure 1G)], mesoderm [Brachyury (Figure 1F) and troponin (Figure 1H)], and endoderm [FoxA2 (Figure 1F) and albumin (Figure 1I)]. These results indicate that the specific features of pluripotent ESCs were preserved in ESCs culture. Journal of Proteome Research • Vol. 7, No. 01, 2008 415

research articles

Baharvand et al.

Figure 2. 2-DE gels analysis of proteins extracted from mouse ESCs (Royan B1). The first dimension was performed using 100 µg of total soluble proteins on linear gradient IPG strips with pH 4–7. In the second dimension, 12% SDS-PAGE gels were used, and the proteins were visualized using silver nitrate. The black arrowheads represent proteins up-regulated during differentiation; the lines represent down-regulated proteins.

Figure 3. The number of protein spots reproducibly detected in Royan B1 and D3 during proliferation and differentiation. Black bars, proteins common in both lines; gray bars, proteins detected only in D3; open bars, proteins detected only in Royan B1.

Proteome Pattern. We applied a 2-DE-based proteomics approach to discover ESC-associated proteins by comparing ESCs and dif-ESCs (Figure 2). Proteins were extracted from three independent replications of ESCs and dif-ESCs (d6 and d16) of Royan B1 and D3 ESC lines. Out of 615, 694, and 672 protein spots reproducibly detected in three replications in ESC, d6, and d16, respectively, 441, 597, and 478 could be paired in two lines (Figure 3). Quantitative analysis using Melanie software revealed that 97 proteins showed similar changes in abundance in both Royan B1 and D3 lines during differentiation. Of them, 25 spots showed changes in expression only at d6 and 44 spots changed only at d16. Twenty-eight spots also showed similar changes in expression pattern at d6 and d16 compared to ESCs. These results suggest that the changes in 416


expression pattern were more pronounced in d16 compared to d6. Of 97 ESC-associated proteins, 6 proteins were detected only in ESCs, 77 spots were down-regulated, and 14 spots were up-regulated in EBs compared to ESCs. MS Analysis. For MS analysis, 97 protein spots were excised from the CBB- or silver-stained gels based on criteria described in Experimental Procedures, and the proteins therein were subsequently digested with trypsin. The protein spots were analyzed by MALDI-TOF-TOF MS/MS on the basis of a combined peptide mass fingerprinting and MS/MS analysis, leading to the identification of 72 protein spots (Table 1) belonging to several functional categories including signal transduction, transcription, cell proliferation, energy production, and cell structure. Western Blot and Immunocytochemistry Analyses. To further verify the 2-DE data, we applied Western blot and immunocytochemistry analyses to examine the expression level of four proteins, Hspa8, Hspd1, Tpt1, and β-Actin (Figure 4A). Western blots (Figure 4B and Supplementary Figure 1) and immunocytochemistry images (Figure 4C) showed that the level of all four proteins decreased during differentiation. Thus, the Western blots and immunocytochemistry images were complementary to the proteomics data, showing a decrease in expression levels of these proteins. Western blot analysis of two other mouse ESC lines, Royan C1 and Royan C4, also showed a decrease in expression pattern (Figure 4B). This indicates that similar culture and derivation procedures induce similar expression profiles. Gene Expression Analysis by Quantitative Real-Time PCR Analysis. To investigate the changes in gene expression at the mRNA level, we performed qRT-PCR of 20 differentiationassociated genes in four independent replicates. The list of genes and the sequence of forward and reverse primers are summarized in Table 2. With the exception of Stip1, SEP1, Hspd1, Hspa8, hnrnpk, PA2G4, and bola1, low correlation was observed between the changes in gene and protein expression levels during mouse ESCs differentiation (Figure 5).

-14.6* -1.72* -2.86** -3* -5* -4.57**

-4.57** -1.25 -2.09* -3.4 -2**

-4.30** -2.7* -1.96** -2.53** 0

0 -2.22* -2.36* -7.1* -6.55** -1.66

-3.6** -2.2** -1.8** -1.49* -5.55* -1.2**

-4.1** -1.6** -1.95* -2 -2

-3.6** -1.58 -1.81** -1.9** -6.43*

-4.19* -4.6** -1.69*

26 28 73 78 79 86

87 101 104 106 109

123 133 135 137 142

146 147 151

0 -2.56*

-3.18* -2.11* -2.66** -3.51* -2.96* 0 -2.60*

-1.06 -1.28

-1.03 -1.2

-2.60* -1.7* -1 -1.12 1.36 1.97 -2.18*

199 210

211 213

215 217 295 318 322 335 338

-1.87** -1.38* -1.39 -1.5** -3.64** 1.25 -5.55

-2.03** -1.37* 0 -1.26*

-1.58 -1.93*

-2.52** -1.16 -7.22** -1.88**

-1.96* -2.77* -1.44* -1.14*

172 173 191 194

-3.99* -2.38** -2.24** -1.47**

-2.39* -1.81** -1.96* -2.11** -3.43**

-6.53* -1.94** -1.41** -2.74** -1.82 Ribosomal protein, large P2 RS21-C6 protein Eukaryotic translation elongation factor 1 beta 2 Proteasome subunit, alpha type 5 Nascent polypeptide-associated complex alpha polypeptide Eukaryotic translation elongation factor 1-delta Nucleophosmin 1 Nucleophosmin 1 40S ribosomal protein SA eukaryotic translation elongation factor 1 delta isoform b Nucleophosmin 1 Protease, serine, 3 Similar to heterogeneous nuclear ribonucleoprotein A3 isoform 4 14-3-3 protein gamma 14-3-3 protein gamma Actin-like 6A ADP-sugar pyrophosphatase

Heterogeneous nuclear ribonucleoprotein K Heat shock 60 kDa protein 1 Poly(rC) binding protein 1 TAR DNA binding protein Proliferation-associated 2G4, 38 kDa Twinfilin-like protein Poly(rC) binding protein 1

0 60S acidic ribosomal protein P0 -1.87** Keratin complex 1, acidic, gene 19 -2.06* -2.42** -2.9* -1.76** -2.88** 0 -2.1

entryc

pI/MW theoe

pI/MW expf

93/30% 272/43% 230/34% 440/54% 441/40%

317/60% 284/61% 428/56% 414/51% 349/25%

235/32% 348/82% 110/11% 251/37% 242/54% 246/45%

5.04/40 4.76/41 4.72/42 4.8/46 4.97/42

4.68/20 4.67/29 4.55/34 4.55/32 4.26/39

5.5/20 5.42/17 4.68/25 4.88/13 4.3/19 4.86/22

4.91/32 5.1/17 4.45/30 5.43/30 4.96/31

4.53/12 4.83/19 4.53/25 4.74/27 4.52/24

5.95/17 4.67/10 4.76/20 5.59/14 4.76/19 4.62/21

486/58% 6.09/21 5.74/18

score/% coveraged

P61979 P63038 P60335 Q921F2 P50580 Q9Z0P5 P60335

P14869 P19001

167/34% 539/37% 90/40% 353/27% 291/42% 443/51% 379/59%

5.23/72 5.45/70 6.62/42 6.5/47 6.78/51 6.78/42 6.9/40

5.46/48 8.09/60 6.66/38 6.26/45 5.77/40 6.33/40 6.66/38

430/38% 5.74/40 5.91/34 606/61% 5.37/48 5.28/45

Q9CX34 246/42% 5.34/41 5.32/39 P16858 253/30% 5.71/39 8.44/36

P61982 465/47% 4.77/30 4.8/29 P61982 274/43% 4.73/31 4.8/29 Q9Z2N8 297/36% 5.51/56 5.39/48 Q9JKX6 80/27% 5.3/38 5.34/24

P06748 158/28% 5.02/41 4.45/30 Q5K2P8 149/35% 5.03/48 8.6/24 Q8BG05 99/42% 5.16/43 8.21/32

P57776 Q61937 Q61937 P14206 P57776

P99027 Q91VC0 O70251 Q9Z2U1 Q60817

P54227 Q5K2P8 P63028 P61971 P63028 P19105

Down-Regulated Proteins Q9JJ44

Stathmin Hypothetical protein Tumor protein, translationally controlled 1 ChainB, Nuclear Transport Factor 2 Tumor protein, transltionally controlled 1 Myosin regulatory light chain 2

Deoxyuridine triphosphatase

protein name

-2.98** Suppressor of G2 allele of SKP1 0 Glyceraldehyde-3-phosphate dehydrogenase

-1.2 -2.55** -2.71** -2.59**

0 -2.2* -4.43

-2.1** -4.58** -5.67* -2.05** 0

-3.50** -1.78** -3.22** -5.48** -3.32*

-3.18** -4.3* -3.75* -2.13 -4.1** -1.57*

-3.23*

d16/ESC

D3

-2.87** -3.53* -1.51 -1.03* -3.08** -1.92**

-1.34

-3.33*

-1.79

21

d6/ESC

d16/ESC

d6/ESC

spot no.a

Royan B1

expression levelb

14/2 14/5 11/3 9/4 15/3 13/5 18/5

11/4 26/5

10/3 13/5

12/5 14/5 16/3 5/1

8/4 4/2 9/1

6/1 9/3 8/2 15/5 13/5

4/3 11/5 11/5 12/4 5/3

7/3 9/3 3/1 5/4 8/2 13/5

9/5

PMF/ MS-MS

function

Hnrpk Hspd1 Pcbp1 Tardbp Pa2g4 Ptk9l Pcbp1

Arbp Krt1–19

Sugt1 LOC14433

ywhag Ywhag Actl6a Nudt5

Npm1 PRSS3 Hnrpa3

Eef1d Npm1 Npm1 Rpsa Eef1d

Signal transduction Signal transduction Miscellaneous Energy and metabolism signal transduction Energy and metabolism Miscellaneous Cellular organization and biogenesis transcription Protein destination Transcription Transcription Unclassified proteins Signal transduction transcription

Miscellaneous Miscellaneous Transcription

Protein synthesis Miscellaneous Miscellaneous Protein synthesis Protein synthesis

Energy and metabolism Stmn1 signal transduction 2900010J23Rik unclassified proteins Tpt1 Unclassified proteins Nutf2 Transport Tpt1 Unclassified proteins Mylc2 Cellular organization and biogenesis RPLP2 Protein synthesis Rs21c6 Unclassified proteins Eef1b2 Protein synthesis Psma5 Unclassified proteins Naca Protein destination

Dut

gene symbol

Table 1. ESC-Associated Proteins Identified Using MALDI TOF-TOF MS/MS and Their Corresponding Induction Factor (Percent Volume of Differentiated Cells/Percent Volume of ESCs)


research articles

Journal of Proteome Research • Vol. 7, No. 01, 2008 417

418


-2.67 0

-3.74**

-1.23

0 0 0 0 -1.99* -1.85*

-2.92* -5.6**

-2.3**

-2.6**

-3.60* -2.22 -6.91** -1.21 -1.7** -4.11*

2.3* 1.48 -1.26 -1.24 1.32* 1.21 1.17 1.39* -1.03 1.94** 2.18* 1.4*

4.35

0 0 0 0

0

483 487

496

509

539 601 602 610 670 702

5 38 58 220 245 260 272 274 276 332 437 442

450

16 478 705 759

779

0

0 0 0 0

5.87**

0

0 0 0 0

3.72**

8.37** 2.49* 2.04** 2.24** 2.17** 2.55** 2.45* 2.34** 3.04* 2.65* 2** 2.27**

-2.46** -1.09 -6.42** -2.45* -2.9** -4.09**

-3.5**

-2.26

-7.8** 4.25

-1.58* -1.17 -1.02* 1.09 -1.40* -1.43 -1.57** -1.57* -1.3

d6/ESC

0

0 0 0 0

5.79**

5.77** 3.04** 2.73** 3.25** 1.61** 2.95* 5.31** 1.76* 4.75* 2.39* 1.37 2.1**

0 0 0 0 -1.53** -2.98*

-3.36**

-1.4

-4.77** 3.15

-1.74* -2.05* -2.03* 0 0 0 -2.88** 0 0

d16/ESC

D3

b

Proteins Detected Only Chain A, Solution Structure Of A Bola-Like Protein Disulfide isomerase associated 3 Ribonuclease/angiogenin inhibitor 1 Similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 14-3-3 protein zeta/delta

Krt2–8 protein

439/53%

P63101

c

165/43%

at Day 0 (ESC) Q8BGS2 172/57% P27773 446/36% Q91VI7 539/76% N.A 339/41%

P11679

173/57% 355/47% 446/50% 426/52% 113/22% 212/33% 318/41% 212/20% 467/79% 141/48% 143/23% 143/42%

Up-Regulated Protein Chain A, Solution Structure Of A Bola-Like Protein Q8BGS2 Endoplasmic reticulum protein Q53YN1 Type II peroxiredoxin 1 Q5M9N9 6-phosphogluconolactonase Q9CQ60 40S ribosomal protein SA P14206 Cathepsin D P18242 Serine protease OMI Q9JIY5 Phosphoserine phosphatase protein Q99LS3 Adenine phosphoribosyltransferase (APRT) P08030 Poly(rC) binding protein 1 P60335 Enolase 1, alpha non-neuron P17182 Gamma-Actin P63260

196/45%

485/55%

472/48% 269/42%

330/45% 522/50% 516/48% 417/44% 300/38% 128/47% 316/44% 279/47% 199/40%

score/% coveraged

465/53% 152/42% 264/35% 424/54% 122/15% 729/52%

Q7ZVF9

P60710

Q5FWK2 P63260

P60122 Q6PHC1 Q60864 P46664 Q9D6R2 Q544H0 P63017 P52480 O89054

entryc

P99024 P06748 P06748 Q5D0F0 P61979 Q9R1T2

Blass I beta tubulin Nucleophosmin 1 Nucleophosmin 1 Septin 11 Heterogeneous nuclear ribonucleoprotein K Ubiquitin-like 1 (sentrin) activating enzyme sub1

Beta-Actin

Putative beta-Actin

Heterogeneous nuclear ribonucleoprotein F Actin, cytoplasmic 2

RuvB-like 1 protein Enolase 1, alpha non-neuron Stress-induced phosphoprotein 1 Adenylosuccinate synthetase, non muscle Isocitrate dehydrogenase 3 alpha Eukaryotic translation initiation factor 3, sub 4 Heat shock 70 kDa protein 8 Pyruvate kinase M2 Beta-Actin

protein name

17654

5.82/13 4.65/55 5.65/37 4.78/43

5.92/58

6.7/19 5.33/19 5.06/22 5.6/29 5.85/30 6.28/28 6.76/34 5.59/30 6.27/22 6.64/42 5.79/45 5.87/48

4.96/60 4.68/43 4.67/43 6.82/58 5.15/71 5.34/44

4.61/50

5.37/51

5.38/56 5.47/51

6.61/42 6.64/68 6.77/69 6.39/54 5.82/41 5.8/53 5.63/75 5.42/70 5.58/65

pI/MW theoe

4.77/28

6.55/13 5.88/57 4.69/51 8.15/36

5.7/55

6.55/13 5.14/19 5.2/22 5.55/28 5.24/29 6.71/45 9.6/49 5.81/25 6.31/20 6.66/38 6.37/47 5.74/42

4.86/50 4.45/30 4.45/30 6.36/49 5.69/49 5.24/39

5.16/42

5.78/40

5.31/46 5.46/39

6.02/49 6.37/47 6.4/64 5.98/51 6.47/40 5.56/9 5.42/64 7.58/60 5.78/40

pI/MW expf

d

gene symbol

Ywhaz

Bola2 Pdia3 Rnh1 RP23–227C11.3

Krt2–8

Bola2 Txndc12 Prdx2 Pgls RSSA Ctsd Htra2 Psph Aprt Pcbp1 Eno1 Actg1

tubb5 NPM1 Npm1 sept11 Hnrpk Uble1a

bactin2

Actb

Hnrpf Actg1

Ruvbl1 Eno1 Stip1 Adss Idh3a Eif3s4 Hspa8 Pkm2 Actb

function

Signal transduction

Transcription Protein destination Unclassified proteins Energy & metabolism

transcription Protein destination Diseases/defense Energy and metabolism Protein synthesis Protein destination Miscellaneous Protein destination Energy and metabolism transcription Energy and metabolism Cellular organization and biogenesis Cellular organization and biogenesis

Transcription Energy and metabolism Diseases/defense Energy and metabolism Energy and metabolism Protein synthesis Protein destination Energy and metabolism Cellular organization and biogenesis transcription Cellular organization and biogenesis Cellular organization and biogenesis Cellular organization and biogenesis Miscellaneous Miscellaneous Miscellaneous Cell growth/division transcription Miscellaneous

Mascot score and percent coverage resulted from

9/2

7/3 15/4 23/5 14/4

39/4

7/3 10/4 11/5 12/4 3/1 13/2 18/5 4/3 11/5 13/2 7/2 10/3

21/7 8/2 12/4 20/5 6/2 15/7

12/4

16/5

15/7 12/4

17/2 17/8 28/6 21/5 16/5 8/3 18/3 18/3 10/3

PMF/ MS-MS

The numbering corresponds to the 2D gel in Figure 2. d6, six days after differentiation; d16, 16 days after differentiation. Accession number in Swiss-Prot. combined MS-MS/MS search. e Theoretical pI and MW. f Experimental pI and MW.

a

-2.49** -2.63* -2.5** 0 0 0 -2.29** 0 0

-1.24 -1.46** -1.22 1.09 -1.73* -1.3 -1.26 -1.68* -1.01

343 347 348 386 445 451 460 463 477

2.59** 3.16** 2.23* 3.33** 1.2 2.24* 3.13** 1.86** 2.73** 1.19 2.54* -3.47

d16/ESC

d6/ESC

spot no.a

Royan B1

expression levelb

Table 1. (continued)

research articles Baharvand et al.


research articles

Figure 4. (A) Changes in abundance of TPT1, HSPA8, HSPD1, and β-Actin at the proteome level in mouse ESCs during differentiation. (B) Western blots of total protein extracts of Royan B1, D3, Royan C1, and Royan C4 ESC lines. Fifty micrograms of protein extracted from three independent replications of ESCs and Dif-ESCs of Royan B1 and D3 was subjected to SDS-PAGE (Supplementary Figure 1) followed by Western blotting. ESCs and Dif-ESCs were analyzed with antibodies against four proteins (TPT1, HSPA8, HSPD1, and β-Actin), which were markedly enriched in human ESCs. Solid, hatched, and clear bars represent expression levels in ESC, d6, and d16, respectively. Protein bands were quantified using UVI bandmap software. (C) Representative immunofluorecence of mouse ESCs and Dif-ESCs at day 16 (d16) for TPT1, HSPA8, HSPD1, and β-Actin proteins. The nuclei were counterstained with propidium iodide.

Discussion Over the past few years, there has been a growing interest in the molecular mechanisms involved in global differential expression of stem cell genes at different developmental stages. In the present study, we analyzed the protein expression patterns of two mouse ESCs lines during proliferation and differentiation. We detected 97 ESC-associated proteins based on three criteria: (1) they had to be consistently present in all replicates, (2) the changes in spot abundance during differentiation had to be statistically significant spots (P e 0.01), and (3) the spots should have similar expression pattern in both Royan B1 and D3 ESC lines. Therefore, the expression pattern of ESC-associated proteins presented in this study was confirmed in six gels (two cell lines and three replications) or more

(two cell lines, three replication and two stages) (Table 1). This enabled us to reproducibly and reliably identify several novel candidate mechanisms involved in ESC differentiation including down-regulation of stathmin 1, Sgt1, Pa2g4, sept11, Ruvbl1, and stip1, as well as negative correlation between Tpt1 mRNA and protein levels. Negative Correlation between Tpt1 mRNA and Protein Levels. With the use of qRT-PCR, we observed a good correlation between mRNA and protein levels of Stip1, SEP1, Hspd1, Hspa8, hnrnpk, PA2G4, and bola1 (Figure 5). A lack of relationship between mRNA and protein levels was observed for other genes. The striking result was the increase in mRNA level of Tpt1, while the protein level decreases during differentiation. Two isoforms of Tpt1 (spots 73 and 79) were down-regulated Journal of Proteome Research • Vol. 7, No. 01, 2008 419

research articles

Baharvand et al.

Table 2. The List of Primers Used for qRT-PCR spot no.

gene symbol

sense primer

antisense primer

779 16 5 451 217 109 123, 133, 146, 601, 602 78 194 343 601, 602 199 348 610 73, 79 101 670 460 26 104 Reference gene

Ywhaz Bola1 Bola2 Eif3s4 Hspd1 Naca Npm1 Nutf2 Nudt5 Ruvbl1 Gja1 sugt1 Stip1 Sep11 tpt1 rs21c6 hnrnp K Hspa8 Stmn1 Eef1b2 18srRNA

CTGTCTTGTCACCAACCATTCC CCGAGTCCTGGTGGTGTC TCCTGTCCTCTCCTTGAATCC GACTGGCGACTTTGACTC CCTTCGCCAGATGAGACC AGTTGCCACAGCCTCAGG TTAGGAGCAGGGGCAAAAGATG CCACCAGCCTACACCAGATAGC AGGTGAAGTTGCGGAATGC GGAAGGCATCAACATCAGC GGTGGTGTCCTTGGTGTCTC CAAGGTAGAAACGCTCAGG CAAGGTCGCTGCTCAGTG GAGGAGGTGAGCAACTTC AAGATGGTCAGTAGAACAGAGG CCACGCTTGAGGACATCC GCCATTATCCTCTGCTTCTCC GGCATTCGTGTGGTCTCG AACAACAACTTCAGCAAGATGG CTACGAGAAGAACGCCTTGC ATCAGATACCGTCGTAGTTCC

ACCATTTAGGGCAGGACTTCC CTCATTCACGCCGCTGTC GGCTAAGCACTCGTTCACC TGTTCCCATTGATGACTTCC AATCACAGTTCTTCCCTTTGG CCTTGCCTTCTTCTCACTTCG ACCACACTTCAACCGTAAGACC GGAGGAGGTCAGCCGAAGTTG AAGCGTCAAGTCTTGTCAGC ATCTTGGCAGAGGACTTGG GGAGCAGCCATTGAAGTAAGC TGGTCAGCTCCTCTAATGC CTGCCTCTTCCTCTTCATCC GGACACAGATGACAGAGG GCTGGTTTCTTGTAAGTGATGG TGAAGGGCTGCTCTCTCC GGCTTGCTCCTCTTCCATATC GTCCGTGAAAGCAACATAGC GTTCTTCCGCACCTCTTCC CCCACTGGAACCAATTTAGAGG TGCCCTTCCGTCAATTCC

during differentiation in both Royan B1 and D3 lines. The expression pattern in Royan B1 and D3 as well as Royan C1 and C4 was confirmed with Western blot (Figure 4). Tpt1, also known as IgE-dependent histamine-releasing factor, P23, and TCTP, is highly conserved and abundantly expressed in all eukaryotic organisms. It is implicated in cellular processes, such as cell growth and cell cycle progression, but also malignant transformation and protection of cells against various stress conditions and apoptosis (for review see ref 12). The TPT1 gene is transcribed into two mRNAs, which are generated by the use of two alternative polyadenylation signals.12 Tpt1 has been observed to associate with microtubules and the mitotic spindle in a cell cycle-dependent manner, indicating that it might be involved in processes important for cell proliferation.13 Wang

Figure 5. Comparison of 20 genes at the level of mRNA and protein in Royan B1 and D3 mouse ESC lines in proliferating ESCs and 6 (d6) and 16 days (d16) after differentiation. The expression level is expressed as average abundance of two lines in d6 and d16 divided by average abundance of two lines in ESCs. The fold changes in down-regulated proteins and mRNA have been shown as negative values. 420


and Gao4 suggested that Tpt1 plays an important role in neural differentiation of mouse ESCs possibly through modulating its binding to Ca2+, tubulin, and Na+K-ATPase. This view is in line with the observation that P23/TPT1 is preferentially expressed in proliferating, but not in terminally differentiated cells of the polyp Hydra vulgaris.14 TPT1 synthesis is regulated at both the transcriptional and the translational level.15 Because of its extended secondary structure, TPT1 mRNA is also subject to negative translational regulation through the dsRNA-activated protein kinase PKR.15 Repression of TPT1 mRNA translation imposed by PKR activation is likely to be mediated by eukaryotic initiation factor-2R (eIF2R) phosphorylation. It has been shown that the phosphorylation of eIF2R and the subsequent inhibition of protein synthesis by activated PKR facilitate the dephosphorylation and inactivation of Stat1 and Stat3.16 The higher level of TPT1 mRNA might be required to negatively regulate the activity of stat1 and stat3 via activation of eIF2R kinase PKR (Figure 6). Down-Regulation of Heat Shock/Stress-Induced Proteins. 1. Heat Shock 70-kDa Protein 8 (Hspa8). The expression level of Hspa8 (spot no. 460), also known as Hsc70, decreased more than 2-fold in Royan B1 and D3 (Table 1 and Figure 4A). For Hspa8 and Hspd1 (see below), similar expression pattern was also observed on Western blots of the four lines, Royan B1, D3, Royan C1, and Royan C4, using monoclonal antibodies (Figure 4B). With immunocytochemistry, we further confirmed the down-regulation of these two heat shock proteins in difESCs compared to ESC (Figure 4C). The down-regulation of Hspa8 has also been reported in ESC (line D3).5 Hspa8 belongs to the heat shock protein 70 family, which contains both heatinducible and constitutively expressed members. The latter are called heat-shock cognate (HSC) proteins. Hspa8 is a heatshock cognate protein that binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Son et al.17 showed that the Hspa8 protein was expressed on the surface of human ESCs and the expression of the Hspa8 protein was markedly down-regulated upon differentiation in


Figure 6. A proposed model for the induction of Stat3 dephosphorylation by Tpt1 and PA2G4. Activation of PKR by upregulation of TPT1 mRNA and down-regulation of PA2G4 proteins leads to dephosphorylation of Stat3 or Stat1. The phosphorylation of eIF2R and the subsequent inhibition of protein synthesis by activated PKR facilitate the dephosphorylation of Stat3 possibly by blocking the expression of a protein that negatively regulates the tyrosine phosphatase.16

culture. They suggested that the Hspa8 protein was a novel cellsurface marker for undifferentiated human ESCs. Several reports have demonstrated that Hspa8 does occur on the surface of a number of cell types.18–20 The biological role of Hspa8 on the surface of human ESCs is currently unknown. However, it has been speculated that the role of Hspa8 on the surface of human ESCs might be associated with immune responses under certain circumstances.17 2. Heat Shock 60 kDa Protein 1 (Hspd1). Spot no. 217 was identified as heat shock 60 kDa protein 1, also know as chaperonin, GROEL, and Hsp60. With the use of 2-DE, we detected the down-regulation of proteins in both Royan B1 and D3 (Table 1 and Figure 4A). This expression pattern was further confirmed by Western blot analysis (Figure 4B) and immunocytochemistry (Figure 4C). The down-regulation of Hspd1 during mouse ESC differentiation has been already reported.4,5 Van Hoof et al. 6 found that Hspd1 is enriched in ESCs compared with differentiated ESCs according to the peptide ratios determined by FT-ICR-MS/MS. This protein is one of the most important components of the protein-folding system within the mitochondrial matrix. The extramitochondrial localization of Hspd1 in a variety of mammalian cells and tissues was also confirmed by electron microscopy.21,22 A comparative proteome analysis of cell surface proteins revealed that Hspd1 is highly abundant on the surface of cancer cells when matched against normal cells.18 More recently, mass spectrometric analysis of biotinylated cell surface proteins of mouse ESCs (line D3) also showed that Hspd1 is highly abundant on the plasma membrane.23 Although the biological role of Hspd1 in mouse ESC differentiation is not yet known, it can be used as a marker for undifferentiated hESCs.

research articles 3. Stress-Inducible Phosphoprotein (STIP1). Another downregulated protein (spot no. 348) was identified as stressinducible phosphoprotein (STIP1). This protein was first described in Saccharomyces cerevisiae, where it was implicated in mediating the heat shock response of some HSP 70 genes.24 Murine STIP1 is a cochaperone that is homologous to the human heat shock cognate protein 70 (hsc70)/heat shock protein 90 (hsp90)-organizing protein (Hop).25 Hop is an indispensable component of a dynamic heterocomplex chaperoning machine that is involved in the functional maturation of a number of unrelated protein–substrates.26 STIP1 was shown to be up-regulated approximately 2-fold following viral transformation.27 Although the exact function of STIP1 is still unknown, the protein has been proposed to play an important role in cell proliferation and gene regulation.27 Down-Regulation of Proteins Involved in Cell Proliferation. 1. Stathmin 1. One of the proteins rigorously down-regulated during differentiation was identified as stathmin 1. At d6, the expression level of this protein decreased up to 3.6- and 2.9fold in Royan B1 and D3, respectively. At d16, the expression level further declined up to 14.6- and 3.2-fold in Royan B1 and D3, respectively. Stathmin 1 belongs to the stathmin family and is a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. Its expression is regulated in relation with cell proliferation and differentiation and has been suggested as a marker of the multipotential cells of the early mouse embryo.28 It has been proposed that stathmin is necessary for cell proliferation in most cell lineages.29 In bone marrowderived mesenchymal stem cells (MSCs), the expression level of stathmin decreased after 5-aza treatment.30 It is possible that the expression level and phosphorylation status of stathmin regulate cell division by increasing the instability of interphase microtubules, leading to their depolymerization at the onset of mitosis followed by repolymerization of microtubules to form the mitotic spindle.31,32 The function of stathmin 1 during ESCs differentiation needs to be investigated in further research. 2. Suppressor of G2 Allele of SKP1 (SGT1). Spot no. 199 was down-regulated up to 2- and 3-fold in Royan B1 and D3, respectively, at d16. The protein spot was identified as suppressor of G2 allele of skp1 (SGT1), also known as SUGT. This protein is homologous to the yeast gene SGT1, which encodes a protein involved in kinetochore function and is required for cell cycle progression at both the G1/S and G2/M transitions.33 Human Sgt1 can perform the essential functions of SGT1 in budding yeast, indicating that Sgt1 function is conserved throughout eukaryotes.33 3. Proliferation-Associated 2G4 (PA2G4). PA2G4 also known as ErbB3-binding protein Ebp1 is a highly conserved proteins from yeast to human. One of the interesting characteristics of this protein is that it appears in the nuclei from late G1 to early S phase and diminishes at late G2 during cell cycle. Therefore, PA2G4 is thought to play an important role in DNA replication or cell cycle progression.34 It has been shown that PA2G4 binds PKR and inhibits its dsRNA-induced kinase activity on eIF2a, in vivo. Wang et al.16 showed that the phosphorylation of eIF2R and the subsequent inhibition of protein synthesis by activated PKR facilitate the dephosphorylation and inactivation of Stat1 and Stat3. The lower level of PA2G4 during diffrentiation might be required to negatively regulate the activity of stat1 and stat3 via activation of eIF2R kinase PKR. Journal of Proteome Research • Vol. 7, No. 01, 2008 421

research articles 4. Nucleophosmin (Npm1). Five of the down-regulated protein spots (spots nos. 133, 135, 146, 601, and 602) were identified as Nucleophosmin (Npm1). Npm1 was first identified as a phosphoprotein that was highly expressed in the nucleolus.35 The human NPM1 gene can be transcribed as three variants. NPM has proven to be a multifunctional protein that is involved in many cellular activities, and has been related to both proliferative and growth-suppressive roles in the cell. It is more abundant in proliferating cells than in normal resting cells,36 and is highly expressed in undifferentiated ESCs.37 Wang et al.38 demonstrated that Npm1 is an essential gene for ESC proliferation. Witht he use of a (Tc)-inducible small interference RNA, they showed that the suppression of Npm1 expression in ESCs resulted in reduced cell proliferation. Expression Pattern of Proteins Involved in Transcription. We have identified several genes involved in transcription that are preferentially expressed in undifferentiated cells and may play a key role in ESC proliferation. Most of proteins involved in transcription showed to be down-regulated during differentiation including TAR DNA binding protein (spot no. 318), 49-kDa TATA box-binding protein-interacting protein (spot no. 343), Hnrpa3 (spot no. 151), Hnrnpk (spot nos. 215 and 670), and Hnrpf (spot no. 483). The down-regulation of Hnrpf and Hnrnpk during differentiation of stem cells has already been reported.5,39 Further studies are needed to elucidate the detailed and specific roles of these differentially expressed proteins in ESC differentiation. Proteins Associated with Energy Production and Metabolism. The differentiation of ESC is accompanied by the reduction in expression of proteins associated with energy production and metabolisms, indicating active metabolisms in ESCs. These proteins include deoxyuridine triphosphatase (spot no. 21), ADP-sugar pyrophosphatase (spot no. 194), glyceraldehyde3-phosphate dehydrogenase (spot no. 210), enolase 1 (spot no. 347), adenylosuccinate synthetase (spot no. 386), isocitrate dehydrogenase 3 alpha (spot no. 445), and pyruvate kinase M2 (spot no. 463). All of these proteins were highly down-regulated after 16 days of differentiation compared to 6 days. Other proteins including 6-phosphogluconolactonase (spot no. 220), purine nucleoside phosphorylase (spot no. 247), adenine phosphoribosyltransferase (spot no. 276), and enolase 1 (spot no. 437) were up-regulated.

Concluding Remarks The present findings add insight to our understanding of the mechanisms involved in mouse ESC proliferation and differentiation. The results provide evidence that differentiation causes a redirection in protein synthesis, interestingly, to a greater extent in down-regulation of proteins. As a result of comparative analysis of two genotypes, several proteins emerged as key participants in ESC differentiation. Possible candidates include Hspa8, Hspd1, Tpt1, Sugt1, Stip1, Npm1, Sep11, Pa2g4, and Tardbp. The Tpt1 mRNA and protein levels behaved in an opposing manner (i.e., down-regulated at protein level and upregulated at mRNA level). The higher level of Tpt1 mRNA level might be required to negatively regulate the activity of stat1 and stat3 via activation of eukaryotic initiation factor-2R kinase PKR. The present study offers opportunities to pursue further investigation with respect to the etiology of stemness. Abbreviations: ESCs, embryonic stem cells; qRT-PCR, quantitative real time-PCR; EBs, embryoid bodies; dif-ESCs, differentiated ESCs. 422


Baharvand et al.

Acknowledgment. We thank Mohammad Pakzad, Shabnam Zarei Moradi, and Elaheh Afzal for their technical assistance. We are grateful to Mohammad Ghareyazie and Taha Abachi for their assistance in creating the database. This project was funded by grants from Royan Institute. Supporting Information Available: Figure of SDSPAge of mouse ESCs and Dif-ESCs. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Andrews, P. W.; Benvenisty, N.; McKay, R.; Pera, M. F.; Rossant, J.; Semb, H.; Stacey, G. N. The International Stem Cell Initiative: toward benchmarks for human embryonic stem cell research. Nat. Biotechnol. 2005, 23 (7), 795–779. (2) Baharvand, H.; Fathi, A.; Van Hoof, D.; Salekdeh, G. H. Trends in stem cells proteomics. Stem Cells 2007, 25 (8), 1888–1903. (3) Guo, X.; Ying, W.; Wan, J.; Hu, Z.; Qian, X.; Zhang, H.; He, F. Proteomic characterization of early-stage differentiation of mouse embryonic stem cells into neural cells induced by all-trans retinoic acid in vitro. Electrophoresis 2001, 22 (14), 3067–3075. (4) Wang, D.; Gao, L. Proteomic analysis of neural differentiation of mouse embryonic stem cells. Proteomics 2005, 5 (17), 4414–4426. (5) Kurisaki, A.; Hamazaki, T. S.; Okabayashi, K.; Iida, T.; Nishine, T.; Chonan, R.; Kido, H.; Tsunasawa, S.; Nishimura, O.; Asashima, M.; Sugino, H. Chromatin-related proteins in pluripotent mouse embryonic stem cells are downregulated after removal of leukemia inhibitory factor. Biochem. Biophys. Res. Commun. 2005, 335 (3), 667–675. (6) Van Hoof, D.; Passier, R.; Ward-Van Oostwaard, D.; Pinkse, M. W.; Heck, A. J.; Mummery, C. L.; Krijgsveld, J. A quest for human and mouse embryonic stem cell-specific proteins. Mol. Cell. Proteomics 2006, 5 (7), 1261–1273. (7) Baharvand, H.; Matthaei, K. I. Culture condition difference for establishment of new embryonic stem cell linesfrom the C57BL/6 and BALB/c mouse strains. In Vitro Cell. Dev. Biol.: Anim. 2004, 40 (3), 76–81. (8) Baharvand, H.; Taee, A.; Massumi, M.; Jafari, H.; Mollamohammadi, S.; Hatami, M.; Zarei Moradi, S. h. Effect of mouse strain on establishment of embryonic stem cell lines. Iran. J. Anat. Sci. 2004, 2, 21–31. (9) Blum, H.; Beier, H.; Gross, H. J. Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 1987, 8, 93–99. (10) Neuhoff, V.; Arold, N.; Taube, D.; Ehrhardt, W. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 1988, 9 (6), 255–262. (11) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods 2001, 25, 402–408. (12) Bommer, U. A.; Thiele, B. J. The translationally controlled tumour protein (TCTP). Int. J. Biochem. Cell Biol. 2004, 36 (3), 379–385. (13) Gachet, Y.; Tournier, S.; Millar, J. B.; Hyams, J. S. A MAP kinasedependent Actin checkpoint ensures proper spindle orientation in fission yeast. Nature 2001, 412 (6844), 352–355. (14) Yan, L.; Fei, K.; Bridge, D.; Sarras, M. P., Jr. A cnidarian homologue of translationally controlled tumor protein (P23/TCTP). Dev. Genes Evol. 2000, 210 (10), 507–11. (15) Bommer, U. A.; Borovjagin, A. V.; Greagg, M. A.; Jeffrey, I. W.; Russell, P.; Laing, K. G.; Lee, M.; Clemens, M. J. The mRNA of the translationally controlled tumor protein P23/TCTP is a highly structured RNA, which activates the dsRNA-dependent protein kinase PKR. RNA 2002, 8 (4), 478–496. (16) Wang, S.; Raven, J. F.; Baltzis, D.; Kazemi, S.; Brunet, D. V.; Hatzoglou, M.; Tremblay, M. L.; Koromilas, A. E. The catalytic activity of the eukaryotic initiation factor-2alpha kinase PKR is required to negatively regulate Stat1 and Stat3 via activation of the T-cell protein-tyrosine phosphatase. J. Biol. Chem. 2006, 281 (14), 9439–9449. (17) Son, Y. S.; Park, J. H.; Kang, Y. K.; Park, J. S.; Choi, H. S.; Lim, J. Y.; Lee, J. E.; Lee, J. B.; Ko, M. S.; Kim, Y. S.; Ko, J. H.; Yoon, H. S.; Lee, K. W.; Seong, R. H.; Moon, S. Y.; Ryu, C. J.; Hong, H. J. Heat shock 70-kDa protein 8 isoform 1 is expressed on the surface of human embryonic stem cells and downregulated upon differentiation. Stem Cells 2005, 23 (10), 1502–1513.

research articles

Mouse Embryonic Stem Cell-Associated Proteins (18) Shin, B. K.; Wang, H.; Yim, A. M.; Le Naour, F.; Brichory, F.; Jang, J. H.; Zhao, R.; Puravs, E.; Tra, J.; Michael, C. W.; Misek, D. E.; Hanash, S. M. Global profiling of the cell surface proteome of cancer cells uncovers an abundance of proteins with chaperone function. J. Biol. Chem. 2003, 278 (9), 7607–7616. (19) Sapozhnikov, A. M.; Gusarova, G. A.; Ponomarev, E. D.; Telford, W. G. Translocation of cytoplasmic HSP70 onto the surface of EL-4 cells during apoptosis. Cell Proliferation 2002, 35 (4), 193–206. (20) Poccia, F.; Piselli, P.; Vendetti, S.; Bach, S.; Amendola, A.; Placido, R.; Colizzi, V. Heat-shock protein expression on the membrane of T cells undergoing apoptosis. Immunology 1996, 88 (1), 6–12. (21) Soltys, B. J.; Gupta, R. S. Cell surface localization of the 60 kDa heat shock chaperonin protein (hsp60) in mammalian cells. Cell Biol. Int. 1997, 21 (5), 315–320. (22) Soltys, B. J.; Gupta, R. S. Mitochondrial-matrix proteins at unexpected locations: are they exported. Trends Biochem. Sci. 1999, 24 (5), 174–177. (23) Nunomura, K.; Nagano, K.; Itagaki, C.; Taoka, M.; Okamura, N.; Yamauchi, Y.; Sugano, S.; Takahashi, N.; Izumi, T.; Isobe, T. Cell surface labeling and mass spectrometry reveal diversity of cell surface markers and signaling molecules expressed in undifferentiated mouse embryonic stem cells. Mol. Cell. Proteomics 2005, 4 (12), 1968–1976. (24) Nicolet, C. M.; Craig, E. A. Isolation and characterization of STI1, a stress-inducible gene from Saccharomyces cerevisiae. Mol. Cell. Biol. 1989, 9 (9), 3638–3646. (25) Blatch, G. L.; Lassle, M.; Zetter, B. R.; Kundra, V. Isolation of a mouse cDNA encoding mSTI1, a stress-inducible protein containing the TPR motif. Gene 1997, 194 (2), 277–282. (26) Smith, D. F.; Sullivan, W. P.; Marion, T. N.; Zaitsu, K.; Madden, B.; McCormick, D. J.; Toft, D. O. Identification of a 60-kilodalton stress-related protein, p60, which interacts with hsp90 and hsp70. Mol. Cell. Biol. 1993, 13 (2), 869–876. (27) Honore, B.; Leffers, H.; Madsen, P.; Rasmussen, H. H.; Vandekerckhove, J.; Celis, J. E. Molecular cloning and expression of a transformation-sensitive human protein containing the TPR motif and sharing identity to the stress-inducible yeast protein STI1. J. Biol. Chem. 1992, 267 (12), 8485–8491. (28) Doye, V.; Kellermann, O.; Buc-Caron, M. H.; Sobel, A. High expression of stathmin in multipotential teratocarcinoma and normal embryonic cells versus their early differentiated derivatives. Differentiation 1992, 50 (2), 89–96. (29) Rowlands, D. C.; Harrison, R. F.; Jones, N. A.; Williams, A.; Hubscher, S. G.; Brown, G. Stathmin is expressed by the proliferat-

(30)

(31)

(32)

(33)

(34)

(35)

(36)

(37)

(38)

(39)

ing hepatocytes during liver regeneration. Clin. Mol. Pathol. 1995, 48 (2), M88–M92. Ye, N. S.; Chen, J.; Luo, G. A.; Zhang, R. L.; Zhao, Y. F.; Wang, Y. M. Proteomic profiling of rat bone marrow mesenchymal stem cells induced by 5-azacytidine. Stem Cells Dev. 2006, 15 (5), 665–676. Holmfeldt, P.; Larsson, N.; Segerman, B.; Howell, B.; Morabito, J.; Cassimeris, L.; Gullberg, M. The catastrophe-promoting activity of ectopic Op18/stathmin is required for disruption of mitotic spindles but not interphase microtubules. Mol. Biol. Cell 2001, 12 (1), 73–83. Iancu, C.; Mistry, S. J.; Arkin, S.; Wallenstein, S.; Atweh, G. F. Effects of stathmin inhibition on the mitotic spindle. J. Cell. Sci. 2001, 114 (Pt 5), 909–916. Kitagawa, K.; Skowyra, D.; Elledge, S. J.; Harper, J. W.; Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol. Cell 1999, 4 (1), 21–33. Squatrito, M.; Mancino, M.; Sala, L.; Draetta, G. F. Ebp1 is a dsRNAbinding protein associated with ribosomes that modulates eIF2alpha phosphorylation. Biochem. Biophys. Res. Commun. 2006, 344 (3), 859–868. Kang, Y. J.; Olson, M. O.; Busch, H. Phosphorylation of acid-soluble proteins in isolated nucleoli of Novikoff hepatoma ascites cells. Effects of divalent cations. J. Biol. Chem. 1974, 249 (17), 5580– 5585. Chan, W. Y.; Liu, Q. R.; Borjigin, J.; Busch, H.; Rennert, O. M.; Tease, L. A.; Chan, P. K. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth. Biochemistry 1989, 28 (3), 1033–1039. Baharvand, H.; Hajheidari, M; Kazemi Ashtiani, S; Salekdeh, G. H. Proteomic signature of human embryonic stem cells. Proteomics 2006, 6 (12), 3544–3549. Wang, B. B.; Lu, R.; Wang, W. C.; Jin, Y. Inducible and reversible suppression of Npm1 gene expression using stably integrated small interfering RNA vector in mouse embryonic stem cells. Biochem. Biophys. Res. Commun. 2006, 347 (4), 1129–1137. Hoffrogge, R.; Mikkat, S.; Scharf, C.; Beyer, S.; Christoph, H.; Pahnke, J.; Mix, E.; Berth, M.; Uhrmacher, A.; Zubrzycki, I. Z.; Miljan, E.; Volker, U.; Rolfs, A. 2-DE proteome analysis of a proliferating and differentiating human neuronal stem cell line (ReNcell VM). Proteomics 2006, 6 (6), 1833–1847.

PR700560T

Journal of Proteome Research • Vol. 7, No. 01, 2008 423

Identification of Mouse Embryonic Stem Cell-Associated Proteins

Recommend Documents