Identification of Platinum-Resistance Associated Proteins through

Dec 19, 2006 - Synopsis. The platinum-resistance associated proteins were identified using 2-DE and MALDI-TOF MS between two sensitive and four resist...
1 downloads 0 Views 548KB Size
Download PDF
Identification of Platinum-Resistance Associated Proteins through Proteomic Analysis of Human Ovarian Cancer Cells and Their Platinum-Resistant Sublines Xue-dong Yan Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, P. R. China

Ling-ya Pan* Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, P. R. China

Ye Yuan Department of Cell Biology, Institute of Basic Medical Sciences, Beijing 100850, P. R. China

Jing-he Lang Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, P. R. China

Ning Mao Department of Cell Biology, Institute of Basic Medical Sciences, Beijing 100850, P. R. China Received August 8, 2006

Chemoresistance is a major therapeutic obstacle in cancer patients, and the mechanisms of drug resistance are not fully understood. In the present study, we established platinum-resistant human ovarian cancer cell lines and identified differentially expressed proteins related to platinum resistance. The total proteins of two sensitive (SKOV3 and A2780) and four resistant (SKOV3/CDDP, SKOV3/CBP, A2780/CDDP, and A2780/CBP) human ovarian cancer cell lines were isolated by two-dimensional gel electrophoresis (2-DE). The differentially expressed proteins were identified using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS). In total, 57 differential protein spots were identified, and five proteins, including annexin A3, destrin, cofilin 1, Glutathione-S-transferase omega 1 (GSTO1-1), and cytosolic NADP+-dependent isocitrate dehydrogenase (IDHc), were found to be coinstantaneous significance compared with their parental cells. The expression of the five proteins was validated by quantitative PCR and western blot, and the western blot results showed complete consistency with proteomic techniques. The five proteins are hopeful to become candidates for platinum resistance. These may be useful for further study of resistance mechanisms and screening of resistant biomarkers. Keywords: drug resistance • ovarian cancer • platinum • proteomics • two-dimensional gel electrophoresis • matrixassisted laser desorption ionization-time-of-flight mass spectrometry

Introduction Ovarian cancer is the leading cause of gynecological cancer mortality. The optimal cytoreductive surgery followed by a first* To whom correspondence should be addressed. Professor Ling-ya Pan, Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College (CAMS & PUMC), 1 Shuai Fu Yuan, Beijing 100730, P.R. China. E-mail: [email protected]; Telephone: 86-10-65296203; Fax: 86-1065124875.

772

Journal of Proteome Research 2007, 6, 772-780

Published on Web 12/19/2006

line platinum-based chemotherapy is an effective strategy, however, the 5-year survival rate for stage III and IV disease is about 20%-30%.1 One of the major reasons is that cancer cells are resistant to anti-tumor drugs. Prompt adjustment of the chemotherapy regimen based on the early detection of tumor resistance to the drugs may further improve the disease outcome. A number of genes, such as GST-pi, LRP, MDR1, XIAP, HER2/neu, hMLH2, and hMSH1,2-6 have been reported to be 10.1021/pr060402r CCC: $37.00

 2007 American Chemical Society

research articles

Platinum-Resistant Human Ovarian Cancer Cells

associated with platinum resistance in ovarian cancer, whereas no single gene will be used as the biomarker for detecting tumor resistance to chemotherapy. Because the expression of the gene may be inconsistent to protein due to modification during a post-translational process, it is very necessary to perform high-throughput studies at protein level for which proteomic techniques rightly answer. However, so far, seldom proteomic studies were performed in drug resistance and further screening resistant biomarkers of ovarian cancer. In this study, platinum-resistance associated proteins were observed for the first time by comparing cell lines of multiple resistant cells and their parental cells, using proteomics-based approaches. To screen differentially expressed proteins, two human ovarian cancer cell lines and their subclones in respective of cisplatin-resistance and carboplatin-resistance were analyzed by two-dimensional gel electrophoresis (2-DE) and matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS). Five proteins were found to express differentially in at least three resistant lines. The five proteins may be involved in the mechanisms of platinum resistance for ovarian cancer.

Materials and Methods Materials. Cisplatin was purchased from Mayne Pharma Pty Ltd (Melbourne, Victoria, Australia). 3-(4,5-Dimethylthiazol-2yl)-2,5-dipherytetradium bromide was obtained from Sigma (St. Louis, MO). Protease inhibitor cocktail was provided by Roche (Mannheim, Germany). DyNAmo PCR Master Mix was purchased from Finnzymes (Espoo, Finland). The rabbit antihuman destrin antibody was obtained from Abcam (Cambridge, UK). The rabbit anti-human cofilin1 antibody was obtained from Cytoskeleton (Denver, CO). The mouse antihuman GSTO1-1 antibody was purchased from Abnova (Taiwan, China). The mouse anti-actin antibody was produced by Chemicon (Bedford, MA). Cell Lines and Culture Conditions. SKOV3 is a human epithelial ovarian cancer cell line obtained from Cell Culture Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. The SKOV3/CDDP was generated by selecting SKOV3 cells for growth with cisplatin at 100 µM pulse for 16 months in our laboratory. Human epithelial ovarian cancer cell lines A2780, A2780/CDDP, A2780/CBP and SKOV3/ CBP were kindly supplied by Dr. Li Li,7 Department of Gynecologic Oncology, Medical University of Guangxi Cancer Institute and Hospital. All cell lines were maintained in DMEM containing 10% fetal calf serum. Cells were kept at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. These cell lines grew in a monolayer and were passaged when cultures were 70-80% confluent. Drug Sensitivity Assay. Cells were harvested from exponential phase cultures. Single-cell suspensions were prepared and dispersed in 96-well plates. Six duplicate wells were used for each determination. After incubation for 72 h with drugs, 3-(4,5dimethylthiazol-2-yl)-2,5-dipherytetradium bromide solution (0.5 g/L) was added to each well and the plates were incubated at 37 °C for 4 h. Following incubation, 100 µL of extraction buffer (20% SDS/50% N,N-dimethylformamide, pH 4.7) was added to each well, incubated overnight, and then absorbance at 540 nm on each well were measured using Immunoskan 340 (Labsystems, Vantaa, Finland). 2-DE. Cell samples were lysed in solubilization buffer (100 µL per 107 cells) containing 40 mM Tris, 7 M urea, 2 M thiourea, 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfo-

Table 1. DNA Sequence of the Forward and Reverse Primers, Length of Products, and Annealing Temperature for Quantitative PCR primer designation

sequence

annexin A3 TGAAGGGTATTGGAACTGATG TGAGAAGAAGTAAGGTGGAGC destrin GTAAATGCTCCACACCAGAAG GCATCATACAAAGCATAGCGA cofilin 1 TATGAGACCAAGGAGAGCAAG CTTGACCTCCTCGTAGCAGTT GSTO1-1 AAGCATACCCAGGGAAGAAGC TGCCATCCACAGTTTCAGTTT IDHc AGAGCAAAGCTTGATAACAAT GAAAAATGTAAACCTGTAGAC beta-actin AAACTACCTTCAACTCCATCA AACTAAGTCATAGTCCGCCTA

product annealing length temperature (bp) (°C)

254

52

199

52

148

52

334

52

284

52

319

52

nate (CHAPS), 65 mM dithiothereitol (DTT), 1 mM ethylenediamine-tetra-acetic acid, 1 × protease inhibitor cocktail, 0.1 g/L RNase A, and 0.1 g/L DNase I with sonication (5 s/cycle, 5 cycle; 0 °C). After centrifugation at 13 000 × g for 30 min at 4 °C, the supernatant was collected as the protein sample. Protein concentration was determined by the Bradford protocol using Bradford protein assay kit. The protein samples were stored at -80 °C in aliquots until use. 2-DE was performed as described.8 Proteins (1.2 mg) were diluted to 350 µL with rehydration solution (8 M urea, 4% CHAPS, 20 mM DTT, 0.5% immobilized pH gradient buffer, trace of bromphenol blue) and loaded into 18 cm (pH 3-10) nonlinear immobilized pH gradient DryStrip (Amersham Biosciences, Little Chalfont, UK). The IPGphor system (Amersham Biosciences) was used for the first dimension isoelectric focusing, for a total running time of 80 000 Vh. Prior to the second dimension separation, the strip was equilibrated for 15 min with equilibration solution containing 50 mM Tris-HCl (pH 8.8), 6 M urea, 30% w/v glycerol, 2% w/v SDS, 0.3% DTT, and trace of bromphenol blue. A second equilibration step was also carried out for 15 min in the same solution except for DTT, which was replaced by 1.85% iodoacetamide. Separation in the second dimensional electrophoresis was carried out in the PROTEAN II xi Cell (Bio-Rad, Hercules, CA) with a 13% SDSpolyacrylamide gel at a constant current of 20 mA/gel for the initial 40 min and 30 mA/gel thereafter until the bromphenol blue dye marker reached the bottom of the gel. The samples from the same cell line were run for at least three times to determine the variability. 2-DE Image Analysis. Protein patterns were visualized directly by Coomassie Brilliant Blue R-350 staining. The twodimensional electrophoresis patterns were captured with the ImageScanner (Amersham Biosciences). Spot detection, quantification, and matching analysis were performed with the ImageMaster 2D Platinum 5.0 software (Amersham Biosciences). Spot intensity was expressed as percentage of the spot volume in the total sum of all spot volumes on the gel. Image analysis was performed by comparing the quantity of matched spots between resistant sublines and the corresponding parental (sensitive) cell lines. In-Gel Digestion and Peptide Mass Fingerprinting by MALDI-TOF MS. After matching the gel image with the analytical software, in-gel digestion was performed with a previously published protocol.9 Targets were prepared as indicated by the instruments’ manufacturer. A saturated solution of R-cyano-4-hydroxycinnamic acid in 50% acetonitrile and Journal of Proteome Research • Vol. 6, No. 2, 2007 773

research articles

Yan et al.

Table 2. IC50 and RI Values of the Six Cell Lines IC50(µM)a

IC50(µM)b

cell line

cisplatin

carboplatin

RI

cisplatin

carboplatin

Pc

SKOV3 SKOV3/CDDP SKOV3/CBP A2780 A2780/CDDP A2780/CBP

6.67 ( 2.58 27.24 ( 8.60 -d 1.95 ( 0.69 6.83 ( 1.41 -d

80.79 ( 10.82 -d 242.40 ( 20.36 50.26 ( 5.38 -d 175.90 ( 15.27

1.00 4.12 3.00 1.00 3.50 3.50

6.34 ( 1.42 30.59 ( 10.58 -d 2.43 ( 0.89 8.17 ( 1.74 -d

82.97 ( 12.82 -d 256.67 ( 37.13 53.44 ( 10.93 -d 187.84 ( 18.75

0.85, 0.83 0.69 0.59 0.50, 0.67 0.36 0.44

a The value of IC50 of the sensitive and resistant cells to their corresponding induced drug when they were successful established. b The value of IC50 of the sensitive and resistant cells during 4 months’ culture in drug-free medium. c P value compared with the corresponding value in “a” group. d The value of IC50 that was not detected.

0.1% trifluoroacetic acid was used as matrix. One microliter of the matrix solution and sample solution (1:1) were mixed and applied onto the target plate. All mass spectra of MALDI-TOF MS were obtained on a Bruker REFLEX III MALDI-TOF MS (Bruker Daltonics, Bremen, Germany) in positive ion mode at an accelerating voltage of 20 kV. The peptide mass fingerprints obtained were used to search through the SwissProt and NCBInr database by the Mascot software. There was no limitation in protein mass and fixed modification. Monoisotopic peptide masses and MH+ mass values were used to search the database. A peptide mass tolerance of 100 ppm and one missed cleavage was allowed. Four matching peptides were the minimal requirement for an identity assignment. Variable modifications such as oxidation of methionine and carbamidomethyl modification of cysteine were considered. Reverse Transcription and Quantitative PCR. Total RNA was isolated with TRIzol Reagent according to the supplier’s instructions. The isolated RNA was used for the preparation of first-strand cDNA by reverse transcription. The RNA samples were incubated in 20 µL of reaction buffer at 42 °C for 60 min. For the determination of the five target cDNA contents, reactions containing 0.25 mM of each primer, 1 µL of template cDNA, and 5 µL DyNAmo PCR Master Mix in a total of 10 µL was performed in a Chromo 4 thermocycler (MJ Research, Waltham, MA). Beta-actin cDNA fragments were amplified as internal positive controls. The PCR conditions included an initial denaturation of 2 min at 95 °C, followed by 35 cycles consisting of 30 s of denaturation at 95 °C, 50 s of primer annealing at 52 °C, and 40 s of elongation at 72 °C. Data were analyzed using Opticon Monitor 3.0 software. The amplication of the target fragments from platinum-resistant cells, relative to their amplication in the corresponding parental cells, was determined by quantitative PCR using the ∆∆CT method.10 Quantitative PCR assays were conducted in triplicate for each sample, and mean value was used for calculation. The sequence of each primer and product length are shown in Table 1. Western Blot Analysis. Cells were lysed in Laemmli Sample Buffer (Bio-Rad) on ice. The lysates were heated to 99 °C for 10 min and centrifuged (10 000 × g for 10 min at 4 °C) to remove insoluble material. Following electrophoresis, proteins were electrophoretically transferred to polyvinylidene difluoride membrane at 100 V for 2 h in ice-cooled transfer buffer. Membranes were blocked in 5% nonfat milk for 1 h at room temperature and then incubated overnight at 4 °C in the relevant primary antibody (rabbit anti-human annexin A3 antibody was provided by Dr. Joel D. Ernst, University of California, San Francisco, USA., and used at 1:10 000,11 rabbit anti-human destrin antibody was used at 1:600, rabbit antihuman cofilin1 antibody was used at 1:1000, mouse antihuman GSTO1-1 antibody was used at 1:3000, mouse anti774

Journal of Proteome Research • Vol. 6, No. 2, 2007

human actin antibody was used at 1:1000). After incubation with the corresponding horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature, peroxidase activity was visualized with the chemiluminescence kit according to the manufacturer’s instructions. Statistical Analysis. Statistical analyses were carried out by One-way ANOVA and Student’s t test. When necessary, data were logarithmically converted into normal distribution of variable to remove heterogeneity of variance before analysis. Differences between groups were considered significant at P < 0.05.

Results Characteristics of the Platinum-Resistant Sublines. Cisplatin-resistant subline was established by pulse exposure of SKOV3 to cisplatin over a period of 16 months. The resultant cisplatin resistant subline was then maintained and passaged in drug-free medium. The stability of drug resistance was examined at monthly intervals. The inhibitory concentration 50% (IC50) and resistance index (RI) values of the six cell lines are shown in Table 2. The resistant phenotype was very stable because the values of IC50 and RI had no significant change in a period of 4 months in drug-free medium (Table 2). The 2-DE Maps of All Cell Lines. All the protein lysates and 2-DE gels were processed in parallel. 2-DE was carried out on all the protein samples of the six cell lines and was repeated at least thrice from different samples. About 1800 spots were detected on each gel after Coomassie Brilliant Blue R-350 staining by the auto-detect spots menu of analysis software and manual cleanup. Around 95% of all spots were matched on duplicate gels, and the intensity of the identical spot from different duplicate gels showed no significant change. All the maps showed great similarity between the resistant sublines and their parental cell lines in which the matching rate reached 90%. Matching rate ranged from 80 to 85% between the two different parental cell lines, SKOV3 and A2780. In the matched spots, a 2-fold or higher difference in spot intensity was considered significant. The pI of the differentially expressed spots mostly ranged between 5 and 9, and the molecular weight was about 14-70 kDa. Protein Identification by MALDI-TOF MS. Sixty-two protein spots in all samples were found to be significantly different in spot intensity by statistical analysis (P < 0.05), 57 of which were successfully identified by MALDI-TOF MS (Figure 1). Protein identification was repeated at least once with spots from different gels for guaranteeing the reliability. The results showed the matched spots from different gels were the same protein. Some of the protein spots showed identical variation trends, whereas some other spots displayed inverse expression among

Platinum-Resistant Human Ovarian Cancer Cells

research articles

Figure 1. Representative overview of Coomassie Blue-stained 2-DE map of the two sensitive and four resistant cell lines. All the differentially expressed proteins between the four resistant sublines and their corresponding parental cells are marked (arrow) on the map.

different samples. In the differential spots, spot 25 (annexin A3) and spot 67 (destrin) were upregulated in all resistant sublines, whereas spot 7 [cytosolic NADP+-dependent isocitrate dehydrogenase (IDHc)] was downregulated in four resistant sublines. Spot 54 [glutathione-S-transferase omega 1 (GSTO11)] showed an upregulated trend in the other three sublines except SKOV3/CBP. Interestingly, cofilin 1 (spot 34), which was downregulated in the two SKOV3 resistant cell sublines, was

upregulated in the A2780 sublines (Figure 2). The alternation of annexin A3 was the most marked with the upregulated range from 3- to 20-fold in all the differentially expressed proteins (Table 3). Differentially Expressed Proteins between SKOV3/CDDP and SKOV3. In total, 14 proteins were found to be differentially expressed between SKOV3/CDDP and SKOV3 protein preparations, among which 8 were upregulated and 6 were downreguJournal of Proteome Research • Vol. 6, No. 2, 2007 775

research articles

Figure 2. Expression of annexin A3, destrin, cofilin 1, GSTO11, and IDHc in 2-DE maps of resistant sublines compared with their parental cell lines. The spots with arrows represent the target protein.

lated (Table 4). Heat shock proteins (spot 21 and 28) that have been shown to be related to drug resistance12,13 increased 6-fold, and annexin A3 (spot 25) increased 4-fold in SKOV3/CDDP, whereas villin 2 (spot 1) and IDHc (spot 7) decreased 7-fold and 9-fold respectively, compared with the sensitive cell line SKOV3. Differentially Expressed Proteins between SKOV3/CBP and SKOV3. Compared with SKOV3, 16 protein spots were found to be differentially expressed in SKOV3/CBP cells (Table 5), with alterations of all spot intensities between 2- and 4-fold. The expression of stathmin 1 (spot 18) as well as phosphoglycerate mutase 1 (spot 14) increased 4-fold, and IDHc (spot 7) decreased 3-fold. Compared with SKOV3/CDDP, annexin A3 (spot 25) only increased 3-fold. Some proteins showed different expression level between SKOV3/CDDP and SKOV3/CBP. For example, stomatin (EPB72)-like 2 (spot 4) was downregulated in SKOV3/CDDP, but upregulated in SKOV3/CBP. In contrast to the upregulation in SKOV3/CDDP cells, the expression of heat shock 70kDa protein 1A and heat shock protein 27 was downregulated in SKOV3/CBP. Annexin A1 (spot 9), upregulation of which was associated with drug resistance in some studies,14 was decreased compared with SKOV3. Differentially Expressed Proteins between A2780/CDDP and A2780. The 2-DE map of A2780 was very similar to that of SKOV3, reflecting their epithelial ovarian cancer cell nature. Fifteen spots were found to be differentially expressed in A2780/CDDP (Table 6), among which 11 were upregulated and 4 were downregulated. Annexin A3 (spot 25) was dramatically upregulated by about 20-fold. GSTO1-1 (spot 54) and splicing factor, arginine/serine-rich 3 (spot 33) were also upregulated for 5-fold and 6-fold, respectively. Differentially Expressed Proteins between A2780/CBP and A2780. There were 12 differential spots in A2780/CBP compared with A2780 (Table 7), in which only five spots were downregulated with a decrease in spot intensity of 2-3-fold. Adenine phosphoribosyltransferase (spot 32) and UMP-CMPK (spot 31) was upregulated 3-fold and 4-fold, respectively. Annexin A3 (spot 25) was upregulated only 3-fold in A2780/CBP. Although both SKOV3/CBP and A2780/CBP were sublines selected against carbopaltin, their pattern of differentially expressed proteins were different. The expression of ECH1 protein (spot 47) and stathmin 1 (spot 18) were upregulated in SKOV3/CBP cells but downregulated in A2780/CBP. The expression level 776

Journal of Proteome Research • Vol. 6, No. 2, 2007

Yan et al.

of cofilin 1 (spot 34) was prominently increased by 10 folds in A2780/CBP, but decreased in SKOV3/CBP cells. The expression of dUTP pyrophosphatase (spot 56) was downregulated in both A2780/CBP and A2780/CDDP cells. Validation of Five Differential Proteins by Quantitative PCR and Western Blot. To validate the expression of the genes identified by the 2-DE, we focused on 5 genes that showed similar alteration in expression pattern in all sublines, and measured their mRNA level by quantitative PCR (Figure 3), and protein level by western blot (Figure 4). Consistent with the 2-DE result, both mRNA and protein level of annexin A3 was low in SKOV3 and A2780 cells, but increased significantly in all their resistant sublines. Despite of a consistent change in all four resistant cells in 2-DE, destrin mRNA level increased in the other three resistant cell lines except A2780/CDDP and IDHc mRNA level decreased only in SKOV3/CDDP, SKOV3/ CBP and A2780/CDDP. Intriguingly, cofilin 1 mRNA was slightly downregulated in SKOV3/CBP and markedly upregulated in A2780/CBP. The mRNA levels of GSTO1-1 were upregulated only in cisplatin resistant sublines while it had no significant change in carboplatin-resistant sublines. Despite the inconsistencies between mRNA and protein level from 2-DE, protein expression of destrin, cofilin 1, and GSTO1-1 was identical to that obtained from 2-DE.

Discussion Proteomics research is a new biological discipline that contributes greatly to our understanding of gene function in the post-genomic era, protein expression and protein-protein interactions via a global, high-resolution capacity, and highthroughput study. There is an increasing interest in proteomic techniques because the cell might express its function of proteins in various ways but DNA sequence information provides only a static snapshot. This aspect has been validated by these results. The expression of destrin, cofilin 1, GSTO11, and IDHc showed an inconsistency between quantitative PCR and western blot (and 2-DE), indicating certain expressional changes may occur at protein level. One possibility for the inconsistency may be due to translational regulations, which may take place at the level of amino acyl-tRNA prior to polymerization or take place during polymerization.15 Another may be attributed to the post-translational modification of proteins (i.e., phosphorylation, glycosylation, methylation, acetylation, sulfation, and ubiquitination).16 Only annexin A3 in the five proteins showed consistency between quantitative PCR and western blot (and 2-DE), indicating the regulation of annexin A3 expression may display at transcriptional level. As the studies with cells in culture might not always mirror the situation in human tumors in vivo, we selected four different resistant sublines to remedy the insufficiency of this method. For these experiments, we found five proteins including annexin A3, destrin, cofilin 1, GSTO1-1 and IDHc had significant change coexisting in three or four sublines. In particular, annexin A3, destrin and IDHc were coinstantaneously changed in all four resistant cell lines, which suggest their possible roles in platinum resistance. To our knowledge, this is the first report detecting the differentially expressed proteins using proteomic techniques in multiple resistant cells. This experiment greatly facilitates to avoid the inaccuracy from single cell line and guarantees the reliability of the results. Alternatively, in terms of function, this is the first time finding that annexin A3, destrin, cofilin 1, GSTO1-1, and IDHc may be involved in platinum resistance.

research articles

Platinum-Resistant Human Ovarian Cancer Cells Table 3. Five Differential Proteins Coexisted in More than Three Resistant Sublines peptides

spot

protein name

NCBInr IDa

theoretical pI /Mr (Da)

match

total

sequence coverage (%)

scoreb

expression change (fold)

07 25 34 54 67

IDHc annexin A3 cofilin 1 GSTO1-1 destrin

gi|3641398 gi|47115233 gi|5031635 gi|4758484 gi|5802966

6.34/46659 5.76/36452 8.22/18491 6.23/27548 8.84/18493

25 19 7 11 4

41 36 20 35 6

63 55 46 39 47

321 238 113 84 65

2-9 3-20 2-10 2-5 2-3

a

Abbreviations: ID, identification. b A score of more than 63 is significant (P < 0.05).

Table 4. Differentially Expressed Proteins in SKOV3/CDDP Identified by MALDI-TOF MS Compared with SKOV3

resist a

mean vol. ratio R/S

match

0.112 ( 0.019 0.051 ( 0.009 0.060 ( 0.010 0.049 ( 0.008 0.099 ( 0.013

0.135 0.486 0.110 0.194 2.063

gi|19923784 9.60/14356

0.033 ( 0.009 0.101 ( 0.021

gi|5123454 5.48/69995 gi|47115233 5.76/36452 gi|30582133 6.15/29579 gi|46360168 gi|662841 gi|5031635 gi|4758484 gi|5802966

spot

protein name

NCBInr ID a

theoretical pI /Mr (Da)

01 04 07 12 16

villin 2 stomatin (EPB72)-like 2 IDHc annexin A4 ATP synthase, H+ transporting, mitochondria F0 complex, subunitd isoform a activated RNA polymerase II transcription cofactor 4 heat shock 70kDa protein 1A annexin A3 proteasome (prosome, macropain) subunit, alpha type, 1 prohibitin heat shock protein 27 cofilin 1 (non-muscle) GSTO1-1 destrin

gi|46249758 gi|7305503 gi|3641398 gi|1703319 gi|5453559

5.94/69199 6.88/38510 6.34/46659 5.84/35860 5.21/18480

17 21 25 26 27 28 34 54 67 a

5.57/29802 7.83/22313 8.22/18491 6.23/27548 8.84/18493

total

sequence coverage (%)

scoreb

expression

47 19 25 21 10

69 26 41 38 17

60 53 63 58 72

328 177 321 145 123

V V V V v

3.061

10

24

55

137

v

0.401 ( 0.085 2.284 ( 0.206 0.183 ( 0.014 0.805 ( 0.111 0.247 ( 0.028 0.122 ( 0.020

5.696 4.399 0.494

32 19 16

56 36 55

60 55 51

251 238 101

v v V

0.191 ( 0.023 0.127 ( 0.021 0.094 ( 0.014 0.047 ( 0.006 0.028 ( 0.003

3.068 5.614 0.457 2.170 2.000

14 16 7 11 4

46 57 20 35 6

67 73 46 39 47

203 221 113 84 65

v v V v v

spot vol % sensit a

0.831 ( 0.094 0.105 ( 0.011 0.553 ( 0.032 0.252 ( 0.024 0.048 ( 0.011

0.586 ( 0.077 0.713 ( 0.080 0.043 ( 0.006 0.102 ( 0.013 0.056 ( 0.011

peptides

Abbreviations: ID, identification; Sensit, SKOV3; Resist, SKOV3/CDDP. b A score of more than 63 is significant (P < 0.05).

Table 5. Differentially Expressed Proteins in SKOV3/CBP Identified by MALDI-TOF MS Compared with SKOV3

spot

protein name

04 07 09 11 13 14 15

stomatin (EPB72)-like 2 IDHc annexin A1 unnamed protein product lactamase, beta 2 phosphoglycerate mutase 1 prosome beta-subunit; HSBpros26 stathmin 1 fatty acid binding protein5 heat shock 70 kDa protein 1A annexin A3 heat shock protein 27 cofilin 1 (non-muscle) peroxiredoxin 1 ECH1 protein destrin

18 19 21 25 28 34 40 47 67 a

spot vol %

mean sequence peptides vol. ratio coverage R/S match total (%) scoreb expression

IDa

theoretical pI /Mr (Da)

sensit

gi|7305503 gi|3641398 gi|54696696 gi|7022776 gi|7705793 gi|38566176 gi|551547

6.88/38510 6.34/46659 6.57/38690 8.99/21244 6.32/32785 6.67/28802 5.70/25893

0.105 ( 0.011 0.553 ( 0.032 1.236 ( 0.149 0.009 ( 0.001 0.056 ( 0.007 0.384 ( 0.021 0.085 ( 0.012

0.218 ( 0.024 0.192 ( 0.022 0.614 ( 0.063 0.004 ( 0.001 0.023 ( 0.003 1.488 ( 0.153 0.172 ( 0.011

2.076 0.347 0.497 0.444 0.411 3.875 2.024

19 25 22 15 8 13 11

26 41 34 20 33 30 17

53 63 63 35 34 48 48

177 321 228 95 68 252 108

v V V V V v v

gi|15680064 gi|30583737 gi|5123454 gi|47115233 gi|662841 gi|5031635 gi|55959887 gi|16924265 gi|5802966

5.76/17326 6.60/15155 5.48/69995 5.76/36452 7.83/22313 8.22/18491 8.27/18964 8.47/35735 8.84/18493

0.041 ( 0.003 0.098 ( 0.018 0.401 ( 0.085 0.183 ( 0.014 0.127 ( 0.021 0.094 ( 0.014 0.029 ( 0.006 0.013 ( 0.002 0.028 ( 0.003

0.153 ( 0.027 0.045 ( 0.009 0.200 ( 0.013 0.517 ( 0.041 0.054 ( 0.008 0.026 ( 0.002 0.071 ( 0.011 0.035 ( 0.002 0.074 ( 0.008

3.732 0.459 0.499 2.825 0.425 0.277 2.448 2.692 2.643

9 15 32 19 16 7 24 5 4

14 30 56 36 57 20 57 7 6

51 68 60 55 73 46 87 24 47

114 126 251 238 221 113 262 69 65

v V V v V V v v v

NCBInr

a

resist a

Abbreviations: ID, identification; Sensit, SKOV3; Resist, SKOV3/CBP. b A score of more than 63 is significant (P < 0.05).

Development of drug resistance can be attributed to various factors that include altered drug metabolism or uptake, avoidance of apoptotic cell death, increased repair of drug induced damage, altered gene expression and drug target.17 GSTs are a family of Phase II detoxification enzymes that catalyze the conjugation of glutathione (GSH) to a wide variety of xenobiotics and noxious compounds and display a remarkably broad substrate specificity.18 Cisplatin can be covalently linked to GSH after nucleophilic attack of the glutathione thiolate anion, and this complex can be transported out of the cell by the ATPdependent pump.19-21 Conjugation with GSH also inhibits the

conversion of monoadducts to cross-links, thereby reducing the cytotoxic potential of cisplatin adducts.22 GSTO1-1 is a member of the omega class of GSTs and so far there is no study reporting it can be involved in drug resistance. Our findings are supported by the observation that the expression of GSTO1-1 was upregulated in three resistant sublines. It is possible that the overexpression of GSTO1-1 may result in the increase of combination between GSH and platinum compounds and lead to an accelerated detoxification of drug substrates just as the above mechanisms and thus an acquired resistance. Journal of Proteome Research • Vol. 6, No. 2, 2007 777

research articles

Yan et al.

Table 6. Differentially Expressed Proteins in A2780/CDDP Identified by MALDI-TOF MS Compared with A2780

NCBInr IDa

spot

protein name

07 08 10

IDHc aldehyde reductase aldo-keto reductase family 1, member B1 annexin A3 prohibitin splicing factor, arginine/ serine-rich 3 cofilin 1 (non-muscle) lactate dehydrogenase B GSTO1-1 peroxiredoxin 6 dUTP pyrophosphatase purine nucleoside phosphorylase destrin triosephosphate isomerase 1 T-complex protein 1, gamma subunit (TCP-1-gamma) (CCT-gamma)

25 27 33 34 51 54 55 56 63 67 68 81

a

mean sequence peptides vol. ratio coverage R/S match total (%) scoreb expression

spot vol %

theoretical pI /Mr (Da)

sensita

resista

0.307 ( 0.045 0.151 ( 0.014 0.043 ( 0.005 0.087 ( 0.007 0.039 ( 0.002 0.082 ( 0.009

0.492 2.023 2.103

25 18 11

41 29 23

63 53 25

321 188 158

V v v

gi|47115233 5.76/36452 0.006 ( 0.001 0.122 ( 0.017 gi|46360168 5.57/29802 0.056 ( 0.006 0.024 ( 0.002 gi|56417681 10.12/14194 0.104 ( 0.018 0.592 ( 0.054

20.333 0.429 5.692

19 14 8

36 46 26

55 67 54

238 203 124

v V v

3.354 2.250 4.891 5.182 0.458 2.302 2.059 0.409 2.730

7 12 11 10 5 21 4 9 31

20 14 35 14 7 31 6 11 43

46 24 39 47 48 69 47 47 47

113 99 84 103 81 199 65 138 242

v v v v V v v V v

gi|3641398 6.34/46659 gi|1633300 6.34/36419 gi|13529257 6.60/35801

gi|5031635 gi|4557032 gi|4758484 gi|4758638 gi|4503423 gi|4557801 gi|5802966 gi|17389815 gi|20455521

8.22/18491 5.71/36615 6.23/27548 6.00/25019 6.15/17737 6.45/32127 8.84/18493 6.45/26625 6.10/60364

0.113 ( 0.015 0.008 ( 0.001 0.248 ( 0.057 0.011 ( 0.002 0.041 ( 0.001 0.043 ( 0.007 0.034 ( 0.006 0.066 ( 0.012 0.148 ( 0.035

0.379 ( 0.033 0.018 ( 0.002 1.213 ( 0.096 0.057 ( 0.008 0.020 ( 0.001 0.099 ( 0.011 0.070 ( 0.005 0.027 ( 0.002 0.404 ( 0.007

Abbreviations: ID, identification; Sensit, A2780; Resist, A2780/CDDP. b A score of more than 63 is significant (P < 0.05).

Table 7. Differentially Expressed Proteins in A2780/CBP Identified by MALDI-TOF MS Compared with A2780

resista

mean vol. ratio R/S

match

spot vol %

total

sequence coverage (%)

scoreb

expression

peptides

spot

protein name

NCBInr IDa

theoretical pI /Mr (Da)

07 18 25 31 32

IDHc stathmin 1 annexin A3 UMP-CMPK adenine phosphoribosyltransferase cofilin 1 (non-muscle) ECH protein 1 GSTO1-1 dUTP pyrophosphatase destrin J-type co-chaperone HSC20 KIAA0158

gi|3641398 gi|15680064 gi|47115233 gi|33150592 gi|31415697

6.34/46659 5.76/17326 5.76/36452 5.44/22208 5.78/19595

0.307 ( 0.045 0.126 ( 0.022 0.006 ( 0.001 0.004 ( 0.000 0.008 ( 0.001

0.142 ( 0.013 0.059 ( 0.009 0.020 ( 0.001 0.017 ( 0.001 0.024 ( 0.003

0.463 0.468 3.333 4.250 3.000

25 9 19 11 10

41 14 36 29 26

63 51 55 55 72

321 114 238 147 151

V V v v v

gi|5031635 gi|16924265 gi|4758484 gi|4503423 gi|5802966 gi|41388876

8.22/18491 8.47/35735 6.23/27548 6.15/17737 8.84/18493 7.59/27405

0.113 ( 0.015 0.227 ( 0.024 0.248 ( 0.057 0.041 ( 0.001 0.034 ( 0.006 0.041 ( 0.005

1.116 ( 0.092 0.079 ( 0.012 0.515 ( 0.018 0.020 ( 0.002 0.071 ( 0.004 0.018 ( 0.001

9.876 0.348 2.077 0.488 2.088 0.439

7 5 11 5 4 7

20 7 35 7 6 14

46 24 39 48 47 33

113 69 84 81 65 71

v V v V v V

gi|40788885

6.05/42120

0.047 ( 0.009

0.095 ( 0.006

2.021

15

36

46

110

v

34 47 54 56 67 82 83 a

sensita

Abbreviations: ID, identification; Sensit, A2780; Resist, A2780/CBP. A score of more than 63 is significant (P < 0.05). b

Destrin (actin depolymerizing factor, ADF) and cofilin 1 are two widely distributed intracellular actin regulatory proteins, which depolymerize filamentous (F)-actin and inhibit the polymerization of monomeric globular (G)-actin.23 The actin cytoskeleton plays an important role in apoptosis. Increased turnover of F-actin can promote cell longevity, whereas decreased actin turnover seems to trigger cell death through an apoptosis-like pathway accompanied by an increase in caspase-3 activation.24,25 Another aspect of the actin cytoskeleton during apoptosis is its specific cleavage by caspases, which in turn further trigger the activation of caspases. Expression of tActin (a 15 kDa fragment of actin cleaved by caspases) is sufficient to lead to morphological changes that resemble those observed in apoptotic cells.26 The actin regulatory protein cofilin has also been found to play a key role in the apoptotic process. A resent study showed that the active (dephosphorylated) form of cofilin is targeted to mitochondria after initiation of apoptosis and induce cytochrome c leakage from the mitochondria.27 This remarkable activity was dependent on the actin-binding domain of cofilin and implies that its actin regulatory activity is pivotal in the progression of apoptosis. Considering the important effects of destrin and cofilin 1 on regulating activity of actin, we speculate destrin and cofilin 1 may exert platinum-resistant roles through modulating the actin cytoskeleton and further inhibit apoptotic cell death in response to chemotherapeutic 778

Journal of Proteome Research • Vol. 6, No. 2, 2007

agents. On the other hand, the distinct expression pattern of cofilin 1 in the four resistant sublines may be due to the fact that specific cells respond differently to the drugs. Perhaps the transformation of the active and inactive forms of cofilin 1 could be attributed to the different expression in resistant cells. IDH is critical for certain life processes involved in cellular redox homeostasis and normal metabolisms. IDHc is known to generate NADPH, a cellular reducing agent, via oxidative decarboxylation of isocitrate. IDHc is also a very active IDH enzyme and has been shown to be the main enzyme involved in providing carbon skeletons.28 Therefore, the supply of R-oxoglutarate through a cytosolic pathway involving aconitase and IDHc represents an alternative route to the Krebs cycle enzymes, for providing carbon skeletons and the biosynthesis of glutamate and glutamine.28,29 Given the important role of IDHc in metabolism and biosynthesis, the downregulation of IDHc may inhibits the biosynthesis of R-oxoglutarate and amino acid, which lead to decreased basal metabolisms of energy and glucide and help cell live through the duration when exposed to anti-tumor drug. This hypothesis is supported by our previous experimental evidence of an arrest in G0/G1 phase and inhibition of growth in the cisplatin-resistant cells compared with their parental cells.30 Annexin A3 is a member of the annexin family (I-XIII), which is a calcium-dependent phospholipid-binding proteins

research articles

Platinum-Resistant Human Ovarian Cancer Cells

annexin A3 may confer platinum resistance through enhanced vesicle aggregation and exocytosis of drug-containing vesicles, and finally lead to increase the resistance to drug. In this study, annexin A3 had the most prominent alternation with a 3-20fold upregulation in all the differentially expressed proteins that provided us with a broad space to explore its functions and roles in platinum resistance. Taken together, these findings support that annexin A3, destrin, cofilin 1, GSTO1-1, and IDHc would probably play important roles in the development of platinum resistance. Clearly, more investigation is required to elucidate how the five proteins act in the platinum activity pathway that may occur to induce platinum resistance in epithelial ovarian cancer cells. The distinct function roles for them in regulation of platinum resistance courage us to pursue that the use of marker proteins as clinical utility for early detecting drug resistance and preventing poor prognosis.

Figure 3. Relative quantification of annexin A3, destrin, cofilin 1, GSTO1-1, and IDHc mRNA related to platinum resistance using the comparative method, beta-actin was used as internal standards. * P < 0.05, ** P < 0.01 by the t test, when comparing their corresponding parental cells for each target mRNA. (A) Relative gene expression of SKOV3 and its platinum-resistant sublines for target mRNA. (B) Relative gene expression of A2780 and its platinum-resistant sublines for target mRNA.

Acknowledgment. We thank Dr. Joel D. Ernst (University of California, San Francisco, CA, U.S.A.) for rabbit antihuman annexin A3 antibody and Dr. Xuemin Zhang and colleagues (Institute of Basic Medical Sciences, National Center of Biomedical Analysis, Beijing, China) for proteomic technical assistance. We also thank Dr. Sheng Zhou (St. Jude Children’s Research Hospital, Memphis, TN, U.S.A.) for critical comments on the manuscript and helpful discussions and all our colleagues in Department of Cell Biology, Institute of Basic Medical Sciences for excellent technical assistance. This work was supported by the Key foundation of PUMC Hospital (Grant 200203*). References

Figure 4. Western blot characterization of annexin A3, destrin, cofilin 1, and GSTO1-1 in the four resistant cell lines and their parental cell lines. Sixty micrograms of total proteins were run in SDS-PAGE at 80 V through the stacking gel and then 100 V for the duration of the separation gel and transferred to polyvinylidene difluoride membrane. The blocked membrane was then incubated with relevant antibodies, followed by an appropriate secondary antibody conjugated to horseradish peroxidase. The bands were visualized using an ECL system. The proteins are located at 36, 18, 18, and 27 kDa, respectively.

group, and plays a role in the regulation of cellular growth and in signal transduction pathways.31 Annexin A3 has been shown to have anticoagulant and anti-phospholipase A2 properties in vitro32 and to mediate membrane-membrane contact during biological processes (i.e., phagosome-lysosome fusion, vesicular trafficking, plasma membrane binding and degranulation).33 Despite the physiological functions of other annexins have been recently clarified by the knock-out or RNAi and transgenic methods,34-39 the functions of annexin A3 remain poorly understood. According to the current knowledge, it seemed that

(1) Berek, J. S. In Practical gynecologic oncology; Lippincott Williams & Wilkins: Philadelphea, 2000; pp 457. (2) Hamada, S.; Kamada, M.; Furumoto, H.; Hirao, T.; Aono, T. Gynecol. Oncol. 1994, 52, 313-319. (3) Veneroni, S.; Zaffaroni, N.; Daidone, M. G.; Benini, E.; Villa, R.; Silvestrini, R. Eur. J. Cancer 1994, 30A, 1002-1007. (4) Sasaki, H.; Sheng, Y.; Kotsuji, F.; Tsang, B. K. Cancer Res. 2000, 60, 5659-5666. (5) Marth, C.; Widschwendter, M.; Kaern, J.; Jorgensen, N. P.; Windbichler, G.; Zeimet, A. G.; Trope, C., Daxenbichler, G. Br. J. Cancer 1997, 76, 1328-1332. (6) Aebi, S.; Kurdi-Haidar, B.; Gordon, R.; Cenni, B.; Zheng, H.; Fink, D.; Christen, R. D.; Boland, C. R.; Koi, M.; Fishel, R.; Howell, S. B. Cancer Res. 1996, 56, 3087-3090. (7) Li, L.; Luan, Y.; Wang, G.; Tang, B.; Li, D.; Zhang, W.; Li, X.; Zhao, J.; Ding, H.; Reed, E.; Li, Q. Q. Int. J. Mol. Med. 2004, 14, 257264. (8) Cecconi, D.; Donadelli, M.; Scarpa, A.; Milli, A.; PalmieriM, M.; Hamdan, M.; Areces, L. B.; Rappsilber, J.; Righetti, P. G. J. Proteome Res. 2005, 4, 1909-1916. (9) Yang, J. W.; Rodrigo, R.; Felipo, V.; Lubec, G. J. Proteome Res. 2005, 4, 768-788. (10) Livak, K. J.; Schmittgen, T. D. Methods 2001, 25, 402-408. (11) Ernst, J. D.; Hoye, E.; Blackwood, R. A.; Jaye, D. J. Clin. Invest. 1990, 85, 1065-1071. (12) Sugimura, M.; Sagae, S.; Ishioka, S.; Nishioka, Y.; Tsukada, K.; Kudo, R. Oncology 2004, 66, 53-61. (13) Hettinga, J. V.; Lemstra, W.; Meijer, C.; Los, G.; de Vries, E. G.; Konings, A. W.; Kampinga, H. H. Int. J. Cancer 1996, 67, 800807. (14) Wang, Y.; Serfass, L.; Roy, M. O.; Wong, J.; Bonneau, A. M.; Georges, E. Biochem. Biophys. Res. Commun. 2004, 314, 565570. (15) Rodnina, M. V.; Gromadski, K. B.; Kothe, U.; Wieden, H. J. FEBS Lett. 2005, 579, 938-942. (16) Han, K. K.; Martinage, A. Int. J. Biochem. 1992, 24, 19-28. (17) Kartalou, M.; Essigmann, J. M. Mutat. Res. 2001, 478, 23-43. (18) Lowndes, H. E.; Beiswanger, C. M.; Philbert, M. A.; Reuhl, K. R. Neurotoxicology 1994, 15, 61-73. (19) Ishikawa, T. Trends Biochem. Sci. 1992, 17, 463-468.

Journal of Proteome Research • Vol. 6, No. 2, 2007 779

research articles (20) Chen, Z. S.; Mutoh, M.; Sumizawa, T.; Furukawa, T.; Haraguchi, M.; Tani, A.; Saijo, N.; Kondo, T.; Akiyama, S. Exp. Cell Res. 1998, 240, 312-320. (21) Ishikawa, T.; Ali-Osman, F. J. Biol. Chem. 1993, 268, 20116-20125. (22) Eastman, A. Chem. Biol. Interact. 1987, 61, 241-248. (23) Bamburg, J. R.; McGough, A.; Ono, S. Trends Cell Biol. 1999, 9, 364-370. (24) Posey, S.; Bierer, B. J. Biol. Chem. 1999, 274, 4259-4265. (25) Odaka, C.; Sanders, M. L.; Crews, P. Clin. Diagn. Lab. Immunol. 2000, 7, 947-952. (26) Mashima, T.; Naito, M.; Tsuruo, T. Oncogene 1999, 18, 2423-2430. (27) Chua, B. T.; Volbracht, C.; Tan, K. O.; Li, R.; Yu, V. C.; Li, P. Nature Cell Biol. 2003, 5, 1083-1089. (28) Minard, K. I.; Jennings, G. T.; Loftus, T. M.; Xuan, D.; McAlisterHenn, L. J. Biol. Chem. 1998, 273, 31486-31493. (29) Galvez, S.; Lancien, M.; Hodges, M. Trends Plant Sci. 1999, 4, 484-490. (30) Yan, X. D.; Zhang, M. W.; Pan, L. Y. Basic Clin. Med. (China) 2006, 36, 739-744. (31) Moss, S. E.; Morgan, R. O. Genome Biol. 2004, 5, 219. (32) Tait, J. F.; Sakata, M.; McMullen, B. A.; Miao, C. H.; Funakoshi, T.; Hendrickson, L. E.; Fujikawa, K. Biochemistry 1988, 27, 62686276.

780

Journal of Proteome Research • Vol. 6, No. 2, 2007

Yan et al. (33) Ernst, J. D.; Hoye, E.; Blackwood, R. A.; Jaye, D. J. Clin. Invest. 1990, 85, 1065-1071. (34) Kubista, H.; Hawkins, T. E.; Patel, D. R.; Haigler, H. T.; Moss, S. E. Curr. Biol. 1999, 9, 1403-1406. (35) Herr, C.; Smyth, N.; Ullrich, S.; Yun, F.; Sasse, P.; Hescheler, J.; Fleischmann, B.; Lasek, K.; Brixius, K.; Schwinger, R. H.; Fassler, R.; Schroder, R.; Noegel, A. A. Mol. Cell Biol. 2001, 21, 41194128. (36) Roviezzo, F.; Getting, S. J.; Paul-Clark, M. J.; Yona, S.; Gavins, F. N.; Perretti, M.; Hannon, R.; Croxtall, J. D.; Buckingham, J. C.; Flower, R. J. J. Physiol. Pharmacol. 2002, 53, 541-553. (37) Croxtall, J. D.; Gilroy, D. W.; Solito, E.; Choudhury, Q.; Ward, B. J.; Buckingham, J. C.; Flower, R. J. Biochem. J. 2003, 371, 927935. (38) Song, G.; Harding, S. E.; Duchen, M. R.; Tunwell, R.; O’Gara, P.; Hawkins, T. E.; Moss, S. E. FASEB J. 2002, 16, 622-624. (39) Hannon, R.; Croxtall, J. D.; Getting, S. J.; Roviezzo, F.; Yona, S.; Paul-Clark, M. J.; Gavins, F. N.; Perretti, M.; Morris, J. F.; Buckingham, J. C.; Flower, R. J. FASEB J. 2003, 17, 253-255.

PR060402R