Article pubs.acs.org/molecularpharmaceutics
Improved Lentiviral Transduction of ALS Motoneurons in Vivo via Dual Targeting Valerie B. O’Leary,*,†,‡ Saak V. Ovsepian,†,§ MacDara Bodeker,†,∥ and J. Oliver Dolly*,† †
International Centre for Neurotherapeutics, Dublin City University, Dublin 9, Ireland Helmholtz Zentrum Munchen, Institute of Radiation Biology, 85764 Neuherberg, Germany § DZNE, Ludwig-Maximilian-Universität München, Zentrum für Neuropathologie, 81377 München, Germany ∥ Life Sciences Department, Institute of Technology, Sligo, Ireland ‡
S Supporting Information *
ABSTRACT: Treatment of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disease, is hampered by its complex etiology and lack of efficient means for targeted transfer of therapeutics into motoneurons. The objective of this research was engineering of a versatile motoneuron targeting adaptera full-length atoxic tetanus toxin fused to core-streptavidin (CSTeTIM)for retro-axonal transduction of viral vectors; validation of the targeting efficiency of CS-TeTIM in vivo, by expression of green fluorescence protein (GFP) reporter in motoneurons of presymptomatic and symptomatic ALS-like SOD1G93A mice, and comparison with age-matched controls; and appraisal of lentiviral transduction with CS-TeTIM relative to (1) a HC binding fragment of tetanus toxin CS-TeTx(HC), (2) rabies glycoprotein (RG), and (3) a CS-TeTIM-RG dual targeting approach. CS-TeTIM and CSTeTx(HC) were engineered using recombinant technology and site-directed mutagenesis. Biotinylated vectors, pseudotyped with vesicular stomatitis virus glycoprotein (VSV-G) or RG, were linked to these adaptors and injected intraperitoneally (ip) into presymptomatic (12 weeks old), symptomatic SOD1G93A (22 weeks old) or wild type control mice, followed by monitoring of GFP expression in the spinal cord and supraspinal motor structures with quantitative PCR and immuno-histochemistry. Transcripts were detected in the spinal cord and supraspinal motor structures of all mice 2 weeks after receiving a single ip injection, although in symptomatic SOD1G93A animals reporter RNA levels were lower compared to presymptomatic and wild-type controls irrespective of the targeting approach. GFP transduction with CS-TeTIM proved more efficient than CS-TeTx(HC) across all groups while CSTeTIM-RG dual-targeted vectors yielded the highest transcript numbers. Importantly, in both wild-type and presymptomatic SOD1G93A mice strong colabeling of choline-acetyltransferase (ChAT) and GFP was visualized in neurons of the brain stem and spinal cord. CS-TeTIM, a versatile adaptor protein for targeted lentiviral transduction of motoneurons, has been engineered and its competence assessed relative to CS-TeTx(HC) and RG. Evidence has been provided that highlights the potential usefulness of this novel recombinant tool for basic research with implications for improved transfer of therapeutic candidates into motoneurons for the amelioration of ALS and related diseases. KEYWORDS: tetanus toxin, CS-TeTIM, lentivirus, rabies glycoprotein, pseudotyping, ALS, SOD1
■
INTRODUCTION Amyotrophic lateral sclerosis (ALS) is a multifactorial neurodegenerative disease characterized by progressive loss of motoneurons in the motor cortex, brain stem and spinal cord, culminating in paralysis and death of the affected within 3−5 years from diagnosis.1 The majority of cases are idiopathic with only 10% of individuals inheriting it as an autosomal dominant disorder.2,3 An estimated 15% of these familial ALS (fALS) have missense mutations in a gene encoding superoxide dismutase 1 (SOD1), a metallo-protease that binds copper and zinc ions to convert naturally occurring, but harmful, superoxide radicals to molecular oxygen and hydrogen peroxide.4,5 Despite being one of the earliest characterized familial neurodegenerative conditions, the mechanistic link © 2013 American Chemical Society
between SOD1 mutations and progressive loss of motoneurons remains unclear. Equally, the intricate etiology of sporadic and other fALS forms, combined with poor accessibility of motoneurons in the brain and spinal cord for therapeutics, imposes major hurdles for developing treatments;6,7 therefore, a pressing need exists for novel therapies as well as the means for their targeted delivery to motoneurons before the onset or throughout the course of the pathological process. Received: Revised: Accepted: Published: 4195
April 23, 2013 August 27, 2013 September 25, 2013 September 25, 2013 dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Table 1. Primers for Engineering CS-TeTIM and CS-TeTx(Hc) Probes Used for Determining Transgene Expression with Taqman QPCR.a primers
sequence 5′ → 3′
CS forward CS reverse TeTIM forward TeTx(HC) forward common reverse TetXINVFor TetXINVRev GFP forward GFP reverse GFP probe SOD1G93A forward SOD1G93A reverse SOD1G93A probe ChAT assay GAPDH
CAAGAGATAACATATGGGAGGATCCAGATCTC TAGGATTATGAGCTCATGAGATCTCTCGAG GCACAAGAGCTCCCAATAACCATAAATAATTTTAGATAT AGTGATCCTGTTA AAATTAAGGAGCTCATGAAAAATCTGGATTGTTGGGTTGATAAT GCTCAAGAGCTCTCGTTGGTCCAACCTTCATCG GTAATTATCATTACGACCTAGAACTTTTATAAACG GTGCGTGAATATGTACATGATGTACCAAATATGCC TCCGCCCTGAGCAAAGAC GAACTCCAGCAGGACCATGTG 6-FAM-CCAACGAGAAGCGC-TAMRA GGGAAGCTGTTGTCCCAAG CAAGGGGAGGTAAAAGAGAGC 6-FAM-CTGCATCTGGTTCTTGCAAAACACCA-BHQ1 Taqman gene expression assay part number 4331182/plate i.d. 631669 Taqman gene expression assay 435233BE-0703008
5′ fluorophore and 3′ quencher are indicated for probes. BHQ1: black hole quencher 1, TetXINVFor and TetXINVRev used for site directed mutagenesis. 10 pmol of primer/reaction and 5 pmol of probe/reaction. a
The best characterized ALS-like mouse, SOD1G93A, serves as a valuable model for assessing the effectiveness of restorative and drug delivery approaches.8−10 A deficit in slow axonal transport has emerged as a key contributor to advanced ALS.11,12 Hence, an attractive strategy for discriminatory retroaxonal transduction of nonviral and viral vectors to motoneurons through the use of tetanus toxin (TeTx) heavy chain binding fragment (HC) has been used in presymptomatic SOD1G93A mice, albeit with limited success.9,13 Anecdotal evidence suggests that full-length TeTx is superior to HC at targeting motoneurons,14,15 implicating the role of other TeTx subdomains in this process. Successful retargeting of therapeutic vectors or liposomal cargo to motoneurons and end-plates in vitro and intramural ganglionic neurons in vivo with full-length inactive botulinum neurotoxin B fused with CS (CS-BoTIM/B)16,17 encouraged us to utilize a similar approach with atoxic TeTx to evaluate its capacity for neuronal targeting and vector transduction. To this end, a protease inactive mutant of TeTx (TeTIM) was produced and fused to core-streptavidin (CS, a reduced variant of streptavidin), so the resultant CSTeTIM combines the exquisite neuron targeting of full-length TeTIM with the competence of CS for high-affinity (10−15) attachment to a broad range of biotinylated cargo or viral vectors.16,18 The potential applicability of CS-TeTIM as an adaptor for targeting motoneurons in the periphery is of primary importance and interest given that attempts to date at selective retro-axonal transduction of vectors have only had limited success,13,19,20 while central delivery via intrathecal spinal cord infusion is a highly invasive route for transfer of therapeutics with substantial risk of severe adverse effects.21−23 Herein, an in vivo analysis was conducted, appraising the transduction to motoneurons of lentiviral vectors attached to atoxic CS-TeTIM following a single intraperitoneal (ip) administration in presymptomatic and symptomatic SOD1G93A mice and wild-type (WT) littermates. Moreover, a double-pronged targeting approach was evaluated through coupling CS-TeTIM to rabies glycoprotein pseudotyped lentiviral vectors (RGLVs), with its superior capacity of gene targeting and intervention with the genome or transcriptome of motoneurons from the periphery, with a potential for basic
research as well as for combating ALS and other related neurodegenerative disorders.
■
EXPERIMENTAL SECTION Engineering, Expression and Purification of CS-TeTIM and CS-TeTx(HC). All materials were purchased from SigmaAldrich (Dublin, Ireland) unless otherwise stated. Restriction endonucleases were obtained from New England Biolabs (Ireland). Platinum Pfx DNA-polymerase (Invitrogen, Ireland) was used to amplify CS with paired primers (Table 1) based on its gene sequence24 with the introduction of NdeI and SacI restriction sites. The resultant PCR fragment (513 bp) was trimmed and subcloned into pET29A (Novagen, United Kingdom) generating CS-pET. TeTIM was obtained by site-directed mutagenesis25 involving PCR, appropriate 5′ phosphorylated primers (Table 1) and the TeTx gene26 as template. PCR products were incubated with DpnI (20 U/μL) at 37 °C for 1 h, self-ligated and transformed into Escherichia coli TOP10. DNA was subsequently isolated and purified from transformants. The presence of a mutation that resulted in a glutamic acid to alanine conversion at position 405 (equivalent to E234A26) was confirmed by sequencing. DNA fragments were amplified from this TeTIM gene, using specific forward primers (Table 1) for either full length TeTIM (minus the start methionine) or TeTx(HC) binding domain. Both of these forward primers were paired with a common reverse primer (Table 1), generating TeTx (3951bp) or TeTx(HC) (1355bp), respectively. All primers contained a SacI endonuclease recognition site, allowing unidirectional cloning after SacI trimming, into the CS-pET vector which was similarly prepared incorporating a Cterminal His6 tag. Following initial restriction mapping to confirm correct orientation of sequences in CS-pET, candidate clones were verified by sequencing. CS-TeTIM and CSTeTx(H C) genes were transformed into E. coli BL21 (Stratagene, USA), expressed under autoinduction conditions27 and purified by immobilized metal affinity chromatography (IMAC), using standard protocols. A second IMAC, performed with 700 mM NaCl, removed all extraneous free CS, yielding 80% purity for CS-TeTIM and CS-TeTx(HC). The latter were purified further by incubation with biotin-agarose for 30 min at 4196
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
mutant human SOD1 gene (G93A),8 were purchased from Jackson Laboratories (Bar Harbor, ME, USA), housed and bred at the Dublin City University bioresources facility, with food and water provided ad libitum. All mice were monitored and weighed thrice per week, with only males used in the current analysis due to the known late onset of the ALS-like phenotype in females, 32 to reduce variability. Hemizygotes were propagated by mating B6SJL-Tg(SODG93A) males with C57BL/6 females. Upon weaning, offspring were genotyped and the presence of the SOD1G93A gene was confirmed by quantitative PCR (QPCR) amplification of genomic DNA extracted from ear-punches33 (Table 1). PCR involved 40 cycles of denaturation (95 °C; 5 min), annealing (60 °C; 30 s) and amplification (72 °C; 45 s) followed by extension (72 °C; 2 min). Neurological scoring criteria were followed.34 The SOD1G93A mice were euthanized around 245 ± 15 days, when end point (neurological score = 2) was reached, as evident from the severe flaccid paralysis of hindlimbs. The onset of paralysis was judged by scoring rotarod performance, a complex task requiring good motor coordination, balance and muscle strength.35 Beginning at week 10, SOD1G93A (n = 10) mice and age-matched WT littermate male controls (n = 10) were trained for 5 days/week for 3 weeks adaptation period (at rotation speed of 5 rpm, week 1; 15 rpm, week 2; 25 rpm, week 3). Measurement was taken of the time each animal remained on the rotating cylinder (3.5 cm in diameter) of a rotarod apparatus (UGO Basile, USA) revolving at a constant speed of 25 rpm. With progressive deficit of motoneuron function, the time mice balanced on the rotating rod became shorter. Quantification of Motoneuron Size, Survival and Astrocyte Morphometry. Symptomatic SOD1G93A mice (22 weeks) and WT controls (n = 5 per group) were anesthetized with sodium pentobarbital (200 mg/kg), transcardially perfused with PBS (100 mL) followed by fixation in 4% paraformaldehyde (PFA)/PBS (80 mL). Brain and spinal cord were dissected and incubated overnight in 4% PFA/PBS for fixation, followed by dehydration for 24 h in 30% sucrose/ 0.1× PBS. Afterward, the tissue was embedded in O.C.T. compound (Tissue Tek), cryosectioned (60 μm) and stained with cresyl violet (Nissl dye) (Sigma).36 Cells visualized within the anterior horn region were counted from every second slice in series (10 per animal, i.e. 50 sections per group). Brain stem and spinal cord sections of the same thickness were also used for selective labeling of motoneuorns with ChAT staining (see protocol below). The cell/motoneuron size was measured from the largest cross-sectional areas as determined by ImageJ (Version 1.42g software: National Institutes of Health) with numerical values plotted using IgorPro (WaveMetrics, Lake Oswego, OR, USA). Analysis of astrocyte branching taken as a readout of the glial response to the pathological process37 was carried out on brain stem and lumbar spinal cord sections stained for glial fibrillary acidic protein (GFAP)a mature astrocyte markerwith mouse GFAP primary antibody followed by goat anti-mouse IgG Alexa 568 (1:1000). Image stacks with optical section thickness of 2 μm in z-axis depth were acquired using a confocal microscope (LSM 710) with a Plan-Apo 40×/0.95 oil immersion objective (Carl Zeiss, Germany). Astrocytes were traced through stacks with reconstruction as 2D binarized representations, using ImageJ (NIH) and the Sholl method for concentric circles.38 Each cell was thus analyzed by selecting the center of its soma and then running the analysis procedure, with counting of the number of intersections at circles between 45 and 50 μm from the center.
RT (Thermo Scientific, U.K.). After extensive washing with buffer (20 mM Tris Cl pH 8, 75 mM NaCl, 2 mM CaCl2), bound material was eluted in the presence of 0.1 M glycineHCl (pH 3). Fractions were immediately neutralized with 1 M sodium phosphate (pH 9) (10% v/v), pooled and buffer exchanged into the working solution (20 mM Tris Cl pH 8, 75 mM NaCl, 2 mM CaCl2). CS-TeTIM was converted to dichain (DC) by nicking with recombinant enterokinase (Promega, USA; 1 unit/30 μg of protein) at 22 °C for 2 h, and the reaction stopped with 1 mM PMSF. Nicking was confirmed by SDS−PAGE and Coomassie blue staining. Antagonism of the Action of TeTx by CS-TeTIM or CSTeTx(HC). Spinal cord neurons were isolated from C57BL/6 mice (age P1), plated at 2 × 106 cells per 35 mm dish in culture medium as previously described16 and exposed to various concentrations of CS-TeTIM or CS-TeTx(HC) for 1 h at 37 °C, followed by addition of TeTx (10 nM) for 5 h at 37 °C under nonstimulatation conditions. Afterward, proteins were extracted and resolved by electrophoresis on 12% Bis-Tris NuPage gels (Invitrogen) with SNAREs (VAMP-2 and syntaxin) detected using Western blotting, with respective antibodies (1:10000 Synaptic Systems, U.K.). Rabies Glycoprotein-Pseudotyped Lentivirus: Production, Purification and Its Conjugation to CS-TeTIM. Replication-deficient lentiviruses encoding green fluorescent protein (GFP) pseudotyped with either the vesicular stomatitis virus glycoprotein (VSV-G) termed LVGFP or the rabies virus envelope glycoprotein (RG) called RGLV-GFP further referred to as RGLV were utilized in this study. LVGFP was produced as previously reported.16 RGLV was obtained through transfection of HEK293FT with pHCMV-RabiesG (6.6kb) (Addgene plasmid 15785),28 pWPI (11kb) (Addgene plasmid 12254) and psPAX2 (10.7kb) (Addgene plasmid 12260) using polyethylenimine.29 Following centrifugation (930g, 4 °C) to remove cell debris, culture supernatants were spun (36000g, 4 °C) for 2 h over a 30% sucrose cushion to concentrate viral particles. Protein content of the resultant RGLV was measured using bicinchoninic acid, and titers determined by p24 enzymelinked immunosorbent assay (Aalto, Ireland).30 The p24 ELISA was also used to determine the extent of viral clearance by the liver. Viral titers are presented as a multiplicity of infection (MOI) ratio, defined as the number of infectious virus particles deposited in a tissue culture well divided by the number of cells present. Viral infectivity was evaluated with cultures of C57BL/ 6 mice spinal cord neurons exposed to RGLV (MOI 1−1000) for 48 h before counting of GFP fluorescent cells as described earlier for rat spinal cord neuron cultures.16 RGLV was biotinylated with EZ-link sulfo-NHS-SS-biotin and quantified using a HABA-avidin kit (Thermo Scientific)31 and calculator (http://www.piercenet.com), as described previously.16 Biotinylated RGLV was conjugated to CS-TeTIM by passing it through a Talon resin column containing CS-TeTIM bound to the His6 tag. After repeated washing with PBS, CS-TeTIMRGLV was eluted with PBS/1 mM EDTA and fractions were monitored by SDS−PAGE as previously reported.16,17 Likewise, CS-TeTIM or CS-TeTx(HC ) was conjugated to biotinylated LVGFP, which was followed by quantification of the viral titers using the p24 assay (as above). Functional Assessment of SOD1G93A Transgenic Mice. All experimental procedures involving mice were approved by the Research Ethics Committee at Dublin City University under the guidelines of the Department for Health, Republic of Ireland. B6SJL-Tg (hSOD1G93A) 1Gur/J mice, which carry a 4197
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Figure 1. Construction of neuronal targeting moieties: CS-TeTIM, CS-TeTx (HC) and rabies glycoprotein pseudotyped lentiGFP. (A; top) Map of core streptavidin (CS) TeTIM DNA construct showing CS, light-chain (LC) and heavy chain (HC) (double headed arrows). (A; lower top) Line diagram illustrating CS, LC and HC moieties: HN, N-terminal translocation domain; HC, C-terminal binding domain. Linker (63bp) and C-terminal linker-histidine (His6) tag (55bp) are represented as double bars left and right, respectively. (A; middle) Bar diagrams representing CS-TeTIM (upper) and CS-TeTx(HC) depicted as CS-HC (lower). Both constructs have an N-terminal CS (black) and C-terminal His6 tag (green). CS-TeTIM also contains LC with a mutation (E234A, navy blue) linked through a disulfide bridge (S−S) to full HC. (A; lower) DNA sequence (inset) of the LC inactive metalloprotease domain of CS-TeTIM containing the A → C missense mutation (red underlined) generated by site-directed mutagenesis. (B) Coomassie stained CS-TeTIM purified by IMAC and nicked with enterokinase, 12% Bis-Tris SDS−PAGE gel. Ld: protein standards (Bio-Rad). Lanes 1 and 2: dichain CS-TeTIM (upper arrowhead: 163 kDa) resolved under nonreducing conditions and in the presence of 1 mM DTT showing HC (middle arrowhead: 100 kDa) and CS-LC (lower arrowhead: 63 kDa). Lane 3: CS-HC (63 kDa). (C) CS-TeTIM does not cleave substrate GST-VAMP-2-GFP in vitro. Coomassie stained (12% Bis-Tris SDS) gels: intact VAMP-2 (black arrowhead; 37 kDa) in the absence (−) of TeTx showing slight degradation of the recombinant substrate (lower band and smearing); complete cleavage of VAMP-2 in the presence (+) of TeTx (200 nM; lower arrowhead); intact VAMP-2 in the absence (−) and presence (+) of CS-TeTIM (200 nM). (D) CS-TeTIM antagonizes TeTx more effectively than CS-TeTx(HC) in spinal cord neurons. Representative Western blots of VAMP-2 from spinal cord neuron cultures preexposed to either CS-TeTIM (left: 100 nM) or CS-TeTx(HC) (right: 100 nM) followed by increasing nanomolar concentrations of TeTx (upper panel). VAMP-2 (top) cleavage is evident as the protein band disappearing. Syntaxin (bottom) serves as an internal loading control. (E) Agarose gel (1.2%) of linearized plasmids used for assembly of rabies pseudotyped lentivirus (RGLV). Ld: λ EcoRI HindIII digested ladder. lanes 1−3: pHCMVRG (6.6kb), pWPI (11kb) and psPAX2 (10.7kb) restriction digested with EcoRI, Xba1 or EcoRV, respectively, to linearize the plasmids.
procedure followed as specified.39 Postsurgical mice were routinely monitored with welfare records maintained before being processed for QPCR or immuno-histochemistry. Mice were euthanized (as above) and intracardially perfused with PBS (100 mL) at 3, 7, and 14 days (n = 6 per time point). Spinal cord, brain stem, motor cortex and basal ganglia were extracted into RNAlater (Qiagen, U.K). Total RNA was isolated and purified (RNeasy Lipid Tissue mini-kit, Qiagen) with genomic DNA removed using DNase1 (1 unit/10 μg; 30 min, 37 °C). RNA concentration and purity were determined from A260 nm and A260/280 nm ratios, respectively. Synthesis of single-stranded cDNA was carried out as per manufacturer’s instructions (Invitrogen) with 5 μg of RNA reverse transcribed per sample, using both random and oligo dT primers, followed by incubation with RNaseH (1 unit/μg; 20 min, 37 °C). A Taqman QPCR assay was designed to determine the GFP transgene copy number relative to glyceraldehyde phosphate dehydrogenase (GAPDH), an endogenous control reference gene. Using specific primers and probes (Table 1) and 20x Mastermix (Applied Biosystems, U.K.), samples were analyzed
Detection of Reporter Transcripts or Protein Expression in the Central Nervous System. Presymptomatic (12 weeks old), symptomatic SOD1G93A (22 weeks old) and WT controls were injected intraperitonally (300 μL) with 109 viral particles (VP) of RGLV, CS-TeTx(Hc)-LVGFP, CSTeTIM-LVGFP or CS-TeTIM-RGLV. Mice were briefly anesthetized by exposure to isoflurane (2% mixed with oxygen). A needle (25 G) was inserted at a 30° angle into the lower right quadrant of the animal abdomen. The shaft of the needle was inserted to a depth of ∼5 mm with aspiration to ensure no penetration of blood vessels, intestines or urinary bladder. In order to verify and compare the transduction ability of motoneurons of presymptomatic and symptomatic SOD1G93A mice, intrathecal injections were conducted (n = 4) according to the protocol described39 and mice processed after 14 days, with spinal cord injection segment dissected and used for QPCR as specified below. After penetration of the vertebral lamina over the L1 and L2 using a microdrill, RGLV (109 viral particles) was injected slowly (over 5 min) with a Hamilton microsyringe attached to a 30 gauge beveled needle and 4198
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Figure 2. Functional and cellular evaluation of SOD1G93A male mice and wild-type littermate controls: (A) Plots showing mean (±SEM) changes in rotarod performance (% of time on the rotarod with 3 min taken as 100%) over a 35 week period for SOD1G93A mice (n = 10) and wild-type littermate controls (n = 10). Significant differences began from 24 weeks. Inset: schematic representations of the times of lentiviral administration (upward pointing arrows). Animals were evaluated for transgene delivery at 3, 7, and 14 days postinjection (downward pointing arrows). (B, C) Representative photomicrographs of anti-ChAT (developed with HRP secondary antibody) and Nissl stained motoneurons in sections of the spinal cord from littermate controls (WT: left panels) and symptomatic SOD1G93A mice (right panels): note granulated cell bodies in Nissl stained micrographs (arrowheads). P and M refer to posterior and medial, respectively. (D, E) Graphical representation of the motoneuron (D) and cell (E) size distribution in the anterior horn of WT and symptomatic SOD1G93A mice. For cell size measurements, the largest cross-sectional areas were determined using ImageJ software (Version 1.42g, National Institute of Health).
in duplicate along with controls (no-template, no-reverse transcriptase and sample from noninjected animal). The threshold for the real-time PCR was taken as the signal level that reflected a significant increase over the calculated baseline. The threshold cycle (Ct), the cycle number at which the fluorescent signal crossed the threshold, was used to calculate the initial DNA copy number, as the Ct value is inversely related to the concentration of starting template. Standard curves for GFP and GAPDH were generated either using pWPI plasmid encoding GFP with transgene copy number (2 × 102 to 2 × 1010) or from known cDNA concentrations (50−50000 pg/μL) extracted from neuronal tissue or liver, respectively. The copy number values and endogenous reference control for the unknown samples were then derived from such standard curves. Values were calculated by the ΔΔCt method with GAPDH used as an internal standard. For immunohistochemistry, lumbar spinal cord (L3−L6) and brain stem floating sections (60 μm) were permeabilized [Tris-buffered saline (TBS) containing 0.4% Triton) (TBS-T)], blocked [donkey serum (5%), BSA (2%), TBS-T] and immunostained overnight at RT with goat anti-choline acetyltransferase (ChAT) (1:100) and rabbit anti-GFP (1:500) for detecting motoneurons and transgene, respectively. Anti-ChAT was detected with a secondary donkey anti-goat Alexa 568 (1:1000) or donkey anti-goat HRP (OAB kit, Vectorlabs used for detection) and goat anti-rabbit-FITC (1:1000) utilized for enhancing the GFP fluorescence.40 Nuclei were identified with Vectashield DAPI hardset mounting medium (Vector Laboratories. U.K.). Fluorescence images were acquired using confocal microscopy (Carl Zeiss). Argon and helium/neon lasers provided the 488 nm (GFP) and 568 nm line for excitation with emitted signals sampled in a frame mode at a spatial resolution of 30 nm per pixel and a dwell time of 1.5 μs through a Plan-Apo 40×/0.95 oil immersion objective. Data Analysis and Statistics. Values in the text are expressed as the mean ± SEM, and n refers to the number of
independent data. Differences between means were tested using the Student t-test with p values 10000-fold) of the in vivo neurotoxicity for reported E234A mutated TeTx.14 In view of the intended use of CS-TeTIM and CS-TeTx(HC) as targeting adaptors for viral vectors and other potential neurotherapeutics, their abilities to bind neuronal acceptors and antagonize the proteolysis of native VAMP-2 substrate by TeTx (10 nM) were assessed in cultured spinal cord neurons. As expected, pretreatment of cultured neurons with either CS-TeTIM or CS-TeTx(HC) reduced the proteolysis of VAMP-2 by TeTx, in a dose dependent manner, which is expected due to competition of these proteins with TeTx for binding to shared neuronal acceptors (Figure 1D). Comparison of TeTx-induced VAMP-2 cleavage in the presence of CS-TeTIM or CSTeTx(HC) revealed that the former is a superior TeTx competitor, as evident from stronger intact VAMP-2 bands on Western blots, which differed significantly at concentration ranges between 10 and 500 nM (p < 0.05). VSV-G and RG pseudotyped LVs were produced by transfection of packaging HEK-293FT cells with three different plasmids: (1) pMD-2G (helper), pWPT-GFP (vector) and pCMV-d-8.74 (envelope) 4199
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Figure 3. Increased transgene expression from dual targeted lentivirus following delivery to the central nervous system: histograms of real-time reverse transcriptase QPCR analysis determining GFP copy number, normalized to GAPDH within motor cortex (MC), basal ganglia (BG), brain stem (BS) and lumbar spinal cord (SC) tissue from presymptomatic SOD1G93A mice (PS-SOD1:black bars) and wild type (WT) littermate controls (gray) at 3, 7, and 14 days postintraperitoneal injection of CS-TeTx(HC)-LVGFP [upper left], (B) RGLV [upper right], (C) CS-TeTIM-LVGFP [lower left] and (D) CS-TeTIM-RGLV [lower right]; n = 6 per time point; statistical values are described in the text and Table 2
for LVGFP16 or (2) psPAX2 (helper), pWPI (vector) and pHCMV-RG (envelope) for RGLV (verified through sequencing (not shown) and size determination; Figure 1E). The HABA/avidin assay confirmed effective biotinyation of VSV-G and RG (74 ± 4 and 82 ± 6 mol of biotin per mol of viral glycoprotein, respectively) pseudotyped lentiviruses with uncompromised infectivity found in cultured spinal cord neurons (Figure 1 in the Supporting Information). Functional and Histochemical Correlates of the Onset and Progression of the ALS-like Phenotype in SOD1G93A Mice. SOD1G93A hemizygotes were obtained by crossing B6SJL-Tg (hSOD1G93A) 1Gur/J males carrying the SOD1G93A transgene with C57BL/6 females. Severe motor deficit and ataxia progressed eventually to almost complete incapacitation and weight loss, evident from age of 35 ± 2 weeks; this was defined as the end-point with earliest signs starting with loss of hindlimb reflex from ∼20 ± 2 weeks, consistent with earlier reports.41,42 The latter correlated with the gradual decrease in rotarod performance, commencing around 19 ± 2 weeks for male SOD1G93A mice, which reached statistical significance by 24−26 weeks, followed by a more rapid decline (Figure 2A). Distinctly, no motor deficit was encountered in WT littermates, with rotorod performance time remaining unchanged throughout the entire experimental period (Figure 2A). To ascertain histochemical correlates of progressing motor
deficit, motoneurons and astroglia within L3−L6 segments of the spinal cord were examined with ChAT or Nissl staining (Figure 2B−E) and GFAP immunolabeling, respectively (Figure 2 in the Supporting Information). Although the size or the number of motoneuron in presymptomatic or symptomatic-SOD1G93A did not differ significantly from those of WT littermates, large motoneurons were less prevalent in symptomatic SOD1G93A mice (Figure 2D,E), with a notable fraction appearing shrunk and perikarial enriched with numerous dense inclusions (Figure 2C). Morphometric analysis of astroglia with GFAP immunolabeling revealed notable astrogliosis with greater branching of processes in symptomatic SOD1G93A than in WT controls (8.3 ± 0.45 vs 4.2 ± 0.6 intersection points, p < 0.05, respectively) (Figure 2 in the Supporting Information), perhaps indicating the onset of the degenerative process. Selective Transduction of Central Neurons by Systemic Administration of Targeted LV Vectors. A highly sensitive QPCR assay was utilized to estimate the time course and the level of GFP transcripts in presymptomatic and symptomatic SOD1G93A compared to age-matched WT controls after a single ip injection of targeted LV. The GFP transcript was routinely detected in spinal cord and brain stem from the third day after injection of CS-TeTx(Hc) or CS4200
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Table 2. Fold Change in Values of GFP Transgene Expression after Transcriptome Analysis in CNS Tissue Evaluated from Presymptomatic SOD1G93A Micea spinal cord days PI 3 7 14 brain stem days PI 3 7 14
RGLV
CS-TeTx(Hc)-LVGFP
CS-TeTIM-LVGFP
CS-TeTIM-RGLV
1 ± 0.01 1 ± 0.05 1 ± 0.06
0.90 ± 0.14 0.84 ± 0.10 0.83 ± 0.06
1.27 ± 0.04* 1.64 ± 0.12* 1.35 ± 0.07*
1.40 ± 0.15 2.31 ± 0.09** 1.67 ± 0.08*
1 ± 0.07 1 ± 0.08 1 ± 0.04
0.84 ± 0.09 0.83 ± 0.07 0.96 ± 0.04
1.31 ± 0.04* 1.69 ± 0.08* 1.43 ± 0.05**
1.42 ± 0.03* 2.36 ± 0.07** 2.47 ± 0.01**
a
Lentivirus pseudotyped with various targeting moieties as indicated. Rabies virus glycoprotein pseudotyped lentivirus (RGLV) was used as baseline reference for comparative purposes (mean GFP transcript values as presented in Figure 3 compared using Student’s t-test); p < 0.05 and p < 0.005 indicated by single and double asterisks, respectively. PI = post injection.
Table 3. Fold Change in Values of GFP Transgene Expression after Transcriptome Analysis in CNS Tissue Evaluated from Symptomatic SOD1G93A Micea spinal cord days PI 3 7 14 brain stem days PI 3 7 14
RGLV
CS-TeTx(Hc)-LVGFP
CS-TeTIM-LVGFP
CS-TeTIM-RGLV
1 ± 0.02 1 ± 0.08 1 ± 0.07
0.40 ± 0.01 0.96 ± 0.04 0.31 ± 0.03**
1.33 ± 0.23 1.23 ± 0.02 0.50 ± 0.01**
4.70 ± 0.24* 1.76 ± 0.18 1.15 ± 0.18
1 ± 0.03 1 ± 0.10 1 ± 0.11
0.32 ± 0.01 0.70 ± 0.02 0.47 ± 0.09*
1.20 ± 0.03* 1.37 ± 0.10 0.84 ± 0.02
3.75 ± 0.03 2.32 ± 0.21 1.36 ± 0.03
a
Lentivirus pseudotyped with various targeting moieties as indicated. Rabies virus glycoprotein pseudotyped lentivirus (RGLV) was used as baseline reference for comparative purposes (mean GFP transcript values as presented in Figure 4 compared using Student’s t-test); p < 0.05 and p < 0.005 indicated by single and double asterisks, respectively. PI = post injection.
relatively similar in WT mice injected at either 12 or 22 weeks of age (Figures 3 and 4) unlike presymptomatic and especially symptomatic SOD1G93A mice, which showed a pronounced reduction (Figure 4). Because the same targeted vectors were used for all experiments, this reduction is likely to reflect changes in neuronal processes required for efficient transduction. Indeed, at all data points the expression of the transgene mRNA in spinal cord and brain stem were reduced (Figure 4), although the overall trend in transduction efficiency of individual targeting systems remained relatively consistent with those revealed in WT (Table 3). Notably, significant levels of GFP transcripts was also detectable at later time points in the motor cortex and basal ganglia in symptomatic SOD1G93A mice (being the highest in the motor cortex 14 days postinjection of CSTeTIM-RGLV) but not in presymptomatic or WT mice (Figure 4). Such a paradoxal increase in LV transduction of the motor cortex and basal ganglia with overall reduction of the signal level in the spinal cord and brain stem, perhaps, can be attributed to nonspecific leakage of viral vectors in symptomatic SOD1G93A mice due to the breakdown of the blood brain barrier.44 Hepatic Clearance of Targeted LV Vectors after Single IP Injection. To assess the extent of systemic viral clearance, p24 was measured in liver tissue from animals receiving a single ip LV injection. This viral capsid protein was detected in liver tissue of all animals 24 h postinjection irrespective of the targeting means, with its level being indistinguishable between the 4 groups (Figure 3A in the Supporting Information). The intensity of p24 rapidly declined by 48 h (Figure 3B in the Supporting Information) with no p24 detectable by day 3 post
TeTIM targeted LVGFP, RGLV or dual targeted CS-TeTIMRGLV (Figure 3). CS-TeTIM proved more effective in transduction of LVGFP than CS-TeTx(Hc) in spinal cord and brain stem of WT (p = 0.04 and p < 0.001) and presymptomatic SOD1G93A (p = 0.017 and p = 0.004) mice. Notably, a significant increase in GFP transduction was evident in mice administered dual targeted LV (CS-TeTIM-RGLV) compared with those injected with RGLV (∼40% gain in WT, p = 0.001) or CS-TeTx(Hc)-LVGFP (∼52% gain in WT, p < 0.001) by day 14 (Figure 3A−D), yielding a maximal 1.2 × 105 level of GFP copy number/ GAPDH in spinal cord of WT controls with dual targeting. Likewise, superior GFP transduction was detected in the brain stem and spinal cord of presymptomatic SOD1G93A mice injected with CS-TeTIM-RGLV compared to RGLV (∼40% gain; p = 0.011), CS-TeTIM-LVGFP (∼30%; p = 0.03) or CSTeTx(HC)-LVGFP (∼51%; p = 0.005) in the spinal cord (Figure 3A−D), with levels of reporter transcripts being highest (1 × 105 ± 4 × 103 GFP copies/GAPDH) at 14 days postinjection. Interestingly, the overall transduction efficiency across all data points was notably reduced in presymptomatic SOD1G93A compared to WT mice (Figure 3A−D). Quantitative assessment of all the GFP transcript levels revealed a strong nonlinearity with a trend toward saturation at day 14, consistent with the established pattern of transduction in replicationdeficient viral systems. Considering that VSV-G pseudotyped LV is incapable of retro-axonal transduction of central neurons43 and, hence, was not used for this comparative study, the expression of the GFP transcript targeted by RGLV served as a reference (Table 2 and 3). It is worth stressing that the levels of GFP transcripts in brain stem and spinal cord were 4201
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Figure 4. Compromised transgene expression in symptomatic SOD1G93A mice in comparison to WT littermate controls: histograms of real-time reverse transcriptase QPCR analysis determining GFP copy number, normalized to GAPDH within motor cortex (MC), basal ganglia (BG), brain stem (BS) and lumbar spinal cord (SC) tissue from symptomatic SOD1G93A mice (S-SOD1: black bars) and WT littermate controls (gray) at 3, 7, and 14 days postintraperitoneal injection of CS-TeTx(HC)-LVGFP [upper left], (B) RGLV [upper right], (C) CS-TeTIM-LVGFP [lower left] and (D) CS-TeTIM-RGLV [lower right]; n = 6 per time point; statistical values described in the text and Table 3.
in symptomatic SOD1G93A mice yielded very poor transduction and expression of the reporter in mice injected with CSTeTIM-RGLV (Figure 5D), a result that is consistent perhaps with compromised axonal transport in symptomatic SOD1G93A mice.45 Accordingly, intrathecal injection of RGLV particles yielded similar transcript levels in the spinal cord tissue at the site of injection (4.2 ± 0.7 × 106 vs 3.9 ± 0.6 × 106 GFP copy/ GAPDH in presymptomatic and symptomatic SOD1G93A, respectively), consistent with uncompromised transduction of spinal cord neurons with lentiviral vectors.
injection (not shown). Interestingly, QPCR revealed significant but transient GFP expression in liver only in mice that received LVGFP pseudotyped with VSV-G, perhaps, contributed by its broader tropism. Indeed, high numbers of transcripts were detected at 48 h after injection (1.7 × 103 ± 102 GFP copies/ GAPDH), with levels rapidly declining (82 ± 4% decrease) by day 14 (not shown). Retro-Axonal Transduction with Expression of the Reporter Gene in Motoneurons of Spinal Cord and Brain-Stem via Dual LV Targeting. Confocal microscopic evidence was sought to address the specificity of the transduction based on expression of the reporter protein in motoneurons of WT and SOD1G93A mice. Two weeks after a single ip injection of CS-TeTIM-RGLV, GFP expression was evident in both large and smallputative α- and γmotoneuronsin spinal cord anterior horn and motor nuclei of the brain stem of both WT and presymptomatic SOD1G93A mice (n = 4), where it localized within anti-ChAT immunofluorescent labeled motoneurons (Figure 5A−D). Weaker GFP expression was also evident in mice injected with RGLV or CS-TeTIM-LVGFP unlike those injected with CS-TeTx(Hc)-LVGFP, which showed an even further decrease in the reporter levels, suggesting dual lentiviral targeting as a method of choice for transduction of viral vectors to motoneurons before motor deficit onset. Similar experiments
■
DISCUSSION
This report introduces and validates a novel dual CS-TeTIMRG targeting of LV vectors to motoneurons in vivo. It combines the exquisite neurotropism and capacity for retro-axonal trafficking of both full-length detoxified TeTx (TeTIM) and RG, the aim being to ensure specific expression of a GFP reporter in brain stem and spinal cord motor nuclei following systemic administration of targeted LVs. Improved transduction by CS-TeTIM-RGLV compared to RGLV or TeTx(Hc)LVGFP not only provides proof-of-concept but also exemplifies a major advance in acquiring the means for direct, but noninvasive, interference with the proteome and transcriptome of motoneurons. 4202
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
Figure 5. Green fluorescence protein in motoneurons of the lumbar spinal cord and brainstem after intraperitoneal administration of CS-TeTIMRGLV to SOD1G93A mice. (A) Presymptomatic SOD1G93A mice representative brain stem section (35 μm) immunostained with anti-ChAT (left; red) and anti-GFP (middle green); note the anti-ChAT positive cells of the oral subnucleus (Sp50; right; red) and the presence of transgene product GFP (middle; green) and their colocalization (right; yellow [green and red merge]). (B, C) Representative lumbar spinal cord (L3) sections (35 μm) immunostained with anti-ChAT (left; red) for identification of motoneurons within the anterior horn and anti-GFP for presence of transgene product GFP (middle; green); note colocalization of GFP and ChAT (right; yellow [green and red merge]). Low and high magnification images shown (B and C, respectively); D and M refer to dorsal and medial. (D) Symptomatic SOD1G93A mice representative lumbar spinal cord (L3) section (35 μm) immunostained as above (in B). Note the highly diminished GFP signal (middle; green) and in merged view (right).
with astounding success for gene therapy in murine models of ALS and spinal muscular atrophy,20,22 the outcome of this approach in clinical trials has not been encouraging, perhaps, due to longer distances and greater transduction capacities required in humans. Indeed, unlike the relatively short motor axons in mice, these extend more than a meter in length in humans, yielding a cell volume ∼5000 times that typical for an animal neuron, almost all of which is in the axon.57 An alternative approach for motoneuron targeting with retrograde transduction utilizes bacterial neurotoxins. The assumption that vaccination precludes the clinical usage of tetanus toxin has been refuted 58,59 but may rather enhance its safety criteria.15,60,61 This approach exploited the outstanding neuron recognition capacity of these natural assailants which was continued with TeTx(HC).62,63 The results of its use in
LVs are the vehicles of choice for gene transfer to neurons due to their capacity to transduce vectors in slowly or nondividing cells. 46 The extremely low occurrence of replication-competent retroviruses,47,48 together with the lack of expression of viral genes,49 renders LVs safe for potential clinical use. Other advantages include their large cloning capacity50 and suitability for host range expansion through pseudotyping51 which warrants usage flexibility. Although widely utilized VSV-G pseudotyping endows LVs with increased stability,52,53 it also subsequently introduces a broad tropism and limits LV action to the injection site, hampering their use for transduction of specific cell types.54,55 To overcome this, a large number of viral envelopes have been appraised,50,56 with rabies G-protein pseudotyping being the most advantageous for neuronal targeting. Despite being used 4203
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
given the failure of current therapeutic interventions in ALS patients, the novel targeting means introduced herein in addition to their potential significance for basic research may provide a much needed scaffold for effective and noninvasive interference with the genome and proteome of motoneurons.
preclinical tests, like those with RGLV targeting, while promising in model animal systems, were also rather disappointing.15,64 Notwithstanding the significant potential of RG- or TeTx(HC)-based neuron targeting, these studies have highlighted the considerable inherent limitations, stressing the urgent need for effective methods for selective and efficient transfer of viral or nonviral therapeutics into motoneurons. The much improved transduction of GFP in the brain stem and spinal cord by CS-TeTIM-LV, and especially CS-TeTIMRGLV shown herein, provides a significant step forward in this direction. Advantageously, CS, the core of streptavidin used as a linker, with enhanced structural stability and less prone to aggregation,18 enables viable delivery of covalently attached biotinylated LV, offering great potential for transfer of a wide range of viral as well as nonviral vehicles and cargo.16,17 While results with CS-TeTIM targeting emphasize the relevance of additional domains within TeTx (along with HC) for effective neuronal recognition14,15,65 and retro-axonal delivery (greater performance of CS-TeTIM for lentiviral CNS delivery compared herein to CS-TeTx(HC)), as suggested, our findings of improved transfection with CS-TeTIM-RGLV are likely to reflect the synergistic action of RG and TeTIM, promoting neuronal uptake with retrograde transduction. Despite several proteins being implicated as acceptors for RG binding to neurons,66,67 the high-affinity protein receptor for TeTx at motor nerve endings remains to be identified.68,69 Importantly, translation of the reporter delivered with dual targeting in both brain stem and spinal cord is restricted to motoneurons without trans-synaptic spread. It should be highlighted that as both fast and slow axonal transport are affected in SOD1G93A, the decrease in reporter levels in what are considered to be presymptomatic and symptomatic stages of ALS in SOD1G93A, shown herein, is not surprising.45,70 Nevertheless, the overall pattern of transduction across different experimental groups remained consistent with those seen in controls, with dual, CSTeTIM-RGLV targeting proving the most effective. In both presymptomatic and symptomatic but not WT mice considerable levels of transcripts were also revealed in the motor cortex and basal ganglia, in addition to the brain stem and spinal cord. In light of the absence of direct projections from these structures to the periphery, the latter might result from disruption of the vascular integrity, permitting the leakage of the vectors from the bloodstream into the brain parenchyma.44,71 Such an interpretation is in agreement with earlier reports, which demonstrated that, following systemic administration, TeTx(HC) could be detected in several brain regions of ALS-like mice, while in WT its presence was restricted to the brain stem and spinal cord, as a result of being retrogradely transported along peripheral motor nerve axons.72,73 The ultimate aim of this study was to develop a tool for efficient noninvasive transfer of viral vectors from the periphery to motoneurons. Previous animal models of motorneuron disease (SOD1, wobbler, progressive motor neuropathy, spinal muscle atrophy etc.) have shown that substantial therapeutic benefits can be achieved with mutant SOD1-targeted RNAi,20 VEGF,74 NT-3,75 GDNF,76,77 IGF-1,19 Bcl-278 or cardiotrophin-1.79 Clinical translation of some of these proteins has not yielded similar efficacy in human ALS patients, perhaps arising from poor motoneuron accessibility with low efficiency of delivery.75,80 Our comparative QPCR data and confocal microscopy reveal greater transduction competence of dual CS-TeTIM-RGLV and CS-TeTIM targeted lentivirus compared to that of TeTx(HC) binding domain and RG. Hence,
■
ASSOCIATED CONTENT
S Supporting Information *
Figures depicting transduction of spinal cord neurons following exposure to pseudotyped biotinylated lentivirus, astrocyte morphometric measurement, viral capsid protein (p24) detected in liver postinjection of lentivirus in mice, and distribution of the GFP expression in mouse spinal cord following ip injection of CS-TeTIM targeted lenti-GFP: low magnification micrograph. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Authors
*V.B.O.: e-mail,
[email protected]; tel, +49 89 3187 2647; fax, +49 89 3187 3381. *J.O.D.: e-mail,
[email protected]; tel, +353 1 700 7757; fax, +353 1 7007758. Author Contributions
V.B.O. and S.V.O. contributed equally. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This study was supported by USAMRIID (Grant Number HDTRA1-07-C-0034) and a Research Professorship plus Principal Investigator award to Prof. J. O. Dolly from Science Foundation Ireland. In addition, we wish to acknowledge the Programme for Research in Third Level Institutions (PRTLI) Cycle 4 from the Higher Education Authority of Ireland for the Neuroscience section of Target-Driven Therapeutics and Theranostics for supporting Dr. Saak Ovsepian. We are grateful to Mr. Liam Ryan for technical assistance and Dr. Tom Zurawski for conducting the LD50 assays.
■
ABBREVIATIONS USED BSA, bovine serum albumin; CaCl, calcium chloride; ChAT, choline acetyltransferase; CNS, central nervous system; CS, core-streptavidin; Ct, threshold cycle; DAPI, 4′,6-diamidino-2phenylindole; DC, dichain; DNA, deoxyribonucleic acid; EDTA, ethylenediaminetetraacetic acid; fALS, familial amyotrophic lateral sclerosis; GAPDH, glyceraldehyde phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; GFP, green fluorescent protein; GST, glutathione synthase transferase; HC, tetanus toxin heavy chain binding domain; HCl, hydrogen chloride; h, hours; IMAC, immobilized metal affinity chromatography; kDa, kilodaltons; LV, lentivirus; NaCl, sodium chloride; PBS, phosphate buffered saline; PCR, polymerase chain reaction; PFA, paraformaldehyde; PI, postinjection; PMSF, phenylmethanesulfonyl fluoride; PS-SOD1, presymptomatic superoxide dismutase 1; QPCR, quantitative polymerase chain reaction; RGLV, rabies glycoprotein pseudotyped lentivirus; RT, room temperature; SDS−PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; SNARE, soluble NSF (N-ethylmaleimide sensitive fusion protein) attachment protein receptor; SOD1, superoxide dismutase 1; S-SOD1, symptomatic superoxide dismutase 1; 4204
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
the nervous system after peripheral delivery. Hum. Mol. Genet. 2001, 10, 2109−21. (22) Azzouz, M.; et al. Lentivector-mediated SMN replacement in a mouse model of spinal muscular atrophy. J. Clin. Invest. 2004, 114, 1726−31. (23) Mentis, G. Z.; et al. Transduction of motor neurons and muscle fibers by intramuscular injection of HIV-1-based vectors pseudotyped with select rabies virus glycoproteins. J. Neurosci. Methods 2006, 157, 208−17. (24) Pahler, A.; Hendrickson, W. A.; Kolks, M. A.; Argarana, C. E.; Cantor, C. R. Characterization and crystallization of core streptavidin. J. Biol. Chem. 1987, 262, 13933−7. (25) Hemsley, A.; Arnheim, N.; Toney, M. D.; Cortopassi, G.; Galas, D. J. A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res. 1989, 17, 6545−51. (26) Li, Y.; et al. A single mutation in the recombinant light chain of tetanus toxin abolishes its proteolytic activity and removes the toxicity seen after reconstitution with native heavy chain. Biochemistry 1994, 33, 7014−20. (27) Studier, F. W. Protein production by auto-induction in high density shaking cultures. Protein Expression Purif. 2005, 41, 207−34. (28) Sena-Esteves, M.; Tebbets, J. C.; Steffens, S.; Crombleholme, T.; Flake, A. W. Optimized large-scale production of high titer lentivirus vector pseudotypes. J. Virol. Methods 2004, 122, 131−9. (29) Boussif, O.; et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 7297−301. (30) Moore, J. P.; McKeating, J. A.; Weiss, R. A.; Sattentau, Q. J. Dissociation of gp120 from HIV-1 virions induced by soluble CD4. Science 1990, 250, 1139−42. (31) Green, N. M.; Toms, E. J. Purification and crystallization of avidin. Biochem. J. 1970, 118, 67−70. (32) Choi, C. I.; et al. Effects of estrogen on lifespan and motor functions in female hSOD1 G93A transgenic mice. J. Neurol. Sci. 2008, 268, 40−7. (33) Zangala, T. Isolation of genomic DNA from mouse tails. J. Visualized Exp. 2007, DOI: 10.3791/246 . (34) Leitner, M.; Menzies, S.; Lutz, C. Working with ALS mice Guidelines for preclinical testing and colony management; The Jackson Laboratory: Bar Harbor, ME, and Prize4Life, Inc.: Cambridge, MA, 2009. (35) Crawley, J. N. Behavioral phenotyping strategies for mutant mice. Neuron 2008, 57, 809−18. (36) Culling, C. F. A.; Allison, R. T.; Barr, W. T. Cellular Pathology Technique; Butterworths: London, 1985. (37) Daniel-Christoph, W.; et al. Object-based analysis of astroglial reaction and astrocyte subtype morphology after ischemic brain injury. Acta Neurobiol. Exp. 2012, 73, 79−87. (38) Sholl, A.; Uttley, A. M. Pattern discrimination and the visual cortex. Nature 1953, 171, 387−8. (39) Raghunath, A.; Perez-Branguli, F.; Smith, L.; Dolly, J. O. Adenoassociated virus transfer of a gene encoding SNAP-25 resistant to botulinum toxin A attenuates neuromuscular paralysis associated with botulism. J. Neurosci. 2008, 28, 3683−8. (40) Brewis, N.; et al. Evaluation of VP22 spread in tissue culture. J. Virol. 2000, 74, 1051−6. (41) Veldink, J. H.; et al. Sexual differences in onset of disease and response to exercise in a transgenic model of ALS. Neuromuscular Disord. 2003, 13, 737−43. (42) Wooley, C. M.; et al. Gait analysis detects early changes in transgenic SOD1(G93A) mice. Muscle Nerve 2005, 32, 43−50. (43) Federici, T.; et al. Comparative analysis of HIV-1-based lentiviral vectors bearing lyssavirus glycoproteins for neuronal gene transfer. Genet. Vaccines Ther. 2009, 7, 1. (44) Garbuzova-Davis, S.; et al. Evidence of compromised bloodspinal cord barrier in early and late symptomatic SOD1 mice modeling ALS. PLoS One 2007, 2, e1205. (45) Bilsland, L. G.; et al. Deficits in axonal transport precede ALS symptoms in vivo. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 20523−8.
TBS-T, tris-buffered saline with Triton X-100; TeTIM, proteolytically inactive mutant of full-length tetanus toxin; TeTx, tetanus toxin; VAMP-2, vesicle-associated membrane protein 2; VSV-G, vesicular stomatitis virus glycoprotein; WT, wild-type
■
REFERENCES
(1) Logroscino, G.; et al. Descriptive epidemiology of amyotrophic lateral sclerosis: new evidence and unsolved issues. J. Neurol., Neurosurg. Psychiatry 2008, 79, 6−11. (2) Siddique, T. & Deng, H. X. Genetics of amyotrophic lateral sclerosis. Hum. Mol. Genet. Spec No. 1996, 5, 1465−70. (3) Gould, T. W.; Oppenheim, R. W. Motor neuron trophic factors: therapeutic use in ALS? Brain Res. Rev. 2011, 67, 1−39. (4) Valentine, J. S.; Doucette, P. A.; Zittin Potter, S. Copper-zinc superoxide dismutase and amyotrophic lateral sclerosis. Annu. Rev. Biochem. 2005, 74, 563−93. (5) Ferraiuolo, L.; Kirby, J.; Grierson, A. J.; Sendtner, M.; Shaw, P. J. Molecular pathways of motor neuron injury in amyotrophic lateral sclerosis. Nat. Rev. Neurol. 2011, 7, 616−30. (6) Gowing, G.; Svendsen, C. N. Stem cell transplantation for motor neuron disease: current approaches and future perspectives. Neurotherapeutics 2011, 8, 591−606. (7) Contestabile, A. Amyotrophic lateral sclerosis: from research to therapeutic attempts and therapeutic perspectives. Curr. Med. Chem. 2011, 18, 5655−65. (8) Gurney, M. E.; et al. Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 1994, 264, 1772−5. (9) Calvo, A. C.; et al. Lack of a synergistic effect of a non-viral ALS gene therapy based on BDNF and a TTC fusion molecule. Orphanet J. Rare Dis. 2011, 6, 10. (10) Turner, B. J.; Talbot, K. Transgenics, toxicity and therapeutics in rodent models of mutant SOD1-mediated familial ALS. Prog. Neurobiol. 2008, 85, 94−134. (11) Williamson, T. L.; Cleveland, D. W. Slowing of axonal transport is a very early event in the toxicity of ALS-linked SOD1 mutants to motor neurons. Nat. Neurosci. 1999, 2, 50−6. (12) Zhang, B.; Tu, P.; Abtahian, F.; Trojanowski, J. Q.; Lee, V. M. Neurofilaments and orthograde transport are reduced in ventral root axons of transgenic mice that express human SOD1 with a G93A mutation. J. Cell Biol. 1997, 139, 1307−15. (13) Ciriza, J.; et al. A genetic fusion GDNF-C fragment of tetanus toxin prolongs survival in a symptomatic mouse ALS model. Restor. Neurol. Neurosci. 2008, 26, 459−65. (14) Li, Y.; et al. Recombinant forms of tetanus toxin engineered for examining and exploiting neuronal trafficking pathways. J. Biol. Chem. 2001, 276, 31394−401. (15) Fishman, P. S. Tetanus Toxin. In Botulinum Toxin: therapeutic clinical practice and science; Saunders Elsevier: 2009; pp 406−24. (16) O’Leary, V. B.; et al. Innocuous full-length botulinum neurotoxin targets and promotes the expression of lentiviral vectors in central and autonomic neurons. Gene Ther. 2011, 18, 656−65. (17) Edupuganti, O. P.; et al. Targeted delivery into motor nerve terminals of inhibitors for SNARE-cleaving proteases via liposomes coupled to an atoxic botulinum neurotoxin. FEBS J. 2012, 279, 2555− 67. (18) Sano, T.; Vajda, S.; Cantor, C. R. Genetic engineering of streptavidin, a versatile affinity tag. J. Chromatogr., B: Biomed. Sci. Appl. 1998, 715, 85−91. (19) Kaspar, B. K.; Llado, J.; Sherkat, N.; Rothstein, J. D.; Gage, F. H. Retrograde viral delivery of IGF-1 prolongs survival in a mouse ALS model. Science 2003, 301, 839−42. (20) Ralph, G. S.; et al. Silencing mutant SOD1 using RNAi protects against neurodegeneration and extends survival in an ALS model. Nat. Med. 2005, 11, 429−33. (21) Mazarakis, N. D.; et al. Rabies virus glycoprotein pseudotyping of lentiviral vectors enables retrograde axonal transport and access to 4205
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
Molecular Pharmaceutics
Article
(46) Jakobsson, J.; Lundberg, C. Lentiviral vectors for use in the central nervous system. Mol. Ther. 2006, 13, 484−93. (47) Zufferey, R.; Nagy, D.; Mandel, R. J.; Naldini, L.; Trono, D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 1997, 15, 871−5. (48) Dull, T.; et al. A third-generation lentivirus vector with a conditional packaging system. J. Virol. 1998, 72, 8463−71. (49) Naldini, L.; Blomer, U.; Gage, F. H.; Trono, D.; Verma, I. M. Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 11382−8. (50) Waehler, R.; Russell, S. J.; Curiel, D. T. Engineering targeted viral vectors for gene therapy. Nat. Rev. Genet. 2007, 8, 573−87. (51) Watson, D. J.; Kobinger, G. P.; Passini, M. A.; Wilson, J. M.; Wolfe, J. H. Targeted transduction patterns in the mouse brain by lentivirus vectors pseudotyped with VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins. Mol. Ther. 2002, 5, 528−37. (52) Kordower, J. H.; et al. Lentiviral gene transfer to the nonhuman primate brain. Exp. Neurol. 1999, 160, 1−16. (53) Baekelandt, V.; et al. Characterization of lentiviral vectormediated gene transfer in adult mouse brain. Hum. Gene Ther. 2002, 13, 841−53. (54) Jakobsson, J.; Ericson, C.; Jansson, M.; Bjork, E.; Lundberg, C. Targeted transgene expression in rat brain using lentiviral vectors. J. Neurosci. Res. 2003, 73, 876−85. (55) Jakobsson, J.; Rosenqvist, N.; Thompson, L.; Barraud, P.; Lundberg, C. Dynamics of transgene expression in a neural stem cell line transduced with lentiviral vectors incorporating the cHS4 insulator. Exp. Cell Res. 2004, 298, 611−23. (56) Georgievska, B.; et al. Regulated delivery of glial cell line-derived neurotrophic factor into rat striatum, using a tetracycline-dependent lentiviral vector. Hum. Gene Ther. 2004, 15, 934−44. (57) Williamson, T. L.; et al. Neurofilaments, radial growth of axons, and mechanisms of motor neuron disease. Cold Spring Harbor Symp. Quant. Biol. 1996, 61, 709−23. (58) Fishman, P. S.; Matthews, C. C.; Parks, D. A.; Box, M.; Fairweather, N. F. Immunization does not interfere with uptake and transport by motor neurons of the binding fragment of tetanus toxin. J. Neurosci. Res. 2006, 83, 1540−3. (59) Fezza, J. P.; Wiley, H. J.; Wesley, R.; Klippenstein, R. E.; Dettbarn, K. W. The effects of tetanus toxin on the orbicularis oculi muscle. Ophthalmic Plast. Reconstr. Surg. 2002, 16, 101−113. (60) Scott, A. B. Antitoxin reduces botulinum side effects. Eye (London) 1988, 2 (Part 1), 29−32. (61) Wiley, R. G.; Oeltmann, T. N. Anti-ricin antibody protects against systemic toxicity without affecting suicide transport. J. Neurosci. Methods 1989, 27, 203−9. (62) Gill, D. M. Bacterial toxins: a table of lethal amounts. Microbiol. Rev. 1982, 46, 86−94. (63) Schwab, M. E.; Suda, K.; Thoenen, H. Selective retrograde transsynaptic transfer of a protein, tetanus toxin, subsequent to its retrograde axonal transport. J. Cell Biol. 1979, 82, 798−810. (64) Francis, J. W.; Ren, J.; Warren, L.; Brown, R. H., Jr.; Finklestein, S. P. Postischemic infusion of Cu/Zn superoxide dismutase or SOD:Tet451 reduces cerebral infarction following focal ischemia/ reperfusion in rats. Exp. Neurol. 1997, 146, 435−43. (65) Wang, J.; et al. Novel chimeras of botulinum and tetanus neurotoxins yield insights into their distinct sites of neuroparalysis. FASEB J. 2012, 26, 5035−48. (66) Cronin, J.; Zhang, X. Y.; Reiser, J. Altering the tropism of lentiviral vectors through pseudotyping. Curr. Gene Ther. 2005, 5, 387−98. (67) Tuffereau, C.; Benejean, J.; Blondel, D.; Kieffer, B.; Flamand, A. Low-affinity nerve-growth factor receptor (P75NTR) can serve as a receptor for rabies virus. EMBO J. 1998, 17, 7250−9. (68) Herreros, J.; Ng, T.; Schiavo, G. Lipid rafts act as specialized domains for tetanus toxin binding and internalization into neurons. Mol. Biol. Cell 2001, 12, 2947−60.
(69) Yeh, F. L.; et al. SV2 mediates entry of tetanus neurotoxin into central neurons. PLoS Pathog. 2010, 6, e1001207. (70) De Vos, K. J.; et al. Familial amyotrophic lateral sclerosis-linked SOD1 mutants perturb fast axonal transport to reduce axonal mitochondria content. Hum. Mol. Genet. 2007, 16, 2720−8. (71) Ay, I.; Francis, J. W.; Brown, R. H., Jr. VEGF increases bloodbrain barrier permeability to Evans blue dye and tetanus toxin fragment C but not adeno-associated virus in ALS mice. Brain Res. 2008, 1234, 198−205. (72) Bizzini, B.; Stoeckel, K.; Schwab, M. An antigenic polypeptide fragment isolated from tetanus toxin: chemical characterization, binding to gangliosides and retrograde axonal transport in various neuron systems. J. Neurochem. 1977, 28, 529−42. (73) Fishman, P. S.; Carrigan, D. R. Motoneuron uptake from the circulation of the binding fragment of tetanus toxin. Arch. Neurol. 1988, 45, 558−61. (74) Azzouz, M.; et al. VEGF delivery with retrogradely transported lentivector prolongs survival in a mouse ALS model. Nature 2004, 429, 413−7. (75) Haase, G.; et al. Gene therapy of murine motor neuron disease using adenoviral vectors for neurotrophic factors. Nat. Med. 1997, 3, 429−36. (76) Keir, S. D.; Xiao, X.; Li, J.; Kennedy, P. G. Adeno-associated virus-mediated delivery of glial cell line-derived neurotrophic factor protects motor neuron-like cells from apoptosis. J. Neurovirol. 2001, 7, 437−46. (77) Acsadi, G.; et al. Increased survival and function of SOD1 mice after glial cell-derived neurotrophic factor gene therapy. Hum. Gene Ther. 2002, 13, 1047−59. (78) Azzouz, M.; et al. Increased motoneuron survival and improved neuromuscular function in transgenic ALS mice after intraspinal injection of an adeno-associated virus encoding Bcl-2. Hum. Mol. Genet. 2000, 9, 803−11. (79) Bordet, T.; et al. Protective effects of cardiotrophin-1 adenoviral gene transfer on neuromuscular degeneration in transgenic ALS mice. Hum. Mol. Genet. 2001, 10, 1925−33. (80) Alisky, J. M.; Davidson, B. L. Gene therapy for amyotrophic lateral sclerosis and other motor neuron diseases. Hum. Gene Ther. 2000, 11, 2315−29.
4206
dx.doi.org/10.1021/mp400247t | Mol. Pharmaceutics 2013, 10, 4195−4206
