Inhibition of Influenza Virus Infections by Sialylgalactose-Binding

Jun 26, 2009 - Teruhiko Matsubara , Ryohei Otani , Miki Yamashita , Haruka Maeno , Hanae Nodono , and Toshinori Sato. Biomacromolecules 2017 18 (2), ...
0 downloads 0 Views 4MB Size
Download PDF
J. Med. Chem. 2009, 52, 4247–4256 4247 DOI: 10.1021/jm801570y

Inhibition of Influenza Virus Infections by Sialylgalactose-Binding Peptides Selected from a Phage Library Teruhiko Matsubara,† Machiko Sumi,† Hiroyuki Kubota,† Takao Taki,‡ Yoshio Okahata,§ and Toshinori Sato*,† †

Department of Biosciences and Informatics, Keio University, 3-14-1 Hiyoshi, Kouhoku-ku, Yokohama 223-8522, Japan, ‡Molecular Medical Science Institute, Otsuka Pharmaceutical Co. Ltd., 463-10 Kagasuno, Kawauchi, Tokushima 771-0192, Japan, and §Department of Biomolecular Engineering, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501, Japan Received December 11, 2008

Influenza virus hemagglutinin recognizes sialyloligosaccharides of glycoproteins and glycolipids as cell surface receptors in the initial stage of the infection process. We demonstrate that pentadecapeptides that bind to a sialylgalactose structure (Neu5Ac-Gal) inhibited the infection of cells by influenza virus. The pentadecapeptides were identified through affinity selection from a phage-displayed random peptide library using a monolayer of the ganglioside Neu5AcR2-3Galβ1-4Glcβ1-10 Cer (GM3). The peptides were found to have affinity for GM3, and alanine scanning showed seven amino acid residues that contribute to carbohydrate recognition. The binding of peptides to the cell surface was significantly inhibited in the presence of sialic acid or by the digestion of cell surface sialyl residues by neuraminidase. Plaque assays indicated that a molecular assembly of alkylated peptides inhibited the infection of Madin-Darby canine kidney cells by influenza virus. Carbohydrate-binding peptides that inhibit carbohydrate-virus interaction showed inhibitory activity. These results may lead to a new approach to the design of antiviral drugs.

*To whom correspondence should be addressed. Phone: þ81-45-5661771. Fax: þ81-45-566-1447. E-mail: [email protected]. a Abbreviations: HA, hemagglutinin; NA, neuraminidase; Glc, glucose; GlcU, glucuronic acid; Gal, galactose; Neu5Ac, N-acetylneuraminic acid; Cer, ceramide; GM3, Neu5AcR2-3Galβ1-4Glcβ1-10 Cer; 60 GM3, Neu5AcR2-6Galβ1-4Glcβ1-10 Cer; GalCer, Galβ1-10 Cer; GlcCer, Glcβ1-10 Cer; BSA, bovine serum albumin; tris, tris(hydroxymethyl)aminomethane; TBS, tris-buffered saline; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; FITC, fluorescein isothiocyanate; TU, transducing unit; pfu, plaque-forming unit; QCM, quartz-crystal microbalance; ΔF, frequency change; ΔA, absorbance change; Kd, dissociation constant; ΔFmax, maximum amount; CLSM, confocal laser scanning microscopy; NPN, N-phenyl1-naphthylamine; cmc, critical micelle concentration; MDCK, MadinDarby canine kidney; IC50, 50% inhibitory concentration; WGA, wheat-germ agglutinin.

equine strains bind to the terminal Neu5AcR2-3Gal structure.6,7 It was found that a switch in receptor specificity from Neu5AcR2-3Gal (avian) to Neu5AcR2-6Gal (human) is achieved by the mutation of one or two amino acids of the Neu5Ac-binding site of HA.8,9 Antiviral therapy in addition to vaccination is effective at preventing influenza.10 Antiviral drugs are designed to inhibit each step of the virus life cycle involving replication and budding: amantadine and rimantadine are M2 protein inhibitors; ribavirin is a replication inhibitor;10 oseltamivir11 and zanamivir12 are neuraminidase inhibitors for blocking of virus budding. However, no HA inhibitor has been put to practical use. The objective of the present study is development of novel drug that interferes with the interaction between HA of influenza virus and glycoconjugate receptors on cells. There are two strategies for blocking the attachment of a virus to the target cell. One is the blocking of the sugar-binding site of HA by peptides13 or Neu5Ac-containing derivatives.14-17 Sato et al. identified HA-binding (sugar replica) peptides by using the phage-display system and showed inhibitory activity of the peptides for viral infections.13 Inhibitory activities of Neu5Acmodified polymers,14 dendrimers,15,16 and lipids17 have been reported. These compounds bound to the Neu5Ac-binding site of HA and resulted in the inhibition of HA-Neu5Ac interaction. However, since a sugar-binding domain is not identical to those of all subtypes, it may be hard to obtain molecules that have affinity for all types of HA.18 The utilization of sugar-binding molecules would be another strategy for the development of inhibitors for influenza virus infection because the Neu5Ac-Gal structure as a HA receptor showed no change for any HA strain. In fact, many carbohydrate-binding proteins, such as lectins19,20 and antibodies,21

r 2009 American Chemical Society

Published on Web 06/26/2009

Introduction Influenza virus is a negative-sense single-stranded RNA virus of the family Orthomyxoviridae.1 There are three different genera of influenza virus, types A, B, and C. Type A is highly mutagenic and causes epidemics and pandemics. The virus is classified into subtypes based on the major antigenic specificity of two envelope glycoproteins, hemagglutinin (HAa) and neuraminidase (NA). Sixteen HA subtypes (H1-H16) and nine NA subtypes (N1-N9) have been identified for type A.2 Three HA subtypes (H1, H2, and H3) and two NA subtypes (N1 and N2) were identified among human epidemics and pandemics so far. The first step in the infection of cells by influenza virus is the binding of HA to sialic acid (Neu5Ac)-containing glycoconjugates.3 HA distinguishes the differences in the linkage (R2-3 or R2-6) of Neu5Ac to Gal on the host cells.4,5 Human HA strains preferentially bind to the terminal Neu5AcR2-6Gal structure that is found on the surface of some tracheal epithelial cells, whereas avian and

pubs.acs.org/jmc

4248 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14

have been applied in therapy for carbohydrate-related diseases.22 Galactose-binding Ricinus communis (RCA120) lectin and the corresponding sugar-binding domains inhibit rotavirus infections of MA104 cells (IC50 of 0.6 ng/mL for RCA120).19 Wheat-germ agglutinin (WGA) was examined for inhibitory activity against infections with human T-cell leukemia virus type I.20 We previously identified ganglioside GM1-binding pentadecapeptides by using a phage library in combination with an air-water interface lipid monolayer.23 The peptides obtained inhibit the binding of cholera toxin B subunit to GM1 with an IC50 of 1.0 μM. However, the interaction between peptides and glycoconjugates on the actual cell surface has yet to be revealed. In the present study, we identified sialylgalactose-binding peptides in a phage library with a ganglioside Neu5AcR2-3Galβ1-4Glcβ110 Cer (GM3) monolayer. Two individual clones were isolated, and the interaction of selected peptide sequences with glycolipids or animal cells was investigated. Synthetic peptides bound to the surface of Madin-Darby canine kidney (MDCK) cells, and the corresponding alkylated peptides inhibited the infection of the cells by the influenza virus. These results suggested that carbohydrate-binding peptides are potential inhibitors of the influenza virus. To the best of our knowledge, this is the first report of a carbohydrate-binding peptide that inhibited influenza virus infections. Results Selection of GM3-Binding Peptides. To obtain sialylgalactose-binding peptides, selection using a phage library method combined with a GM3 monolayer at an air-water interface was carried out as described previously.23 GM3 has Neu5AcR2-3Gal at the nonreducing terminal (Figure 1A). GM3-binding phages were enriched through four rounds of affinity selection. The relative yield of the collected phages increased from 0.2106 to 15106 transducing units (TU). Binding of the selected phages to GM3 was confirmed by a 9 MHz quartz-crystal microbalance (QCM) method.5,24 The frequency decreases (ΔF, Hz) of the QCM responding to the addition of phages (1010 TU/mL) in trisbuffered saline (TBS) were followed with time (Figure 1B). ΔF at equilibrium (10 min) showed that the amount of bound phages (26 Hz) was 6.5 times that of a phage library (4 Hz). Twenty-seven clones of the GM3-binding phages were isolated, and DNA sequences of the phage clones were identified. The deduced amino acid sequences of the external random region indicated seven types of 15-mer sequence as shown in Table 1. A c01 clone was found at the highest frequency (15 copies from 27 isolated clones), and a c03 clone was also found at high frequency (7 from 27 clones). Affinity Screening by Enzyme-Linked Immunosorbent Assay (ELISA). Binding of the isolated phage clones to GM3 was evaluated by phage ELISA. The phage clones interacted with the GM3 monolayer transferred onto a plastic plate in a 24-well plate. The amount of phage bound to GM3 was detected as absorbance change (ΔA) at 492 nm. The relative amount is the ratio of ΔA of a clone to that of a control phage (wild-type fd phage). The binding of the phage clones was c01 >c15, c30, c03, c21>c11, c07 (Table 1). The major clone c01 showed the greatest binding to GM3, and the binding depended on the concentration of phage (Figure 2A). Alanine Scanning Mutagenesis of c01 Peptide. To identify essential amino acid residues for the binding of c01 peptide to GM3, site-directed mutagenesis was performed by changing

Matsubara et al.

Figure 1. Affinity selection of peptides with GM3. (A) Chemical structure of the ganglioside GM3: Glc, glucose; Gal, galactose; Neu5Ac, N-acetylneuraminic acid; Cer, ceramide. (B) Time course of phage binding to GM3 monolayer immobilized on QCM electrode. Closed circles indicate the phages obtained in the fourth round of selection with the GM3 monolayer, and open circles indicate a primary phage library. The GM3 monolayer was attached to the surface of a 9 MHz QCM gold electrode, and the QCM tip was immersed into 1 mL of TBS (pH 7.5). The phage solution containing 6  1010 TU was injected into the buffer, and ΔF responding to phage binding was plotted against time. The final phage concentration was 2 nM. Table 1. Peptide Sequences of Isolated Phage Clones after Four Rounds of Affinity Selection against GM3 clone no.

peptide sequencea

frequencyb

relative bindingc

c01 c03 c15 c30 c21 c11 c07 fd

GWWYKGRARPVSAVA RAVWRHSVATPSHSV LWRPVLFHSAVRALG WRGVYFGDRWLGSQP GWYSSRHYVRSLNGL QQLVYNWWAVSSARR LSWPLHAGRGFRWVS

15/27 7/27 1/27 1/27 1/27 1/27 1/27

2.1 ( 0.6 1.5 ( 0.7 1.7 ( 0.3 1.6 ( 0.4 1.4 ( 0.3 1.1 ( 0.6 0.9 ( 0.4 1.0

a Deduced amino acid sequences. b The number of isolated phage clones. c ΔA/ΔAfd ratio by ELISA at [phage]=0.5 or 1 nM.

amino acids of the peptide to alanine, with the exception of the three alanine residues at positions 8, 13, and 15. The binding of 12 mutants to GM3 was investigated by phage ELISA. Seven mutants showed a significant decrease in the binding (Figure 2B). Therefore, two Trp residues (W2 and W3), two Arg residues (R7 and R9), one Gly residue (G6), one Pro residue (P10), and one Val residue (V11) were found to be essential for the binding of GM3. Neu5Ac-Gal Recognition by Synthetic 15-mer Peptides. Binding of the isolated peptides to the Neu5Ac-Gal structure was evaluated using a QCM. The 15-mer peptide amides c01 GWWYKGRARPVSAVA-NH2 and c03 RAVWRHSVATPSHSV-NH2 were chemically synthesized, and their affinity for oligosaccharides was evaluated using a 27 MHz QCM. GM3, GalCer, and GlcCer monolayers were prepared at the air-water interface and transferred to a QCM gold surface. In this condition, since only the sugar moiety is exposed to the peptide solution, only the interaction between peptides and the oligosaccharide moiety of glycolipids could be detected. The amounts (ΔF ) of c01 bound to GM3, GalCer, and GlcCer were plotted as a function of peptide concentrations (Figure 3A). Scatchard analyses of peptides were carried out to determine the dissociation constant (Kd)

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14

4249

Figure 2. GM3-binding activities of peptides detected by phage ELISA. (A) Binding of phage clones to GM3. The c01 clone (closed circles), c03 clone (open circles), or control fd clone (closed triangles) (0.05-5 nM) was incubated with a GM3 monolayer, and the amounts bound (ΔA at 492 nm) were calculated in triplicate. (B) Effect of alanine substitutions on the binding of c01 phages to GM3. The c01 mutant phage clone was incubated with the GM3 monolayer. The amounts of mutants were calculated in triplicate, taking the amount of c01 phage as 100% and the amount of the mixture of randomly mutated phage (Rmix) as 0%. An asterisk indicates statistical significance (p70

48 71 60

1 1.0 0.15 70 >70

13 36

1 0.20 100 NDd NDd

a

Concentration requiring 50% inhibition. b GM1-binding peptide.23 c N-Terminal amino acid sequence of pIII for fd phage. d ND, not determined.

Figure 6. Formation of the molecular assembly of alkylated peptides. (A) Determination of the cmc of C18-c01 with NPN. Fluorescence intensity of NPN is plotted as a function of the concentration of C18-peptide. The intersection of the two straight lines is the cmc. (B) Particle size of the C18-c01 assembly detected by dynamic light scattering method. The mean diameter of C18-c01 is plotted as a function of the concentration of C18-c01. (Inset) Representative histograms showing size distribution of the assembly at 1, 10, and 100 μM.

center). The c03 complex showed a similar localization (data not shown). No fluorescence was found in the case of cp8-avidin complex (Figure 5A, right) and FITC-avidin only (data not shown) as a control. In addition, the binding of the c01-avidin complex decreased as the concentration of Neu5Ac increased (Figure 5B, left and center), whereas no inhibition was found in the presence of 500 mM Glc (Figure 5B, right) or 500 mM Gal (data not shown). Inhibition of the binding by Neu5Ac was observed at 100 mM, a concentration 105 times higher than that for binding of the complex (1 μM) as well as the phage as shown in Figure 4B. These results indicate that the complexes bound to MDCK cells through c01 and c03, suggesting that these peptides have affinity for Neu5Ac-containing glycoconjugates of MDCK cells. Inhibition of Influenza Virus Infection by Alkylated Peptide. Inhibition of the infection of MDCK cells by influenza virus was determined by means of the plaque assay. Synthetic c01 and c03 peptides without alkyl group (peptide-NH2) were used for the inhibition experiments, but no inhibition was found (IC50>500 μM, Table 3). To enhance the binding affinity of peptide by securing multivalent binding ability,33 the N-terminal of peptides was modified with alkyl group to form a molecular assembly.34 Prior to the inhibition experiments, the molecular assembly of the N-stearoyl peptide amides (C18-peptide) was characterized by the determination of critical micelle concentration (cmc) and particle size. Figure 6A shows the results of a typical determination of the cmc of C18-peptide, and the cmc values of all C18-peptides were found to be 0.8-0.9 μM. Formation of the peptide

Figure 7. Inhibition of influenza virus infection by alkylated peptides. MDCK cells were incubated for 30 min with the influenza A/ PR/8/34 (H1N1, left) or A/Aichi/2/68 (H3N2, right) virus in the presence of alkylated peptides. The cells were washed with PBS and incubated with agarose for 2 days. The living cells were stained, and the number of plaques was counted. [C18-peptide] is the concentration of alkylated peptide monomer.

assemblies was also confirmed by the dynamic light scattering method (Figure 6B). The particle sizes of C18-peptide assemblies depended on the concentration and peptide sequence. In the case of C18-c01, the particle size increased from 0.2 to 2.3 μm when the concentrations of C18-c01 were varied from 0.1 to 200 μM. C18-c01 and C18-c03 had a strong inhibitory effect on infection by the influenza A/PR/8/34 (H1N1) virus with an IC50 of 3.2 and 6.5 μM, respectively (Figure 7 and Table 3). The modification of peptides by stearoyl group was clearly required for inhibition. In addition, the reverse sequence of c01 (C18-c01r) and alanine mutants of c01 (C18-c01W2A and C18-c01P10A) had no inhibitory activity (44, 53, and 89 μM for H1N1, respectively). These results indicate that the specific sequences are responsible for the activity. The IC50 values of C18-c03 for the infection by A/Aichi/2/ 68 (H3N2) was 68 μM (Table 3). The inhibitory activity of this peptide against A/Aichi/2/68 was about 10-fold less than that against A/PR/8/34. Though the binding selectivity of HA of influenza virus depends on the virus strains,35,36 the primary event of virus is the binding of HA to glycan cell surface receptors.37 The c01 peptide had a potential to bind to NeuAc-containing glycoproteins (Figure 4C) and glycolipids (Table 2). These results suggested that the binding affinity of peptide for Neu5Ac-containing glycans caused the inhibition of influenza virus binding to the cell surface. Furthermore, we examined the inhibitory activity of sugar-binding proteins such as WGA and c01-avidin complex (Figure 8). WGA is known to recognize Neu5Ac- and GlcNAc-containing glycoconjugates.38 The IC50 value of WGA was 3.4 μM for A/PR/8/34. It was found that the peptides identified in the present study showed effective

4252 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14

Figure 8. Inhibition of influenza virus infection by sugar-binding proteins. MDCK cells were incubated for 30 min with the influenza A/PR/8/34 (H1N1) virus in the presence of c01-avidin complex and WGA. The cells were washed with PBS and incubated with agarose for 2 days. The living cells were stained, and the number of plaques was counted. In the case of the c01-avidin complex, the concentration of peptide-avidin complex is shown (molar ratio of peptide to avidin, 4:1).

Figure 9. Inhibition of FITC-labeled influenza virus binding by alkylated peptides. (A) CLSM images of MDCK cells after the incubation with FITC-labeled influenza virus for 30 min at 37 °C: right, enlarged image. (B) CLSM images of MDCK cells in the presence of C18-c01 (10 μM). The condition of the incubation was same as in Figure 9A. The binding of FITC-labeled influenza virus to MDCK cells was clearly inhibited by C18-c01: right, enlarged image.

inhibitory activity similar to lectin. However, unexpectedly, the c01-avidin complex had no inhibitory activity (IC50>10 μM) (Figure 8). Alkylated Peptide Inhibits the Binding of Virus to Cells. To know how the alkylated peptides inhibit the influenza virus infection, the binding of FITC-labeled virus to MDCK cells was observed by CLSM. Viral proteins were labeled with FITC (see Experimental Section), and the virus obtained was incubated with MDCK cells at 37 °C. After 30 min, strong fluorescence was found in cytoplasm (Figure 9A). The FITClabeled viral proteins are considered to be uptaken by clathrin-mediated (or other) endocytosis and be transported to cytoplasm. In the presence of 10 μM C18-c01, the fluorescence significantly disappeared and only some fluorescent dots and weak fluorescence in cell surface were found (Figure 9B). These results indicate that C18-c01 inhibits the initial binding of virus at infection. Discussion In the present study, the ganglioside GM3 was employed as a target for affinity selection because it has Neu5Ac-Gal

Matsubara et al.

Figure 10. Possible model of inhibition of influenza virus infection by alkylated peptides. The assembly of alkylated peptides inhibits the initial binding of the virus to sialylglycoconjugates on cells.

which is an influenza virus receptor. We eventually identified Neu5Ac-Gal-binding sequences GWWYKGRARPVSAVA (c01) and RAVWRHSVATPSHSV (c03) (Table 1). The incorporation of functional peptides in liposomes would be effective for the inhibition of cell-cell and cell-virus interaction.13,17,39 Generally, the integration of recognition molecules on molecular assemblies such as micelles and liposomes results in an increase in affinity for target molecules by securing multivalent binding ability.33 Here the peptides were modified with an alkyl group for the formation of the molecular assembly.34 The alkylated peptides (C18-peptides) were evaluated as inhibitors of the influenza virus. The C18c01 and C18-c03 peptides inhibited the infection of MDCK cells by the influenza A/PR/8/34 virus with IC50 values of 3.2 and 6.5 μM, respectively (Figure 7 and Table 3). In the case of peptide amides without an alkyl chain, no inhibitory activity was found (IC50 > 500 μM). Therefore, modification of the peptide by an alkyl group was required for inhibitory activity. The results of CLSM using FITC-labeled virus suggested that the inhibitory activity is caused by the inhibition of the virus binding to MDCK cell (Figure 9 and Figure 10). The inhibitory activities of C18-peptide-containing liposomes (C18peptide/phosphatidylcholine/cholesterol = 3:20:10, by mole) were also assayed; however, the activities were lower than those of the corresponding peptide assemblies (IC50 values of c01 and c03 peptides were 360 and 370 μM, respectively) (Supporting Information, Figure S2). To identify amino acid residues that contribute to the binding of GM3, alanine scanning was performed (Figure 2B). We found a WWxxGRxRPV motif in the c01 peptide, which was not the same as the GM1-binding motif (F/W)RxLxxxFx(Q/N)xxxP.40 Unfortunately, the WWxxGRxRPV motif in c01 was not shared by other peptides identified from the round of selection with GM3. However, it was composed of Trp, Arg, Gly, Pro, and Val, which are often found in the site of sugar-binding proteins such as lectins, enzymes, and antibodies.41,42 In general, the hydroxyl group of a carbohydrate simultaneously acts as a hydrogenbond donor and acceptor.41,42 In many cases, the amide bond of the main chain and Arg also act as a hydrogen-bond donor, and the carbonyl or carboxylate group of Neu5Ac is the hydrogen-bond acceptor. Although the ionic bonds between the carboxylate group of Neu5Ac and a basic amino acid (His, Lys, or Arg) may be important for carbohydrate-amino acid interaction, the X-ray structural data show that in many cases, the carboxylate group of Neu5Ac interacts with the amide group of the peptide bond or the polar side chain (Ser or Arg) by hydrogen-bonding.43 In addition, a hydrophobic B face of the galactopyranose ring and the methyl group of Neu5Ac

Article

interact with an aromatic ring of Trp and Phe via van der Waals contacts. Yamamoto et al. reported that a Neu5Acbinding motif (containing Asp, Lys, and Tyr) of natural lectins recognizes Neu5Ac through hydrogen-bond and van der Waals interactions.44 Neu5Ac-recognizing immunoglobulin-superfamily proteins, Siglecs, display Arg and aromatic amino acids (Trp, Tyr, and Phe) for the recognition of Neu5Ac.45 Therefore, it is reasonable that the peptide motif found in the present study recognizes Neu5Ac (and Gal) through a combination of hydrogen-bond and van der Waals interactions. Unexpectedly, the amino acid sequence of the c01 clone was identical to that of one of the GM1-binding peptides (GWWYKGRARPVSAVA).23 In general, phage display selection gives not only target-specific clones but also targetaffinity clones.46,47 The sequences enriched in the selection process would depend on the conditions. The GWWYKGRARPVSAVA peptide binds to both GM1 and GM3.40 Therefore, it is reasonable that GWWYKGRARPVSAVA is isolated from independent selections against GM1 or GM3. In our previous paper, a GM1-binding peptide DFRRLPGAFWQLRQP showed extensive binding to GM3 (119 ng cm-2 at 10 μM).40 The amount of the peptide bound to GM3 was larger than that of c01 peptide (39 ng cm-2 at 10 μM). However, significant inhibitory activity of C18DFRRLPGAFWQLRQP (C18-p1) was not found (Table 3). This result indicates that the inhibitory activity does not simply depend on the amount of peptide bound to glycolipid detected by the QCM method but might depend on the selectivity of the cell surface. Fortunately, since c01 could bind to the Neu5Ac-Gal moiety on the cell surface competitively with the influenza virus, it is considered to inhibit influenza virus infections. The relationship between the inhibitory activity and binding properties of this peptide should be investigated further. Conclusion We have obtained pentadecapeptide sequences that recognize the sialylgalactose moiety through selection using phage library. The peptides have affinity for glycoconjugates on the cell surface. Their binding to the cell resulted in the significant inhibition of influenza virus infections. In spite of disadvantages (less stability, risk of immunogenicity, costly production, etc.), peptide-based drugs are expected to be viable alternatives to antibodies.48 Though the binding affinity needs to be improved for practical use, the peptides selected in the present study would be expected to be candidates for influenza virus inhibitors. Many kinds of pathogenic microorganisms, viruses, and toxins recognize sugar chains on the cell surface.49 The present methodology has the potential to provide peptides that inhibit the sugar-mediated binding of pathogenic molecules. Experimental Section Materials. A ganglioside Neu5AcR2-3Galβ1-4Glcβ110 Cer (GM3) was obtained from Snow Brand Milk Products, Co. Ltd. (Tokyo, Japan). A synthetic GM3 analogue, Neu5AcR2-6Galβ1-4Glcβ1-10 Cer (60 GM3), was prepared as described in a previous paper.50 A phage-displayed random pentadecapeptide library and E. coli K91Kan were obtained as previously described.51 A phage vector, M13KE, and E. coli ER2838 were purchased from New England BioLabs, Inc. (Beverly, MA). Mouse B16 melanoma cells and MDCK cells were obtained from Cell Bank, RIKEN BioResource Center (Tsukuba, Japan).

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14

4253

Human influenza virus strains A/Puerto Rico (PR)/8/34 (H1N1) and A/Aichi/2/68 (H3N2) were kindly provided by Dr. Kyosuke Nagata (University of Tsukuba, Japan). Synthetic Peptides. The pentadecapeptide amides, biotinylated peptide amides, and alkylated peptide amides were synthesized on an automated peptide synthesizer, an ACT357 (Advanced ChemTech) (Louisville, KY) or PSSM-8 (Shimadzu Corp.) (Kyoto, Japan), using standard 9-fluorenylmethyloxycarbonyl (Fmoc) chemistry. For modification of the biotinyl and stearoyl groups, Fmoc-Lys(biotin)-OH (Novabiochem) and stearic acid (C17H35COOH) were linked to the C-terminal and N-terminal, respectively. All synthetic peptide amides were purified by reversed phase high-performance liquid chromatography (RP-HPLC) and lyophilized. The purity (>95%) and expected structure were verified by RP-HPLC and matrix-assisted laser desorption ionization/time-of-flight mass spectrometry. Affinity Selection of Sialylgalactose-Binding Peptides. A lipid solution (chloroform/methanol =2:1, v/v) containing ganglioside GM3 (∼0.5 mg/mL) was spread on TBS (50 mM tris-HCl, 150 mM NaCl, pH 7.5) in a Teflon-coated Langmuir trough (USI Co., Japan). The subphase was maintained at 20 °C. A surface-pressure (π-A) isotherm was monitored by the Wilhelmy plate method. The GM3 monolayer was compressed at a constant rate (10 cm2 min-1) and transferred and mounted horizontally on the gold surface of a QCM (9 MHz, diameter 4.5 mm, area 15.9 mm2) at a surface pressure of 30 mN m-1.24 The QCM was transferred to a handmade plastic tube filled with 1 mL of TBS, and the buffer was maintained at a temperature of 20 °C with stirring. The phages ((6.1-87)1010 TU) in each round of selection) were injected into the cuvette. The time course of binding of the phages (frequency decrease, ΔF) to the monolayer was followed in order to determine the incubation time.23 After 10 min, the binding was almost saturated (Figure 1). The QCM was washed three times with TBS. The phages bound to the lipid monolayer were eluted with 0.1 M Gly-HCl buffer (pH 2.2) for 15 min. The eluate was neutralized with 1 M tris-HCl buffer (pH 9.1) and then amplified by infecting the E. coli K91Kan host bacterial cells. This process was repeated four times, resulting in the enrichment of the GM3-binding phages. The individual phage clones were amplified and precipitated with polyethyleneglycol/NaCl. Each phage clone DNA was purified with a QIAprep Spin M13 kit (QIAGEN) and used as a template for sequencing in order to deduce the amino acid sequence. Binding Analysis of Phage Clones by ELISA. A 24-well plate was blocked with 1% bovine serum albumin (BSA)/TBS in advance and washed three times. A plastic plate (13.5 mm diameter, code MS-92130, Sumitomo Bakelite Co., Ltd.) was attached horizontally to the ganglioside GM3 monolayer prepared as mentioned above. The phage clones (0.05-5 nM in 200 μL of TBS) were incubated for 30 min at 4 °C with the ganglioside monolayer. The other side of the plastic plate was blocked with 0.5% BSA/TBS and washed twice with 0.5% BSA/ TBS. The bound phages were incubated with a 1:2000 (v/v) dilution of anti-fd bacteriophage antibody (Sigma) for 1 h at 4 °C, then labeled with a 1:2000 (v/v) dilution of peroxidaseconjugated antirabbit IgG antibody (Sigma) for 1 h at 4 °C. The color was developed using o-phenylenediamine. The amount of phages (ΔA at 492 nm) showed a simple saturation curve against the phage concentration at 0.05-5 nM (Figure 2A). The relative amount of phages to a control fd clone (ΔA/ΔAfd) is listed in Table 1. The fd phage clone was prepared with the fUSE5 vector and displays no foreign peptide on coat protein III.47 Each experiment was carried out in triplicate. Alanine Scanning by Phage ELISA. Phage clones of c01 peptide and 12 mutants substituted with alanine were prepared with M13KE vector according to a reference.52 Briefly, 98-base oligonucleotides based on the DNA sequence encoding the c01 peptide, 12 mutants, and random mutants were synthesized. As an example,

4254 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14

the sequence of the oligonucleotide encoding the c01 peptide is 50 CATGTTTCGGCCGAACCTCCACCAGCCACAGCAGAAACAGGCCTAGCCCTACCCTTATACCACCAACCAGAGTGAGAATAGAAAGGTACCCGGGCATG-30 . The extension primer, 50 -CATGCCCGGGTACCTTTCTATTCTC-30 , was annealed and extended by the Klenow fragment, and the resulting duplex was digested with Acc65I and EagI (Supporting Information, Table S1). The insert duplex was ligated into M13KE predigested with the same two restriction enzymes, and the product was electroporated into E. coli ER2738. The cells were grown in LB medium to prepare the phages, and the phages were isolated and checked by DNA sequencing. Phage ELISA was performed at 0.05 nM in triplicate as described above. A mixture of phages displaying the c01 sequence mutated randomly, Rmix, was used as a negative control. Quantitative Analysis of the Interaction between Synthetic Peptide and Neu5Ac-Gal Using QCM. A monolayer of GM3, 60 GM3, GalCer, or GlcCer was prepared on a Langmuir-type trough and transferred horizontally onto a QCM electrode (27 MHz, diameter 2.5 mm, area 4.9 mm2). Peptide solutions of 0.1 and 1 mM in TBS were added into the cuvette of a QCM instrument, and the frequency decreases (ΔF, Hz) of the QCM responding to the addition of peptide were followed with time. The linear relationship between -ΔF and the mass increase on the electrode was confirmed previously.53-55 The ΔF value, which is the amount of peptide bound to glycolipid, was obtained at equilibrium (typically 10-20 min, data not shown). Each measurement was repeated two to three times. For Scatchard analysis, the ΔF value was plotted in the form ΔF/[peptide] versus ΔF, where [peptide] is the concentration of peptide in the cuvette (Figure 3B). The Kd and ΔFmax values were calculated from the slope and intercept of the linear relationship, respectively. Cells. Mouse B16 melanoma cells were grown in Dulbecco’s modified Eagle’s medium (ICN Biomedicals, Inc.) supplemented with 10% fetal bovine serum (FBS) (Life Technologies, Inc.), 100 units/mL penicillin G, and 100 μg/mL streptomycin at 37 °C under 5% CO2-95% air. MDCK cells were grown in minimum essential medium Eagle (MEM) (GIBCO BRL) supplemented with 10% FBS (JRH Biosciences), 0.1% NaHCO3, and 15 μg/mL glutamine at 37 °C under 5% CO2-95% air. Flow Cytometry. B16 cells (2105) in the monolayer culture were incubated with 200 μL of serially diluted phage clones ([phage] = 0.5-10 nM) in 1% BSA/phosphate-buffered saline (PBS) for 1 h on ice. After three washes with 1% BSA/PBS, the cells were incubated with 200 μL of a 1:400 (v/v) diluted buffer of anti-fd bacteriophage antibody for 0.5 h on ice. After two washes, the cells were incubated with 200 μL of a 1:400 (v/v) dilution of FITC-conjugated antirabbit IgG antibody (Sigma) for 0.5 h on ice. The FITC-IgG labeled cells were washed two times with 1% BSA/PBS and analyzed using a flow cytometer (EPICS XL, Beckman Coulter). Inhibition by Addition of Monosaccharides. B16 cells (2105) in the monolayer culture were incubated with 200 μL of phage clones ([phage] = 10 nM) in the absence or presence of a monosaccharide, such as Neu5Ac, Glc, or GlcU, at a concentration of 1 mM for 1 h on ice. The cells were washed with 1% BSA/PBS, labeled with FITC-conjugated antibody, and analyzed using a flow cytometer as described in Flow Cytometry. Removal of Neu5Ac from Cells. B16 cells (2  105) in the monolayer culture were treated with 0.05 units of neuraminidase from Arthrobacter ureafaciens (Sigma) for 90 min at 37 °C (pH 6.5 or 7.4). After three washes with 1% BSA/PBS, the cells were incubated with phage clones ([phage] = 10 nM), labeled with FITC-conjugated antibody, and analyzed using a flow cytometer as described in Flow Cytometry. CLSM. MDCK cells were seeded at (1-2)104 cells/dish in glass-bottom dishes (35 mm diameter, IWAKI) and incubated overnight in MEM containing 10% FBS. The cells were washed three times with PBS and incubated with fluorescencelabeled complex or virus at 37 °C. After a wash with PBS, cell

Matsubara et al.

fluorescence was analyzed with a CLSM (TCS-NT, Leica) equipped with a Kr/Ar laser. Biotinylated peptide (peptide-Lys(biotin)-NH2) was mixed with FITC-labeled avidin to prepare a peptide-avidin complex (molar ratio 4:1). The peptide-avidin complex ([complex] = 1 μM in PBS) was incubated with MDCK cells for 10-30 min at 37 °C in the absence or presence of Glc (100 and 500 mM), Gal (100 and 500 mM), or Neu5Ac (1, 10, 50, 100, and 500 mM). A biotinylated peptide, AETVESCLAKPHTENK(biotin)-NH2, was used as a control, where this sequence (cp8) is a 15-amino acid sequence at the N-terminal of a major coat protein VIII of filamentous (M13 and fd) phage. FITC-labeled influenza virus was prepared as described in the literature with minor modification.56 Influenza virus (∼2105 plaque-forming unit (pfu) in 200 μL) was mixed with 1 mg/mL FITC isomer I (Dojindo Molecular Technologies, Inc., Japan) in 0.5 M bicarbonate buffer (pH 9.5) and allowed to react for 1 h at room temperature. The mixed solution was moved to Amicon Ultra-4 centrifugal filter device (30K NMWL, Millipore), and the free FITC was removed by centrifugation at 5000 rpm for 15 min five times. FITC-labeled virus was suspended in PBS (7.5% yield). The FITC-labeled virus (1.5  103 pfu) was incubated with MDCK ((1-2)104 cells/dish) for 30 min at 37 °C in the absence or presence of C18-c01. Formation of Peptide Assembly. To confirm the formation of the peptide assembly, the cmc value and particle size of alkylated peptide amide (C17H35CO-peptide-NH2; C18-peptide) were measured. The cmc values of the alkylated peptides were determined with a fluorescent probe, N-phenyl-1-naphthylamine (NPN).57 C18-Peptide was suspended in PBS containing 1 μM NPN with a vortex mixer and diluted to 1 nM to 0.1 mM. Fluorescence intensity was measured on a fluorescence spectrophotometer (FL-2500, Hitachi, Japan) using a 5 mm cuvette at 25 °C. In the presence of C18-peptide assemblies, the fluorescence emission has a maximum at 450 nm upon excitation at 350 nm. By plotting of the NPN fluorescence intensities against C18-peptide concentrations, the cmc was determined. In addition, C18-peptide was diluted to 0.1 nM to 0.2 mM in PBS; the particle size of peptide assembly was measured by dynamic light scattering method (model HPP5001, MALVERN Instruments, Ltd.). Plaque Assay. To determine the inhibitory activity of peptides, the infection of MDCK cells by the influenza virus was evaluated by plaque assay.32 A C18-peptide stock solution (2 mM or 10 mM) was prepared by dissolving in PBS under stirring with a vortex mixer. MDCK cells in 6-well plates were incubated with 0.2 mL of influenza A/PR/8/34 (H1N1) or A/Aichi/2/68 (H3N2) virus solution (containing 50-200 pfu) in the presence of C18-peptide. After incubation for 30 min at 37 °C under 5% CO2, the supernatant was removed and the cells were washed with PBS. Two milliliters of 0.6% agarose solution containing 0.01% O-(diethylaminoethyl)cellulose-dextran, 10 mM HEPES buffer, 0.01 μg/mL acetyltrypsin, and 0.2% BSA in MEM was added and incubated for 2 days. Live cells were stained with crystal violet (1 mg/mL in 20% ethanol), and the number of plaques was counted. The maximum infection activity ( f = 1) was defined as the number of plaques without peptide, where f is the fraction of infection activity. The IC50 value of C18-peptide was obtained from the plot of log f/(1-f ) versus log [C18-peptide].

Acknowledgment. This work was supported in part by the Ministry of Education, Science, Sports and Culture, Grant-inAid for Scientific Research B (Grant 14380411, T.S.). We thank Prof. K. Yamamoto (Keio University, Japan) for providing the opportunity to use the dynamic light scattering instrument. Supporting Information Available: DNA sequences for preparation of the c01 phage series (Table S1), QCM analysis of the

Article

binding of peptides to 60 GM3 (Figure S1), and inhibition of influenza virus infections by C18-peptide-containing liposomes (Figure S2). This material is available free of charge via the Internet at http://pubs.acs.org.

References (1) Hilleman, M. R. Realities and enigmas of human viral influenza: pathogenesis, epidemiology and control. Vaccine 2002, 20, 3068– 3087. (2) Fouchier, R. A.; Munster, V.; Wallensten, A.; Bestebroer, T. M.; Herfst, S.; Smith, D.; Rimmelzwaan, G. F.; Olsen, B.; Osterhaus, A. D. Characterization of a novel influenza A virus hemagglutinin subtype (H16) obtained from black-headed gulls. J. Virol. 2005, 79, 2814–2822. (3) Wiley, D. C.; Skehel, J. J. The structure and function of the hemagglutinin membrane glycoprotein of influenza virus. Annu. Rev. Biochem. 1987, 56, 365–394. (4) Sauter, N. K.; Bednarski, M. D.; Wurzburg, B. A.; Hanson, J. E.; Whitesides, G. M.; Skehel, J. J.; Wiley, D. C. Hemagglutinins from two influenza virus variants bind to sialic acid derivatives with millimolar dissociation constants: a 500-MHz proton nuclear magnetic resonance study. Biochemistry 1989, 28, 8388–8396. (5) Sato, T.; Serizawa, T.; Okahata, Y. Binding of influenza A virus to monosialoganglioside (GM(3)) reconstituted in glucosylceramide and sphingomyelin membranes. Biochim. Biophys. Acta 1996, 1285, 14–20. (6) Suzuki, Y.; Nakao, T.; Ito, T.; Watanabe, N.; Toda, Y.; Xu, G.; Suzuki, T.; Kobayashi, T.; Kimura, Y.; Yamada, A. Structural determination of gangliosides that bind to influenza A, B, and C viruses by an improved binding assay: strain-specific receptor epitopes in sialo-sugar chains. Virology 1992, 189, 121–131. (7) Suzuki, Y.; Nagao, Y.; Kato, H.; Matsumoto, M.; Nerome, K.; Nakajima, K.; Nobusawa, E. Human influenza A virus hemagglutinin distinguishes sialyloligosaccharides in membrane-associated gangliosides as its receptor which mediates the adsorption and fusion processes of virus infection. Specificity for oligosaccharides and sialic acids and the sequence to which sialic acid is attached. J. Biol. Chem. 1986, 261, 17057–17061. (8) Stevens, J.; Blixt, O.; Tumpey, T. M.; Taubenberger, J. K.; Paulson, J. C.; Wilson, I. A. Structure and receptor specificity of the hemagglutinin from an H5N1 influenza virus. Science 2006, 312, 404–410. (9) Rogers, G. N.; Paulson, J. C.; Daniels, R. S.; Skehel, J. J.; Wilson, I. A.; Wiley, D. C. Single amino acid substitutions in influenza haemagglutinin change receptor binding specificity. Nature 1983, 304, 76–78. (10) Colman, P. M. A novel approach to antiviral therapy for influenza. J. Antimicrob. Chemother. 1999, 44 (Suppl. B), 17–22. (11) Ward, P.; Small, I.; Smith, J.; Suter, P.; Dutkowski, R. Oseltamivir (Tamiflu) and its potential for use in the event of an influenza pandemic. J. Antimicrob. Chemother. 2005, 55 (Suppl. 1), i5–i21. (12) von Itzstein, M.; Wu, W. Y.; Kok, G. B.; Pegg, M. S.; Dyason, J. C.; Jin, B.; Van Phan, T.; Smythe, M. L.; White, H. F.; Oliver, S. W.; Colman, P. M.; Varghese, J. N.; Ryan, D. M.; Woods, J. M.; Bethell, R. C.; Hotham, V. J.; Cameron, J. M.; Penn, C. R. Rational design of potent sialidase-based inhibitors of influenza virus replication. Nature 1993, 363, 418–423. (13) Sato, T.; Sumi, M.; Ogino, K.; Taki, T. Inhibition of influenza virus infection by hemagglutinin-binding peptides. Pept. Sci. 2002, 38, 329–330. (14) Totani, K.; Kubota, T.; Kuroda, T.; Murata, T.; Hidari, K. I. P. J.; Suzuki, T.; Suzuki, Y.; Kobayashi, K.; Ashida, H.; Yamamoto, K.; Usui, T. Chemoenzymatic synthesis and application of glycopolymers containing multivalent sialyloligosaccharides with a poly(L-glutamic acid) backbone for inhibition of infection by influenza viruses. Glycobiology 2003, 13, 315–326. (15) Tsuchida, A.; Kobayashi, K.; Matsubara, N.; Muramatsu, T.; Suzuki, T.; Suzuki, Y. Simple synthesis of sialyllactose-carrying polystyrene and its binding with influenza virus. Glycoconjugate J. 1998, 15, 1047–1054. (16) Reuter, J. D.; Myc, A.; Hayes, M. M.; Gan, Z.; Roy, R.; Qin, D.; Yin, R.; Piehler, L. T.; Esfand, R.; Tomalia, D. A.; Baker, J. R. Jr. Inhibition of viral adhesion and infection by sialic-acid-conjugated dendritic polymers. Bioconjugate Chem. 1999, 10, 271–278. (17) Guo, C. T.; Sun, X. L.; Kanie, O.; Shortridge, K. F.; Suzuki, T.; Miyamoto, D.; Hidari, K. I.; Wong, C. H.; Suzuki, Y. An O-glycoside of sialic acid derivative that inhibits both hemagglutinin and sialidase activities of influenza viruses. Glycobiology 2002, 12, 183–190. (18) Gamblin, S. J.; Haire, L. F.; Russell, R. J.; Stevens, D. J.; Xiao, B.; Ha, Y.; Vasisht, N.; Steinhauer, D. A.; Daniels, R. S.; Elliot, A.;

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14

(19) (20)

(21) (22) (23) (24)

(25)

(26)

(27) (28) (29)

(30)

(31) (32)

(33)

(34) (35)

(36)

(37) (38) (39)

4255

Wiley, D. C.; Skehel, J. J. The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 2004, 303, 1838–1842. Jolly, C. L.; Beisner, B. M.; Holmes, I. H. Rotavirus infection of MA104 cells is inhibited by Ricinus lectin and separately expressed single binding domains. Virology 2000, 275, 89–97. Yang, D.; Haraguchi, Y.; Iwai, H.; Handa, A.; Shimizu, N.; Hoshino, H. Inhibition of adsorption of human T-cell-leukemia virus type 1 by a plant lectin, wheat-germ agglutinin. Int. J. Cancer 1994, 56, 100–105. Harris, M. Monoclonal antibodies as therapeutic agents for cancer. Lancet Oncol. 2004, 5, 292–302. Sears, P.; Wong, C. H. Carbohydrate mimetics: A new strategy for tackling the problem of carbohydrate-mediated biological recognition. Angew. Chem., Int. Ed. 1999, 38, 2300–2324. Matsubara, T.; Ishikawa, D.; Taki, T.; Okahata, Y.; Sato, T. Selection of ganglioside GM1-binding peptides by using a phage library. FEBS Lett. 1999, 456, 253–256. Sato, T.; Serizawa, T.; Ohtake, F.; Nakamura, M.; Terabayashi, T.; Kawanishi, Y.; Okahata, Y. Quantitative measurements of the interaction between monosialoganglioside monolayers and wheat germ agglutinin (WGA) by a quartz-crystal microbalance. Biochim. Biophys. Acta 1998, 1380, 82–92. Iwabuchi, K.; Zhang, Y.; Handa, K.; Withers, D. A.; Sinay, P.; Hakomori, S. Reconstitution of membranes simulating “glycosignaling domain” and their susceptibility to lyso-GM3. J. Biol. Chem. 2000, 275, 15174–15181. Iwabuchi, K.; Yamamura, S.; Prinetti, A.; Handa, K.; Hakomori, S. GM3-enriched microdomain involved in cell adhesion and signal transduction through carbohydrate-carbohydrate interaction in mouse melanoma B16 cells. J. Biol. Chem. 1998, 273, 9130–9138. Moretti, S.; Montorfano, G.; Rapelli, S.; Berra, B. Prolonged in vitro culture modifies the surface lipid composition of murine melanoma cell lines. Ital. J. Biochem. 1997, 46, 187–194. Schroeder, F.; Gardiner, J. M. Membrane lipids and enzymes of cultured high- and low-metastatic B16 melanoma variants. Cancer Res. 1984, 44, 3262–3269. Corfield, A. P.; Higa, H.; Paulson, J. C.; Schauer, R. The specificity of viral and bacterial sialidases for alpha(2-3)- and alpha(2-6)linked sialic acids in glycoproteins. Biochim. Biophys. Acta 1983, 744, 121–126. Taki, T.; Kasama, T.; Handa, S.; Ishikawa, D. A simple and quantitative purification of glycosphingolipids and phospholipids by thin-layer chromatography blotting. Anal. Biochem. 1994, 223, 232–238. Stray, S. J.; Cummings, R. D.; Air, G. M. Influenza virus infection of desialylated cells. Glycobiology 2000, 10, 649–658. Nakazawa, M.; Kadowaki, S. E.; Watanabe, I.; Kadowaki, Y.; Takei, M.; Fukuda, H. PA subunit of RNA polymerase as a promising target for anti-influenza virus agents. Antiviral Res. 2008, 78, 194–201. Onda, M.; Yoshihara, K.; Koyano, H.; Ariga, K.; Kunitake, T. Molecular recognition of nucleotides by the guanidinium unit at the surface of aqueous micelles and bilayers. A comparison of microscopic and macroscopic interfaces. J. Am. Chem. Soc. 1996, 118, 8524–8530. Sankaram, M. B. Membrane interaction of small N-myristoylated peptides. Implications for membrane anchoring and proteinprotein association. Biophys. J. 1994, 67, 105–112. Suzuki, Y.; Ito, T.; Suzuki, T.; Holland, R. E. Jr.; Chambers, T. M.; Kiso, M.; Ishida, H.; Kawaoka, Y. The hemagglutinins of the human influenza viruses A and B recognize different receptor microdomains. Biochim. Biophys. Acta 1987, 903, 417–424. Suzuki, T.; Horiike, G.; Yamazaki, Y.; Kawabe, K.; Masuda, H.; Miyamoto, D.; Matsuda, M.; Nishimura, S. I.; Yamagata, T.; Ito, T.; Kida, H.; Kawaoka, Y.; Suzuki, Y. Swine influenza virus strains recognize sialylsugar chains containing the molecular species of sialic acid predominantly present in the swine tracheal epithelium. FEBS Lett. 1997, 404, 192–196. Suzuki, Y. Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses. Biol. Pharm. Bull. 2005, 28, 399–408. Bhavanandan, V. P.; Katlic, A. W. The interaction of wheat germ agglutinin with sialoglycoproteins. The role of sialic acid. J. Biol. Chem. 1979, 254, 4000–4008. Takikawa, M.; Kikkawa, H.; Asai, T.; Yamaguchi, N.; Ishikawa, D.; Tanaka, M.; Ogino, K.; Taki, T.; Oku, N. Suppression of GD1alpha ganglioside-mediated tumor metastasis by liposomalized WHW-peptide. FEBS Lett. 2000, 466, 381–384.

4256 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 14 (40) Matsubara, T.; Iijima, K.; Nakamura, M.; Taki, T.; Okahata, Y.; Sato, T. Specific binding of GM1-binding peptides to high-density GM1 in lipid membranes. Langmuir 2007, 23, 708–714. (41) Lis, H.; Sharon, N. Lectins: Carbohydrate-specific proteins that mediate cellular recognition. Chem. Rev. 1998, 98, 637–674. (42) Quiocho, F. A. Protein-carbohydrate interactions. Basic molecular-features. Pure Appl. Chem. 1989, 61, 1293–1306. (43) Weis, W. I.; Drickamer, K. Structural basis of lectin-carbohydrate recognition. Annu. Rev. Biochem. 1996, 65, 441–473. (44) Yamamoto, K.; Konami, Y.; Irimura, T. Sialic acid-binding motif of Maackia amurensis lectins. J. Biochem. (Tokyo) 1997, 121, 756–761. (45) Varki, A.; Angata, T. Siglecs;the major subfamily of I-type lectins. Glycobiology 2006, 16, 1R–27R. (46) Scott, J. K.; Smith, G. P. Searching for peptide ligands with an epitope library. Science 1990, 249, 386–390. (47) Smith, G. P.; Scott, J. K. Libraries of peptides and proteins displayed on filamentous phage. Methods Enzymol. 1993, 217, 228–257. (48) Ladner, R. C.; Sato, A. K.; Gorzelany, J.; de Souza, M. Phage display-derived peptides as therapeutic alternatives to antibodies. Drug Discovery Today 2004, 9, 525–529. (49) Karlsson, K. A. Animal glycosphingolipids as membrane attachment sites for bacteria. Annu. Rev. Biochem. 1989, 58, 309–350. (50) Hasegawa, A.; Ogawa, M.; Kiso, M. Synthetic studies on sialoglycoconjugates. Part 35. Synthesis of a ganglioside GM3 position

Matsubara et al.

(51)

(52) (53) (54)

(55) (56) (57)

isomer, N-acetylneuraminosyl-a(2f6)-lactosyl-b(1f1)-ceramide. Biosci. Biotechnol. Biochem. 1992, 56, 535–536. Nishi, T.; Budde, R. J.; McMurray, J. S.; Obeyesekere, N. U.; Safdar, N.; Levin, V. A.; Saya, H. Tight-binding inhibitory sequences against pp60(c-src) identified using a random 15-amino-acid peptide library. FEBS Lett. 1996, 399, 237–240. Noren, K. A.; Noren, C. J. Construction of high-complexity combinatorial phage display peptide libraries. Methods 2001, 23, 169–178. Ebara, Y.; Okahata, Y. A Kinetic-study of concanavalin-a binding to glycolipid monolayers by using a quartz-crystal microbalance. J. Am. Chem. Soc. 1994, 116, 11209–11212. Okahata, Y.; Niikura, K.; Sugiura, Y.; Sawada, M.; Morii, T. Kinetic studies of sequence-specific binding of GCN4-bZIP peptides to DNA strands immobilized on a 27-MHz quartz-crystal microbalance. Biochemistry 1998, 37, 5666–5672. Niikura, K.; Matsuno, H.; Okahata, Y. Direct monitoring of DNA polymerase reactions on a quartz-crystal microbalance. J. Am. Chem. Soc. 1998, 120, 8537–8538. Yoshimura, A.; Ohnishi, S. Uncoating of influenza virus in endosomes. J. Virol. 1984, 51, 497–504. Brito, R. M.; Vaz, W. L. Determination of the critical micelle concentration of surfactants using the fluorescent probe N-phenyl-1-naphthylamine. Anal. Biochem. 1986, 152, 250–255.